| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
From the Laboratoire de Physiopathologie Rétinienne, Clinique Ophthalmologique, Université Louis Pasteur, Centre Hospitalier Régional Universitaire, Strasbourg, France.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Methods.
Subretinal injections of GDNF were made into rd/rd mice at 13 and 17 days of age and electroretinograms (ERGs) recorded at 22 days. Control mice received saline vehicle injections or underwent no procedure. At 23 days of age, retinas from treated and control mice were fixed and processed for wholemount immunohistochemistry using an anti-rod opsin antibody, and rod numbers were estimated using an unbiased stereological systematic random approach. Subsequent to counting, immunolabeled retinas were re-embedded and sectioned in a transverse plane and the numbers of rods recalculated.
Results.
Although ERGs could not be recorded from sham-operation or nonsurgical rd/rd mice at 22 days of age, detectable responses (both a- and b-waves) were observed in 4 of 10 GDNF-treated mice. Stereological assessment of immunolabeled rods at 23 days showed that control rd/rd retinas contained 41,880 ± 3,890 (mean ± SEM; n = 6), phosphate-buffered saline (PBS)–injected retinas contained 61,165 ± 4,932 (n = 10; P < 0.001 versus control retinas) and GDNF-injected retinas contained 89,232 ± 8,033 (n = 10; P < 0.001 versus control retinas, P < 0.002 versus PBS). This increase in rod numbers after GDNF treatment was confirmed by cell counts obtained from frozen sections.
Conclusions.
GDNF exerts both histologic and functional neuroprotective effects on rod photoreceptors in the rd/rd mouse. Thus rescue was demonstrated in an animal model of inherited retinal degeneration in which the gene defect was located within the rods themselves, similar to most forms of human retinitis pigmentosa. GDNF represents a candidate neurotrophic factor for palliating some forms of hereditary human blindness.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The retinal degeneration (rd/rd) mouse is a model of human RP that has been investigated for more than 70 years because photoreceptor cell degeneration follows a similar evolution to human RP. Most rod cells undergo apoptosis over the first 3 weeks,13 followed by death of cone photoreceptors.14 Furthermore, rod cell death has been found to result from a mutation in the ß subunit of cGMP-dependent phosphodiesterase,15 similar to some human families affected by the disease.16 Recently, among a large variety of neurotrophic factors injected into rd/rd eyes, only ciliary neurotrophic factor (CNTF) reduced histologic photoreceptor cell loss.6
Glial cell line–derived neurotrophic factor (GDNF), which belongs to the transforming growth factor ß superfamily, was first described as a stimulant of survival of dopaminergic neurons in vitro.17 Subsequently, its protective effects were demonstrated in in vivo models of Parkinson disease18 19 20 or on developing motoneurons.21 Because GDNF is synthesized in the retina,22 has been found to stimulate survival of newborn mice photoreceptors in vitro,23 and recently was shown to delay photoreceptor outer segment collapse in vitro,24 we conducted electrophysiological, histologic, immunohistochemical, morphometric, and molecular biologic studies to see whether it could stimulate photoreceptor survival in the rd/rd mouse after intraocular injections in vivo. We showed that such treatment leads to functional improvement, as indicated by the presence of recordable electroretinograms (ERGs) in some GDNF-injected retinas. Increased numbers of immunolabeled rods were detected using two methods of counting, and retinal glial cell physiology was also affected. In contrast, we could exclude the involvement of decreased levels of endogenous GDNF in rod photoreceptor cell death in the rd/rd mouse.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In Vivo Application of GDNF in the rd/rd Mouse
GDNF was injected into C3H mice at 13 and 17 days of age (with the
day of birth defined as day 0). Mice (n = 10) were
anesthetized with an intraperitoneal injection (16.7 µl/g body
weight) of etomidate (0.5 mg/ml) and midazolan (0.5 mg/ml). The pupils
were dilated with 0.5% tropicamide, and the cornea was anesthetized
with 0.5% topical proparacaine. GDNF (1 µl; recombinant human GDNF;
Promega, Madison, WI) was injected at a dose of 330 ng/µl in 0.1 M
sterile PBS with a Hamilton syringe and a 30-gauge needle 1 mm from the
limbus into the subretinal space. The contralateral eye was injected
with the same volume of PBS solution only. It was necessary to perform
bilateral ocular surgery to distinguish between the rescue effect due
to GDNF per se and that due to experimental manipulation. In rare
cases, partial backflow was observed. After injection, fundoscopy was
performed to confirm the induction of a local retinal detachment. This
was observed in every case at the time of injection, and we observed
that the detachment created by the initial injection was resorbed by
the time the second was administered. Processing of fixed retinas after
recording (description follows) indicated that retinas were correctly
attached at the end of the experimental period.
Recording ERGs in the rd Mouse
ERGs were picked up by a cotton wick connected to an Ag:AgCl
electrode with saline solution directed to the apex of cornea by a
micromanipulator. A stainless steel reference electrode was placed
subcutaneously on top of the head. Responses were amplified at a gain
of 10,000 and filtered with the low 0.1-Hz and high 1000-Hz cutoff
filters from an amplifier (Universal; Gould, Ballainvilliers, France).
Responses were digitized using a data acquisition labmaster board
(Scientific Solutions, Solon, OH), mounted on an IBM-compatible
personal computer. Experimental data were acquired and analyzed using
the Patchit and Tack software packages (Scientific
Solutions).25
After a period of 24 hours, dark-adapted
mice were prepared under dim red illumination. They were anesthetized
as above and placed in a Faraday cage, the head resting in a U-shaped
holder. The upper and lower lids were retracted to hold open and
proptose the eye. The light stimulus was obtained from a 150-watt
quartz-xenon lamp bulb (Müller Instruments, Moosinning,
Germany). The light beam was focused to infinity through a
heat-absorbing filter onto a hole in the Faraday cage. The illumination
intensity of the light was 2.9 log cd/m2 as measured with a
luxmeter at the level of the eye. A computer-controlled shutter was
used to deliver flashes of 300-msec duration. For GDNF-injected mice,
recordings from both eyes were obtained successively, and the
investigator was not aware of which eye had received the GDNF
injection.
Histology of Injected Eyes
Mice were killed by anesthetic overdose at 23 days. Whole eyes
from GDNF- and PBS-injected and noninjected rd/rd eyes
(n = 2 for each group), were removed from mice at 23 days,
fixed in 2.5% glutaraldehyde, and embedded in epoxy resin. Eyes were
sectioned along a perpendicular plane close to the optic nerve head,
and semithin sections were processed for histologic examination after
toluidine blue counterstaining.
Immunohistochemical Labeling of Retinas
Mice that underwent surgery (n = 10 for both
GDNF-injected and sham-operation mice) were killed by anesthetic
overdose at 23 days. Nonsurgical eyes were also sampled from a further
six 23-day-old rd/rd mice. Eyecups were removed and fixed in
4% paraformaldehyde for 2 hours. Retinas were dissected from the
posterior eyecup, washed three times in PBS, permeabilized in PBS
containing 0.1% Triton X-100 for 5 minutes, and incubated in blocking
buffer (PBS containing 0.1% bovine serum albumin, 0.1% Tween 20, and
0.1% sodium azide ([buffer A]) for 15 minutes. They were then
incubated with rod photoreceptor-specific monoclonal antibody
rho-4D226
(10 µg/ml in buffer A for 1 hour), washed and
incubated in goat anti-mouse IgG-Texas red (10 µg/ml in buffer
A for 1 hour; Molecular Probes, Portland, OR). Retinas were
washed and flatmounted in PBS-glycerol (50:50 vol/vol), with the
photoreceptor layer facing up, and examined under a photomicroscope
(Optiphot 2; Nikon, Melville, NY) equipped with differential
interference and fluorescence optics.
After stereological counting of rod numbers (see below), five wholemounted immunolabeled retinas from each experimental group were processed further by re-embedding and cryostat sectioning in a transverse plane. Frozen sections were collected from near the central retina, mounted on microscope slides, and examined for rho-4D2 staining. After labeled rods were counted (see later description), sections were incubated with anti-glial fibrillar acidic protein (GFAP) polyclonal antibody (Dako, Trappes, France), diluted 1:400 in buffer A for 2 hours. Sections were washed and incubated in goat anti-rabbit IgG-Bodipy FL (Molecular Probes) and the nuclear dye 4'-6-diamidino-2-phenylindole (DAPI; Sigma–Aldrich, Saint Quentin Fallavier, France), both 10 µg/ml in buffer A for 1 hour. Slides were washed thoroughly and examined as above, with different filter sets allowing visualization of only rho-4D2–immunolabeled rods (single-band-pass, filter XF42), only anti-GFAP-immunolabeled retinal glia (single-band-pass, filter XF22), simultaneous rho-4D2 and anti-GFAP staining (double-band-pass, filter XF53) and DAPI-labeled nuclei (single-band-pass, filter XF03: all fluorescence filters from Omega Optical, division of Molecular Probes). For photography, picture series were taken with similar exposure times (HP5 film; Ilford, Basildon, UK) and printed using identical times.
Cell Counts
For quantification of rods in flatmounted retinas we used a
stereological approach permitting unbiased sampling.27
Immunolabeled cells were observed by microscope (Optiphot 2; Nikon)
under epifluorescence illumination with a plan 40/070 differencial
interference contrast (DIC) (160/0.17) objective. One hundred
twenty fields of 8000 µm2 were selected throughout the
entire retinal surface (approximately 13 mm2) using a
stage encoder and a systematic random procedure.28
Fields
were viewed with a Sony Trinitron color graphic display camera and
digitized software (Automator for Windows; Biocom, Lyon, France). In
each of the 120 fields, cells were counted in two unbiased counting
frames of 900 µm2 generated by the software. The total
number of rod cells in the entire retina was then estimated by
normalizing these numbers to the entire retinal surface area, which was
measured using an image analysis system (Optiscan; Macintosh LC II Ci;
Apple Computer, Cupertino, CA). For counting of rods in transverse
sections, a single section from each of five retinas for each
treatment, passing through the optic nerve head and traversing the
entire retinal width, was mounted on a microscope slide and stained
with DAPI (10 µg/ml in PBS for 10 minutes). Viewing sections with the
two appropriate filter sets allowed visualization of rho-4D2–labeled
rods and total DAPI-labeled nuclei. Images were captured on the
computer as described along the entire length of each section.
Reverse Transcription–Coupled Polymerase Chain Reaction Analysis
of GDNF mRNA
Total RNA was isolated with an RNA-DNA extraction kit (Qiagen;
Valencia, CA) with standard protocol. RNA samples (1 µg) were primed
with random hexamer and incubated 2 hours at 37°C with Moloney murine
leukemia virus reverse transcriptase. cDNA (1:20; 2 µl) was amplified
for 35 cycles with specific pairs of primers. Primer sequences 5' to
3'were: rhodopsin, AAGCCGATGAGCAACTTCC, TCATC TCCCAGTGGATTCTT; GDNF,
ACCAGATAAACAAGCGGCAG, TCAGATACATCCA CACCGTTTAG; and glucose-6-phosphate
dehydrogenase (MG6PDH), GCAGTCACCAAGAACATTCAAG,
CCCAAATTCATCAA AATAGCCC. Amplified products were visualized on
agarose gels stained with ethidium bromide and digitized with a camera.
Quantitative measurement of band intensity was made using commercial
software (Phoretix International, Newcastle-upon-Tyne, UK). To quantify
the amplification products, the exponential phase of the reaction was
experimentally determined using different cycling numbers for each
primer pair. Under these conditions the amount of the amplification
product reflects the initial concentration of
transcripts.29
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
|
|
|
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Faktorovich et al.10 first showed the feasibility of using polypeptide growth factors to slow photoreceptor loss in inherited retinal degeneration. Using a rat model of RP they showed that intraocular injections of FGF-2 delayed rod photoreceptor loss. They also reported recently the effects of intraocular injection of multiple neurotrophic factors (CNTF, brain-derived neurotrophic factor, FGF-2, leukemia inhibitory factor, insulin-like growth factor II, neurotrophin-3 and -4, and nerve growth factor) on slowing rod photoreceptor loss in several mouse models of retinal degeneration including the rd/rd mouse.6 These molecules were chosen because they are known to exhibit neuroprotective effects in other retinal models or elsewhere in the nervous system.5 30 31 Of all these factors, only rat CNTF injected between postnatal days 7 and 10 had a protective effect 1 week later in rd/rd mice. In an independent study, CNTF delivered by adenoviral vectors showed histologic and functional protection of rod photoreceptors in another mutant, the retinal degeneration slow (rds) mouse.32 Rescue effects of PBS injections alone have not been previously observed in mouse rd mutants, whereas in our study PBS injection alone induced a significant rescue effect at the histologic level, but did not lead to detectable functional improvement in any animal examined. Transient rescue effects of PBS injections have been previously reported in the rat33 and are thought to result from local release of endogenous trophic factors as a result of tissue damage.
GDNF was one of the few neurotrophic factors not tested in the exhaustive recent trials by LaVail et al.6 It was shown recently, when used at relatively high concentrations, to have protective effects against photoreceptor outer segment collapse in short-term in vitro assays.24 It is impossible to know the final concentration of the subretinally injected GDNF used in the present study, although the dose administered lies in the range normally used for intraocular growth factor injections.6 10 Although it is possible that GDNF may constitute one of the few identified neurotrophic factors influencing rod photoreceptor survival in inherited retinal degenerations in which the gene defect is localized to the rod cell, other criteria such as timing or ocular site of injection and approach were probably critical. Our injections were performed at relatively late times, after the initial onset of rod loss in this strain.14 These ages were chosen to permit injection into the subretinal space, which was not routinely possible in younger animals. The stereological method of counting, originally developed for assessment of neuronal numbers in brain regions,27 34 allows an accurate unbiased estimation of total cell numbers, reducing greatly the variability induced by regional differences (superior versus inferior hemisphere, site of injection). Nevertheless, increased rod numbers were also reliably scored in transverse retinal sections as routinely used by other investigators.6 10
GDNF may be a particularly interesting neuroprotective molecule,
because unlike FGF-2 it is not reported to be angiogenic and thus
should not lead to neovascular complications.35
Histologic
observations in the present study also did not record the presence of
new retinal blood vessels or invading macrophages. Although this
distant member of the transforming growth factor-ß superfamily was
originally thought to be a specific survival factor for dopaminergic
neurons,17
GDNF is now known to stimulate a wide variety
of autonomic, sensory, and motoneurons21
36
37
and has an
important role in kidney development.38
Previous studies
have indicated the potential value of GDNF as a neuroprotective agent
for the retina through the demonstration that subnanomolar
concentrations of GDNF increase cell survival in enriched photoreceptor
cultures prepared from newborn mice and that rat photoreceptor cultures
possess high-affinity GDNF receptors.23
GDNF is expressed
in the rat retina from embryonic day (E) 15 to E19, mostly in the
innermost layer.22
In the mouse embryo, it is expressed
from E8.5 in the neuroectoderm surrounding the optic vesicle and later
in the mesenchymal components of the developing eye.39
Another member of the GDNF subfamily, neurturin and its receptor
components GFR
2 and Ret, were also recently detected in normal and
rd mouse retina throughout the life span.40
In
the present study, two histologic observations may be of particular
importance. The first is that GDNF injection was effective at slowing
rod loss even though treatment was begun after the initiation of rod
degeneration in this strain.41
Such findings may be of
clinical significance, because they suggest growth factor treatment
could be effective after the onset of photoreceptor death in RP
patients. Enhanced photoreceptor survival after gene transfer of CNTF
in rds mice,32
gene transfer of the normal
PDE gene in rd mice,42
or targeted
digestion of mutant opsin mRNA by adenovirally delivered ribozymes in
transgenic retinal degeneration rats43
have all been
obtained when treatment began long before photoreceptor loss. The
second is that intraocular injection of GDNF (and to a lesser extent
PBS) led to upregulation of GFAP expression, indicating that, similar
to FGF-2,44
this growth factor may regulate phenotypic
expression in retinal Müller glia and that its effects on rod
survival may be mediated through an indirect pathway.45
We
are currently exploring this hypothesis.
The detection of an ERG in GDNF-injected eyes is an especially important finding in the present study, indicating that visual function was extended in treated rd/rd retina. Our data on ERG decrease in young rd/rd mice are in agreement with several previous studies.46 47 48 The persistence of recordable ERG correlated in three of four cases, with the largest relative increases in rod cell numbers. However, because ERG were absent in several rd/rd retinas containing at least as many rods as one animal in which signals were detected, recording was probably also influenced by anesthesia and cataract formation. Experimental constraints (dark adaptation) prevented monitoring of ocular status before recording, but overt cataract formation was noted in both eyes of two animals that did not produce a detectable ERG. In addition, under the experimental conditions used, rods and cones would both have been stimulated and would have contributed to the signal. It should be stressed that ERG recordings and stereological assessment were performed by a naive observer unaware of which eye had received GDNF.
We showed previously in the rd/rd mouse model the protective effects of rod photoreceptor transplantation on host cone cell survival and suggested that this effect was mediated by a diffusible factor released by rods.49 Additional evidence for the existence of such diffusible signals produced by normal retina and influencing cone survival was obtained using coculture models.50 Although exogenous GDNF protects rod photoreceptors, it is unlikely to represent this endogenous signal for several reasons. GDNF is expressed in the rd/rd mouse retina even after complete loss of rods, suggesting that GDNF is not expressed in these cells (although it is possible that its expression may be upregulated in inner retinal cells during photoreceptor degeneration as has been shown to occur for FGF-2 and CNTF during retinal injury51 ). Because the cone-survival–promoting effect observed in our previous coculture studies was dependent on the presence of rods,50 GDNF is unlikely to constitute this diffusible molecule. Endogenous GDNF is not efficient in counteracting the apoptotic process in mutant rods, and it may have functions other than photoreceptor cell survival in the mouse retina.
In conclusion, although the endogenous expression of GDNF was not sufficient to prevent photoreceptor loss in the rd/rd mouse, intraocular injections were able to delay such losses significantly. Administration of GDNF using injections or gene delivery systems may be very useful to protect against photoreceptor degeneration in humans.
|
Footnotes |
|---|
Submitted for publication July 30, 1998; revised January 20 and April 27, 1999; accepted June 15, 1999.
Commercial relationships policy: N.
Corresponding author: José Sahel, Laboratoire de Physiopathologie Rétinienne, INSERM EMI 99-18 Clinique Ophthalmologique, Université Louis Pasteur, Centre Hospitalier Régional Universitaire, BP 426, 1 Place de l’Hôpital, 67091 Strasbourg Cedex, France. E-mail: sahel{at}neurochem.u-strasbg.fr
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, a novel receptor for GDNF Cell 85,1113-1124[Medline][Order article via Infotrieve]
This article has been cited by other articles:
|
|
 |
|
  M. Sasahara, A. Otani, A. Oishi, H. Kojima, Y. Yodoi, T. Kameda, H. Nakamura, and N. Yoshimura Activation of Bone Marrow-Derived Microglia Promotes Photoreceptor Survival in Inherited Retinal Degeneration Am. J. Pathol., June 1, 2008; 172(6): 1693 - 1703. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Brantley Jr, S. Jain, E. E. Barr, E. M. Johnson Jr, and J. Milbrandt Neurturin-Mediated Ret Activation Is Required for Retinal Function J. Neurosci., April 16, 2008; 28(16): 4123 - 4135. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Siffroi-Fernandez, M.-P. Felder-Schmittbuhl, H. Khanna, A. Swaroop, and D. Hicks FGF19 Exhibits Neuroprotective Effects on Adult Mammalian Photoreceptors In Vitro Invest. Ophthalmol. Vis. Sci., April 1, 2008; 49(4): 1696 - 1704. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Kent, I. V. Glybina, G. W. Abrams, and R. Iezzi Chronic Intravitreous Infusion of Ciliary Neurotrophic Factor Modulates Electrical Retinal Stimulation Thresholds in the RCS Rat Invest. Ophthalmol. Vis. Sci., January 1, 2008; 49(1): 372 - 379. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. J. McGill, G. T. Prusky, R. M. Douglas, D. Yasumura, M. T. Matthes, G. Nune, K. Donohue-Rolfe, H. Yang, D. Niculescu, W. W. Hauswirth, et al. Intraocular CNTF Reduces Vision in Normal Rats in a Dose-Dependent Manner Invest. Ophthalmol. Vis. Sci., December 1, 2007; 48(12): 5756 - 5766. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Allocca, U. Di Vicino, M. Petrillo, F. Carlomagno, L. Domenici, and A. Auricchio Constitutive and AP20187-Induced Ret Activation in Photoreceptors Does Not Protect from Light-Induced Damage Invest. Ophthalmol. Vis. Sci., November 1, 2007; 48(11): 5199 - 5206. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. N. Volpert, A. Rothermel, and P. G. Layer GDNF Stimulates Rod Photoreceptors and Dopaminergic Amacrine Cells in Chicken Retinal Reaggregates Invest. Ophthalmol. Vis. Sci., November 1, 2007; 48(11): 5306 - 5314. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. B. Wilson, K. Kunchithapautham, and B. Rohrer Paradoxical Role of BDNF: BDNF+/- Retinas Are Protected against Light Damage-Mediated Stress Invest. Ophthalmol. Vis. Sci., June 1, 2007; 48(6): 2877 - 2886. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. DeMarco Jr, G. L. Yarbrough, C. W. Yee, G. Y. McLean, B. T. Sagdullaev, S. L. Ball, and M. A. McCall Stimulation via a Subretinally Placed Prosthetic Elicits Central Activity and Induces a Trophic Effect on Visual Responses Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 916 - 926. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Salzmann, O P Linderholm, J-L Guyomard, M Paques, M Simonutti, M Lecchi, J Sommerhalder, E Dubus, M Pelizzone, D Bertrand, et al. Subretinal electrode implantation in the P23H rat for chronic stimulations Br. J. Ophthalmol., September 1, 2006; 90(9): 1183 - 1187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Hauck, N. Kinkl, C. A. Deeg, M. Swiatek-de Lange, S. Schoffmann, and M. Ueffing GDNF Family Ligands Trigger Indirect Neuroprotective Signaling in Retinal Glial Cells. Mol. Cell. Biol., April 1, 2006; 26(7): 2746 - 2757. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Andrieu-Soler, M. Casas, A.-M. Faussat, C. Gandolphe, M. Doat, D. Tempe, C. Giovannangeli, F. Behar-Cohen, and J.-P. Concordet Stable transmission of targeted gene modification using single-stranded oligonucleotides with flanking LNAs Nucleic Acids Res., July 7, 2005; 33(12): 3733 - 3742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Tomita, Y. Kotake, and R. E. Anderson Mechanism of Protection from Light-Induced Retinal Degeneration by the Synthetic Antioxidant Phenyl-N-tert-Butylnitrone Invest. Ophthalmol. Vis. Sci., February 1, 2005; 46(2): 427 - 434. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Sethi, G. P. Lewis, S. K. Fisher, W. P. Leitner, D. L. Mann, P. J. Luthert, and D. G. Charteris Glial Remodeling and Neural Plasticity in Human Retinal Detachment with Proliferative Vitreoretinopathy Invest. Ophthalmol. Vis. Sci., January 1, 2005; 46(1): 329 - 342. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Balse, L.-H. Tessier, C. Fuchs, V. Forster, J. A. Sahel, and S. Picaud Purification of Mammalian Cone Photoreceptors by Lectin Panning and the Enhancement of Their Survival in Glia-Conditioned Medium Invest. Ophthalmol. Vis. Sci., January 1, 2005; 46(1): 367 - 374. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Paskowitz, G. Nune, D. Yasumura, H. Yang, R. B. Bhisitkul, S. Sharma, M. T. Matthes, M. A. Zarbin, M. M. LaVail, and J. L. Duncan BDNF Reduces the Retinal Toxicity of Verteporfin Photodynamic Therapy Invest. Ophthalmol. Vis. Sci., November 1, 2004; 45(11): 4190 - 4196. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Y. Chow, V. Y. Chow, K. H. Packo, J. S. Pollack, G. A. Peyman, and R. Schuchard The Artificial Silicon Retina Microchip for the Treatment of Vision Loss From Retinitis Pigmentosa Arch Ophthalmol, April 1, 2004; 122(4): 460 - 469. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Casson, G. Chidlow, J. P. M. Wood, M. Vidal-Sanz, and N. N. Osborne The Effect of Retinal Ganglion Cell Injury on Light-Induced Photoreceptor Degeneration Invest. Ophthalmol. Vis. Sci., February 1, 2004; 45(2): 685 - 693. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Lawrence, D. J. Keegan, E. M. Muir, P. J. Coffey, J. H. Rogers, M. J. Wilby, J. W. Fawcett, and R. D. Lund Transplantation of Schwann Cell Line Clones Secreting GDNF or BDNF into the Retinas of Dystrophic Royal College of Surgeons Rats Invest. Ophthalmol. Vis. Sci., January 1, 2004; 45(1): 267 - 274. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Keegan, P. Kenna, M. M. Humphries, P. Humphries, D. I. Flitcroft, P. J. Coffey, R. D. Lund, and J. M. Lawrence Transplantation of Syngeneic Schwann Cells to the Retina of the Rhodopsin Knockout (Rho-/-) Mouse Invest. Ophthalmol. Vis. Sci., August 1, 2003; 44(8): 3526 - 3532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. A. Beltran, Q. Zhang, J. W. Kijas, D. Gu, H. Rohrer, J. A. Jordan, and G. D. Aguirre Cloning, Mapping, and Retinal Expression of the Canine Ciliary Neurotrophic Factor Receptor {alpha} (CNTFR{alpha}) Invest. Ophthalmol. Vis. Sci., August 1, 2003; 44(8): 3642 - 3649. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Ranchon, M. M. LaVail, Y. Kotake, and R. E. Anderson Free Radical Trap Phenyl-N-tert-Butylnitrone Protects against Light Damage But Does Not Rescue P23H and S334ter Rhodopsin Transgenic Rats from Inherited Retinal Degeneration J. Neurosci., July 9, 2003; 23(14): 6050 - 6057. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Rothermel and P. G. Layer GDNF Regulates Chicken Rod Photoreceptor Development and Survival in Reaggregated Histotypic Retinal Spheres Invest. Ophthalmol. Vis. Sci., May 1, 2003; 44(5): 2221 - 2228. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. F. Insua, A. Garelli, N. P. Rotstein, O. L. German, A. Arias, and L. E. Politi Cell Cycle Regulation in Retinal Progenitors by Glia-Derived Neurotrophic Factor and Docosahexaenoic Acid Invest. Ophthalmol. Vis. Sci., May 1, 2003; 44(5): 2235 - 2244. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. P. Rotstein, L. E. Politi, O. L. German, and R. Girotti Protective Effect of Docosahexaenoic Acid on Oxidative Stress-Induced Apoptosis of Retina Photoreceptors Invest. Ophthalmol. Vis. Sci., May 1, 2003; 44(5): 2252 - 2259. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-C. Fintz, I. Audo, D. Hicks, S. Mohand-Said, T. Leveillard, and J. Sahel Partial Characterization of Retina-Derived Cone Neuroprotection in Two Culture Models of Photoreceptor Degeneration Invest. Ophthalmol. Vis. Sci., February 1, 2003; 44(2): 818 - 825. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Chaum and H. Yang Transgenic Expression of IGF-1 Modifies the Proliferative Potential of Human Retinal Pigment Epithelial Cells Invest. Ophthalmol. Vis. Sci., December 1, 2002; 43(12): 3758 - 3764. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W.-C. Wu, C.-C. Lai, S.-L. Chen, X. Xiao, T.-L. Chen, R. J.-F. Tsai, S.-W. Kuo, and Y.-P. Tsao Gene Therapy for Detached Retina by Adeno-Associated Virus Vector Expressing Glial Cell Line-Derived Neurotrophic Factor Invest. Ophthalmol. Vis. Sci., November 1, 2002; 43(11): 3480 - 3488. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Harada, C. Harada, S. Kohsaka, E. Wada, K. Yoshida, S. Ohno, H. Mamada, K. Tanaka, L. F. Parada, and K. Wada Microglia-Muller Glia Cell Interactions Control Neurotrophic Factor Production during Light-Induced Retinal Degeneration J. Neurosci., November 1, 2002; 22(21): 9228 - 9236. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. E. Politi, N. P. Rotstein, and N. G. Carri Effect of GDNF on Neuroblast Proliferation and Photoreceptor Survival: Additive Protection with Docosahexaenoic Acid Invest. Ophthalmol. Vis. Sci., November 1, 2001; 42(12): 3008 - 3015. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. You, S. Ebner, and F. E. Kruse Glial Cell-Derived Neurotrophic Factor (GDNF)-Induced Migration and Signal Transduction in Corneal Epithelial Cells Invest. Ophthalmol. Vis. Sci., October 1, 2001; 42(11): 2496 - 2504. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Yamada, E. Yamada, A. Ando, N. Esumi, N. Bora, J. Saikia, C.-H. Sung, D. J. Zack, and P. A. Campochiaro Fibroblast Growth Factor-2 Decreases Hyperoxia-Induced Photoreceptor Cell Death in Mice Am. J. Pathol., September 1, 2001; 159(3): 1113 - 1120. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yang, R. Gross, S. Basinger, and S. Wu Apoptotic cell death of cultured salamander photoreceptors induced by cccp: CsA-insensitive mitochondrial permeability transition J. Cell Sci., January 5, 2001; 114(9): 1655 - 1664. [Abstract] [PDF]
|
|
|
|
|
|
W. W. Hauswirth and L. Beaufrere Ocular Gene Therapy: Quo Vadis? Invest. Ophthalmol. Vis. Sci., September 1, 2000; 41(10): 2821 - 2826. [Full Text]
|
|
|
|
|
|
S. Mohand-Said, D. Hicks, H. Dreyfus, and J. A. Sahel Selective Transplantation of Rods Delays Cone Loss in a Retinitis Pigmentosa Model Arch Ophthalmol, June 1, 2000; 118(6): 807 - 811. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Hicks and J. Sahel The Implications of Rod-Dependent Cone Survival for Basic and Clinical Research Invest. Ophthalmol. Vis. Sci., December 1, 1999; 40(13): 3071 - 3074. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
