|
|
||||||||
1 From the Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Kyoto, Japan; and the 2 Department of Perinatology, Institute for Developmental Research, Aichi Human Service Center, Kasugai, Aichi, Japan.
Abstract
PURPOSE. To identify the expression of neurocan, a nervous tissuespecific chondroitin sulfate proteoglycan, in retina and to elucidate its changes during development.
METHODS. Expressional changes of neurocan mRNAs in developing rat retinas were investigated by a semiquantitative reverse transcriptionpolymerase chain reaction (RTPCR). The localization and characterization of neurocan core proteins were also investigated with the use of Western blot analysis and immunohistochemistry.
RESULTS. Gene expression of neurocan was identified in retinas by RTPCR. Semiquantitative analysis using Southern blot analysis revealed that mRNA expression for neurocan increased at increasing postnatal stages and that it reached its peak around postnatal day 7 (P7). Immunohistochemical studies demonstrated that in differentiating rat retinal (neuroblast) cells weak neurocan immunoreactivities were observed throughout the retina on embryonal days 14 (E14) and E16. During the early postnatal period, the immunoreactivities became most conspicuous in the inner and outer plexiform layers on P7 through P14. In adult retinas, only faint immunostaining was detected. Immunoblot analysis showed two positive bands of 220- and 150-kDa core glycoproteins after treatment with chondroitinase ABC. Further immunoblot analysis revealed that the expression of these two immunolabeled variants was regulated differently during retinal development.
CONCLUSIONS. The temporal and spatial regulation of expression of neurocan and its proteolytic variant during retinal development suggest that it may play a role in differentiation and neural network formation.
Proteoglycans are some of the major constituents of the extracellular matrix and are composed of a core protein molecule to which glycosaminoglycans (GAGs) are covalently linked as side chains.1 2 They are classified into several groups (e.g., chondroitin sulfate, heparan sulfate, dermatan sulfate, and keratan sulfate proteoglycans) on the basis of their GAG side chains. Varner and associates3 4 have clearly demonstrated, by histochemical and biochemical studies, the presence of chondroitin sulfate and heparan sulfate GAGs in mammalian retinas, especially in the interphotoreceptor matrix. In addition, recent molecular biological studies have revealed the molecular characterization of a number of proteoglycan core proteins. Since then, biological activities of proteoglycans have been intensively studied, on the basis of characterizations of their core proteins.1 In developing brain, a diverse set of proteoglycan core proteins is present and precisely regulated,5 6 which suggests an important role in the development and maintenance of neural networks. In neural tissues, proteoglycans have been shown to elicit an alteration in neurite outgrowth, neural cell adhesion, and differentiation.5 6 Accordingly, characterization of retinal proteoglycans is necessary to better understand both developmental and pathologic processes. Knowledge about proteoglycan core proteins in the retina is limited.7 8 However, it is known that a nervous tissuespecific proteoglycan, neurocan, is the major proteoglycan in the brain9 and that it regulates neurite outgrowth and cell adhesion in neural tissues.10 11 It is also possible that neurocan plays a pivotal role in formation of the neural network. However, to date, there are no conclusive data regarding the expression of neurocan in the retina. It has been reported that a neurocan-derived C-terminal product (also called chondroitin sulfate proteoglycan [CSPG]-150 or neurocan-C) is created in rat brain by proteolytic processes and that it ultimately becomes the major form and has biological activities similar to full-length neurocan.12 In a previous study, a monoclonal antibody (MAb 1G2) recognizing both a 220-kDa glycoprotein (full-length neurocan) and a 150-kDa glycoprotein (C-terminal half proteolytic product of neurocan) was raised.13 Herein, we report on the gene expression and localization of neurocan core protein in the retina and show alterations in the distribution and amount in the developing retina.
Methods
Retinal RNA Isolation and cDNA Synthesis
Wistar rats at various stages of development were killed by
intraperitoneal overdose injection of pentobarbital. After enucleation
of the eyes, neural retinas were removed by scissors and forceps under
an operating microscope. Total RNA was isolated from the retinas by the
acid guanidium thiocyanatephenolchloroform extraction
method.14
The extracted RNA was used to synthesize
template cDNAs for subsequent reverse
transcriptioninitiatedpolymerase chain reaction (RTPCR)
experiments with the use of reverse transcriptase (Super Script RNase
H-Reverse Transcriptase; GIBCOBRL, Life Technologies, Gaithersburg,
MD). All animals were given water and food ad libitum. All studies were
conducted in accordance with the ARVO Statement for the Use of Animals
in Ophthalmic and Vision Research.
PCR and Subsequent Southern Blot Analysis
PCR was carried out by the method of Saiki et al.,15
slightly modified as described previously.16
In PCR
experiments for the neurocan gene, the following conditions were used:
denaturation at 95°C for 30 seconds, annealing at 65°C for 30
seconds, and polymerization at 72°C for 1 minute for 40 cycles.
Primers used in this study were designed from N terminus of the
reported sequences of rat neurocan gene,17
sequences of
the sense and the antisense primers were AGGAGCCAGCTCCAGTATGG and
TTGGCTCTGTGCCGGGGATA, respectively. Possible contamination of the
genomic sequence was determined by running parallel control experiments
without the use of reverse transcriptase. Rat brain RNAs were used as
positive controls. After the PCR, the products were separated by 2%
agarose gel electrophoresis and then subjected to Southern blot
analysis. In Southern blot analysis, the amplified products were
separated by 2% agarose gel electrophoresis and transferred to a
membrane, Hybond-N+ (Amersham, Buckinghamshire, England) by the
capillary transfer method with 20x SSC. Synthesized internal
oligonucleotide probe (the sequence, TGCTGTGGCTGCTTCTCCTA) was labeled
by ECL 3'-oligolabeling and detection systems (Amersham) to confirm the
identity of the PCR product and to exclude the nonspecific bands.
Semiquantitative RTPCR
Extraction of total RNA from rat retinas and creation of
first-strand cDNA were performed as described above. cDNA concentration
was normalized to ß-actin gene expression in a manner similar to that
described previously,18
using specific primers to
ß-actin: AGCTGAGAGGGAAATCGTGC (sense) and ACCAGACAGCACTGTGTTGG
(antisense).19
For PCR experiments, the following
conditions were used: denaturation at 95°C for 30 seconds, annealing
at 65°C for 30 seconds, and polymerization at 72°C for 1 minute for
19 cycles (ß-actin primers) or 29 cycles (neurocan primers). After
the reaction, the products were separated by 2% agarose gel
electrophoresis as described above. To investigate relative levels of
neurocan gene expression, a semiquantitative analysis was carried out
using Southern blot analysis after RTPCR. Optical densities of
hybridizing bands were measured by a Power Macintosh G3 computer
(Apple, Cupertino, CA) and NIH Image 1.59 software. A standard curve
was generated from the optical densities of hybridizing bands from
serial dilutions of template cDNAs, and the linearity of the created
standard curve among the selected concentrations was confirmed. The
relative levels of mRNA expression were calculated as a ratio to the
control (adult rat retina on postnatal day 42 [P42]).
Preparation of Sections for Immunohistochemistry
Embryonal and postnatal Wistar rats were killed by intraperitoneal
overdose injection of pentobarbital, and the eyes were enucleated. The
enucleated eyes were fixed for 2 hours at 4°C with 4%
paraformaldehyde in phosphate-buffered saline (PBS) with gentle
shaking, washed for 5 minutes in PBS, then gently shaken overnight at
4°C in 30% sucrose/PBS before freezing on powdered dry ice. Sections
(16 µm) were cut using a cryostat and collected onto silanized slides
(DAKO JAPAN, Kyoto, Japan).
Immunohistochemistry
Retinal sections were circled with a PAP pen (DAKO Pen; DAKO
JAPAN) to form a hydrophobic barrier to solutions, fixed for 30 minutes
in 3% paraformaldehyde/1% sucrose/1 mM magnesium chloride
hexahydrate/0.1 mM calcium chloride dihydrate/PBS, then rinsed twice
for 3 minutes each in PBS. Slides were incubated in cold methanol
(-20°C) for 15 minutes and then washed three times for 3 minutes
each in PBS. Sections were covered for 15 minutes with 50 mM glycine in
PBS, then rinsed for 3 minutes in PBS before covering each slide for 1
hour with blocking solution (2% bovine serum albumin [BSA]/2% horse
normal serum/2% goat normal serum in PBS). After slides were washed
for 3 minutes in PBS, sections were incubated overnight at 4°C in a
humidified chamber with primary antibody. The specificity of the
anti-neurocan monoclonal antibody (MAb 1G2) has been described
previously.13
Sections were rinsed three times for 3
minutes each in PBS to remove the primary antibody. Sections were then
incubated for 1 hour at room temperature with the secondary antibody,
fluorescein-conjugated horse anti-mouse IgG (Vector Laboratories,
Burlingame, CA), and washed six times for 3 minutes each in
PBS. Sections were mounted in Vectashield (Vector Laboratories), and
the slides were examined under a confocal microscopy LSM410 (Carl
Zeiss, Oberkochen, Germany). Also, in an effort to identify the cell
origin of the neurocan-expressing cells in the retina, in addition to
MAb 1G2, anti-vimentin IgM and antiS-100ß polyclonal antibodies
were used for doublestaining technique.
Sample Preparation for Western Blot Analysis
Retinal tissue (30 mg wet weight) at embryonal and postnatal
stages was homogenized in 50 µl ice-cold PBS containing 10 mM
N-ethylmaleimide (NEM), 20 mM EDTA, and 2 mM phenylmethylsulfonyl
fluoride (PMSF). The homogenate was mixed with 200 µl of 20 mM
TrisHCl buffer (pH 7.5) containing 2% sodium dodecyl sulfate (SDS),
10 mM NEM, 20 mM EDTA, and 2 mM PMSF and boiled for 5 minutes. The
concentration of an aliquot (10 µl) of the boiled solution was
measured by Bio-Rad DC protein assay (Bio-Rad Laboratories,
Tokyo, Japan). A 100 µl aliquot (200 µg) of the solution
was mixed with 300 µl of 95% ethanol containing 1.3% potassium
acetate and incubated for 1 hour on ice followed by centrifugation at
14,000 rpm for 15 minutes. The pellet was washed with 400 µl of 70%
ethanol containing 1.0% potassium acetate and recentrifuged. Finally,
the pellet was dried using the vacuum pump.
Chondroitinase Treatment
Protease-free chondroitinase ABC (Seikagaku, Tokyo, Japan) was
used to remove the chondroitin sulfate chains from the core protein. To
the pellet was added 119 µl of distilled water, followed by the
addition of 15 µl of TrisHCl buffer (1 M, pH 7.5) including 0.3 M
sodium acetate, 4 µl of inhibitor mixture-I (20 mM PMSF/7.2 mM
pepstatin), 8 µl of inhibitor mixture-II (0.1 M EDTA/0.1 M NEM), and
4 µl of the enzyme solution (0.01 U/µl). The mixture (total 150
µl) was incubated at 37°C for 2 hours. The enzyme reaction was
stopped by adding 450 µl of 95% ethanol containing 1.3% potassium
acetate. The mixture was then centrifuged at 14,000 rpm for 15 minutes,
and the precipitated material was used as the sample for immunoblot
analysis.
Immunoblot Analysis
To each precipitated material was added 20 µl of distilled
water, 20 µl of the sample buffer (0.1 M TrisHCl/4% SDS/20%
glycerol/0.002% bromophenol blue), and 20 µl of the sample buffer
containing 1.5% dithiothreitol. Fifteen microliters of the sample was
electrophoresed by SDSpolyacrylamide gel electrophoresis on a 3%
stacking gel and a 6% separating gel. The proteins separated by
electrophoresis were electrotransferred onto a polyvinylidene
difluoride membrane (Millipore, Bedford, MA). The membrane was
incubated in blocking solution (2% BSA/2% horse normal serum/2% goat
normal serum in PBS) for 1 hour at room temperature. After the membrane
was washed with PBS for 5 minutes, it was immunoblotted with the
primary antibody (MAb 1G2) at room temperature for 2 hours. The
membrane was washed in PBS three times for 5 minutes each, followed by
incubation in the secondary antibody for 30 minutes at room
temperature. The membrane was again washed with PBS several times, and
the immunoblotted protein bands were detected by using
chemiluminescence reagent (NENT Life Science
Products, Boston, MA) and Hyperfilm ECL (Amersham). The
optical densities of immunoreactive bands were measured by a
computer-supported analysis, as described above.
Results
RTPCR Experiments
RTPCR using primers specific to neurocan showed that cDNA
fragments of the expected length (378 bp) were amplified in experiments
using rat retina and brain cDNAs, whereas control PCR experiments
without the use of reverse transcriptase did not show any bands (Fig. 1
A). Southern blot analysis using an internal oligonucleotide probe was
performed in an attempt to confirm the origin of the products amplified
by RTPCR. This showed that the amplified PCR products of the expected
length hybridized with internal probes (Fig. 1B)
, indicating that they
were derived from the expected sequence of rat neurocan core protein
gene.
|
|
|
|
|
Immunoblot Analysis
To characterize the specificity of the anti-neurocan antibody (MAb
1G2) used in this study, we carried out an immunoblot analysis (Fig. 6)
. Immunoblot analysis using retinal preparations at P0 and P21 and
brain preparations at P42, without the use of enzymatic treatment,
showed diffuse smear-like bands around 200 to 300 kDa. In immunoblot
experiments for proteoglycans, it is well known that diffuse bands are
caused by GAG side chains of various sizes bound to a core protein.
Thus, in an effort to characterize GAG side chains linked to
neurocan core proteins, after the treatment of retinal
preparations with protease-free chondroitinase ABC to remove
chondroitin sulfate side chains, similar immunoblot experiments
were conducted. In both retinal preparations and cerebral samples,
immunoblot analysis demonstrated two conspicuous bands. The molecular
weights of the two bands were 220 and 150 kDa, which agree with
the known molecular weights of neurocan core glycoprotein and its
proteolytic C-terminal product.
|
|
In an effort to calculate proteolytic activities in retinas during development, the relative ratio of the measured optical densities of 150 and 220 kDa bands at each developmental stage (E16P21) was calculated (Fig. 7D) . On E16, immunolabeled bands of 220 kDa were predominant, and the relative ratio of optical density of the 150-kDa band to that of the 220-kDa band was 0.1 ± 0.1 (mean ± SEM). From E18 through P3, the relative ratios were between 0.9 and 1.1, suggesting that the two forms are equally expressed during these early developmental stages. After the peak of the intensities of the 220-kDa bands on P3, the bands of 150 kDa (possible proteolytic C-terminal product of neurocan) became predominant. Accordingly, the relative ratio of optical density of the 150-kDa band to that of the 220-kDa band increased to the maximum on P21 (4.5 ± 0.9). Then, as retinal tissues matured, both bands gradually became much more faint.
Discussion
Neurocan is a nervous tissuespecific proteoglycan and is the major component of CSPG in the brain.9 It has been shown previously that neurocan regulates neurite outgrowth and cell adhesion in neural tissues.10 11 Among a number of proteoglycans, CSPG is regarded as one of the most important neurotrophic factors for retinal neuronal cells, because rat superior colliculus-derived CSPG promotes survival of retinal ganglion cells.20 It is thus likely that neurocan is a neurotrophic factor for retinal ganglion cells. In previous reports,21 although immunohistochemical experiments suggested the presence of neurocan in rat retinas, the same group concluded that the immunostaining in retinas is possibly nonspecific because of equally evident staining even with the use of secondary antibody alone.22 Thus, there have been no conclusive data regarding the identification and characterization of neurocan in the retina. In this study, we investigated the expression of a nervous tissue-specific CSPG, neurocan, in developing rat retinas.
Our studies demonstrated the expression of mRNAs and core proteins of neurocan in the retina. RTPCR experiments in this study indicated the presence of mRNA expression of the neurocan gene in the retina as well as in the brain. Subsequent Southern blot analysis using an internal oligonucleotide probe showed that the amplified PCR products were derived from the expected rat neurocan gene sequence. In addition, immunohistochemical studies demonstrated the existence of this core protein in rat retinas, which is consistent with the results from the above-mentioned RTPCR studies. In rat retinas, our immunohistochemical studies showed neurocan core protein immunoreactivities in the inner retinal layers, and immunoblot analysis demonstrated a diffuse band at approximately 200 to 300 kDa, which agrees with similar experiments using rat brain tissues. It is very likely that the diffuse nature of the immunoreactive band reflects various sizes of GAG moieties linked to the core proteins. This hypothesis is supported by the fact that, after treatment with chondroitinase ABC for the chondroitin sulfate GAG side chains, similar experiments showed two major bands of 220 and 150 kDa, which correspond to the expected molecular weights of neurocan core glycoprotein and its C-terminal proteolytic products, respectively. At present, it has been reported that there are three proteolytic products, 90-kDa and 130-kDa N-terminal fragments and a 150-kDa C-terminal fragment in postnatal rat brain.23 In this study, we used a monoclonal antibody, MAb 1G2, that can recognize both full-length neurocan and its C-terminal half proteolytic product, as described elsewhere.13 Thus, we conclude that retinal neurocan immunoreactivities shown by immunohistochemical studies using the MAb 1G2 antibody are indeed derived from the expected proteins of neurocan and its related proteolytic variant. We thus concluded that neurocan (and its proteolytic C-terminal product) is expressed in the rat retina as well as in the rat brain.
Our immunohistochemical studies revealed spatial changes in the expression of neurocan core protein in the retina. On E16, when retinal tissues were composed of uniform retinal (neuroblast) cells and when ganglion cells begin to differentiate, neurocan immunoreactivities are homogeneous and relatively faint. Near birth (E18P3), when ganglion cells and their nerve fibers are undergoing differentiation and maturation, in the innermost layers such as NFL and GCL the neurocan immunoreactivities are most conspicuous, and then (P7P42) immunostaining intensities gradually decrease. On P7, when formation of the IPL was observed, the intensities of neurocan immunoreactivities in this layer become quite strong, in contrast to the decrease seen in the NFL and GCL. Similar associations between neurocan immunoreactivities and the formation of a neuronal layer were observed in the developing OPL between P7 and P14. In adult (P42) rat retinas, as all retinal layers complete development, neurocan immunoreactivities decrease throughout the retina. In developing rat retinas, it is well known that the differentiation of retinal cell types and the formation of retinal layers develop gradually from inner to outer layers, even after birth.24 25
In general, neurocan has been suggested to be synthesized by neurons.26 However, an immunoelectromicroscopic study showed that a 130-kDa proteolytic variant is localized in the cytoplasm of glial cell processes in the rat cerebrum.27 Our immunohistochemical results revealed the presence of neurocan immunoreactivities in radial cells of P7 rat retinas. Radial staining pattern implies that cell origin for the immunoreactivities may be derived from retinal Müller cells. Thus, in an attempt to investigate this possibility, we carried out further immunohistochemical studies with the use of double-staining techniques using cell type markers (vimentin as well as S-100ß). However, because of a different time course during the retinal development in the expression of neurocan and cell type markers28 (vimentin and S-100ß), we were unable to draw any conclusion on this issue. Further studies will be needed for exact identification of cell origin of neurocan-expressing retinal cells.
On the other hand, neurocan is involved in a number of processes of neural development. For example, cell biological studies showed that neurocan inhibits/promotes neurite outgrowth in a manner dependent on the environment surrounding cultured neural cells.10 Neurocan inhibits neurite-promoting and neural adhesion effects of a number of cell adhesion molecules (CAM), such as L1/NgCAM, N-CAM, and tenascin.11 12 29 Balsamo and associates30 have reported that a chicken retinal CSPG regulates cellular responses to cadherin, another cell adhesion molecule related to neural network formation. In a review article by Margolis et al.,26 this retinal CSPG was hypothesized to be identical to neurocan because they have the same molecular size and amino acid sequence data from CNBr peptides. Also, in cocultures of rat embryonal retina and diencephalon, retinal axons invade the thalamus, although they are repulsed by the hypothalamus under physiological conditions.31 Immunohistochemical studies revealed that the neurocan staining intensity changes at the border between the thalamus and the hypothalamus, suggesting that neurocan may play a pivotal role in neural networks of the retina. Thus, our immunohistochemical studies, in addition to the above-mentioned findings, suggest that neurocan, its related proteolytic product, or both may regulate neuronal outgrowth and subsequent formation of neural networks in rat retinas during development.
Our molecular biological and biochemical studies showed that the expression of neurocan and its proteolytic variant is regulated in rat retinas temporally as well as spatially. Our semiquantitative RTPCR experiments showed that mRNA expression for the neurocan gene is found on E16, that mRNA expression gradually increases during early postnatal stages, and that it reaches its peak between P7 and P14. Then, as retinal differentiation and the formation of neural networks are developed, mRNA expression for neurocan decreases rapidly to the minimum at adult (matured) status on P42. Around P7 and P14, formation of networks between retinal neuronal cells proceeds, especially in the IPL and OPL, which agrees with pronounced neurocan immunoreactivities in these synaptic regions at P7 and P14, as described before. Accordingly, our results suggest that mRNA expression and localization of proteins are closely related to the formation of neural networks in the retina. However, one important point to which we should pay attention is the existence of proteolytic variants of neurocan. In the adult rat brain, neurocan of 220 kDa is cleaved between amino acid residues 638 and 639 by proteolysis17 and results in the formation of two proteolytic products of 150 and 130 kDa.32 Although neurocan and its proteolytic C-terminal variant (also called as CSPG-150 or neurocan-C) have similar biological activities, neurocan has been shown to be more effective than the proteolytic C-terminal variant in binding to NgCAM/11.12 Thus, the proteolytic cleavage of neurocan may play an important role in neural network formation. Because the change from full-length neurocan to proteolytic C-terminal variant is caused by a proteolytic process, our results from RTPCR experiments on temporally regulated mRNA expression should be regarded as a summation of neurocan and its proteolytic C-terminal variant. Our results demonstrated that the production of neurocan core proteins starts before E16 and reaches its peak at an early postnatal stage (P3). On the other hand, abundant amounts of the proteolytic variant are found transiently in early postnatal stages, then reach a peak at P14 and rapidly diminish in mature stages. Because the predominant variant in the retina is a 150-kDa proteolytic product between P7 and P21, the supposed peak of the summation of both neurocan and its proteolytic C-terminal variant in developing retina is thought to be around P14, which agrees with the possible peak of mRNA expression between P7 and P14. These findings suggest that proteolytic events in the retina are activated around P7 and P14 when mRNA expression reaches its peak and strong neurocan immunoreactivities are shown in synaptic regions. Our results indicate that temporal regulation of the proteolytic processes against neurocan may be different in the retina than in brain because it has been reported9 13 that the proteolytic variants are the predominant form in the mature brain.
In conclusion, we have demonstrated the expression of mRNAs and core proteins for neurocan (and its proteolytic variant) in the rat retina. Our results show that in developing rat retina the expression of neurocan is regulated both temporally and spatially, which suggests that it may play an important role in the differentiation of and neural network formation in the mammalian retina.
Footnotes
Supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports, and Culture, Japan.
Submitted for publication December 3, 1998; revised April 2, 1999; accepted April 21, 1999.
Proprietary interest category: N.
Corresponding author: Hidenobu Tanihara, Department of Ophthalmology, Tenri Yorozu Hospital, 200 Mishima-cho, Tenri, Nara, 632-8552 Japan. E-mail: tanihara@pearl.ocn.ne.jp
References
gene is expressed in cultured human retinal pigment epithelial cells Biochem Biophys Res Commun 189,66-71[Medline][Order article via Infotrieve]
This article has been cited by other articles:
![]() |
B. Tucker, H. Klassen, L. Yang, D. F. Chen, and M. J. Young Elevated MMP Expression in the MRL Mouse Retina Creates a Permissive Environment for Retinal Regeneration Invest. Ophthalmol. Vis. Sci., April 1, 2008; 49(4): 1686 - 1695. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, A. K. Kardaszewska, T. van Veen, U. Rauch, and M.-T. R. Perez Integration between Abutting Retinas: Role of Glial Structures and Associated Molecules at the Interface Invest. Ophthalmol. Vis. Sci., December 1, 2004; 45(12): 4440 - 4449. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, U. Rauch, and M.-T. R. Perez Accumulation of Neurocan, a Brain Chondroitin Sulfate Proteoglycan, in Association with the Retinal Vasculature in RCS Rats Invest. Ophthalmol. Vis. Sci., March 1, 2003; 44(3): 1252 - 1261. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Inatani, M. Honjo, A. Oohira, N. Kido, Y. Otori, Y. Tano, Y. Honda, and H. Tanihara Spatiotemporal Expression Patterns of N-Syndecan, a Transmembrane Heparan Sulfate Proteoglycan, in Developing Retina Invest. Ophthalmol. Vis. Sci., May 1, 2002; 43(5): 1616 - 1621. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Inatani, M. Honjo, Y. Otori, A. Oohira, N. Kido, Y. Tano, Y. Honda, and H. Tanihara Inhibitory Effects of Neurocan and Phosphacan on Neurite Outgrowth from Retinal Ganglion Cells in Culture Invest. Ophthalmol. Vis. Sci., July 1, 2001; 42(8): 1930 - 1938. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Inatani, H. Tanihara, A. Oohira, Y. Otori, A. Nishida, M. Honjo, N. Kido, and Y. Honda Neuroglycan C, a Neural Tissue-Specific Transmembrane Chondroitin Sulfate Proteoglycan, in Retinal Neural Network Formation Invest. Ophthalmol. Vis. Sci., December 1, 2000; 41(13): 4338 - 4346. [Abstract] [Full Text] |
||||
![]() |
M. Inatani, H. Tanihara, A. Oohira, M. Honjo, N. Kido, and Y. Honda Upregulated Expression of Neurocan, a Nervous Tissue Specific Proteoglycan, in Transient Retinal Ischemia Invest. Ophthalmol. Vis. Sci., August 1, 2000; 41(9): 2748 - 2754. [Abstract] [Full Text] |
||||
![]() |
M. Inatani, H. Tanihara, A. Oohira, M. Honjo, N. Kido, and Y. Honda Spatiotemporal Expression Patterns of 6B4 Proteoglycan/Phosphacan in the Developing Rat Retina Invest. Ophthalmol. Vis. Sci., June 1, 2000; 41(7): 1990 - 1997. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |