(Investigative Ophthalmology and Visual Science. 1999;40:2748-2751.)
© 1999
by The Association for Research in Vision and Ophthalmology, Inc.
Localization of the Mouse nob (no b-wave) Gene to the Centromeric Region of the X Chromosome
Sophie I. Candille1,
Machelle T. Pardue2,3,
Maureen A. McCall4,5,
Neal S. Peachey2,3,6 and
Ronald G. Gregg1,5
From the Departments of
1 Biochemistry and Molecular Biology,
4 Psychological and Brain Sciences, and
5 Ophthalmology and Visual Sciences, University of Louisville, Kentucky;
2 Research Service, Hines VA Hospital, Hines, Illinois; Departments of
3 Neurology and
6 Ophthalmology, Stritch School of Medicine, Loyola University Chicago, Maywood, Illinois.
 |
Abstract
|
|---|
PURPOSE. To determine the position on the X chromosome of the gene responsible
for a spontaneous mouse mutation, nob (no
b-wave), which matches the phenotype of complete X-linked
congenital stationary night blindness (CSNB) type 1 in human.
METHODS. Inter- and intraspecific pedigrees were generated, and the phenotype of
each mouse was scored on the basis of either the presence or the
absence of an electroretinographic b-wave. DNA was isolated from a tail
biopsy from each mouse and was used to determine the genotype at
various polymorphic markers on the X chromosome. LOD scores
(Z) between the nob phenotype and each marker
were calculated to determine the most probable location of the
nob gene.
RESULTS. A total of 174 informative offspring were analyzed. The
nob gene is tightly linked to DXMit103 with a maximum
LOD score of 25.9 at a recombination fraction of zero. This marker is
located at 4.2 cM on the X chromosome of the mouse map. Haplotype
analyses of several recombinant chromosomes in the region indicates
that the nob gene maps between DXMit54 (3.8 cM) and
Ube1x (5.7 cM).
CONCLUSIONS. The genetic position of the mouse nob gene overlaps the
homologous region in human that contains the locus for CSNB1 and
excludes the region of CSNB2. Further studies are planned to identify
the mouse nob gene and to evaluate it as a candidate for
CSNB1.
 |
Introduction
|
|---|
The first steps in vision depend on the transduction of
light energy into electrical activity in the photoreceptors and the
synaptic transmission of that information to the bipolar cells.
Considerable progress regarding the biochemistry and the neurobiology
of this process has been made, particularly with respect to the
transduction events occurring in the photoreceptors.1
This
effort has been accelerated by the study of genetic diseases of the
retina.
Congenital stationary night blindness (CSNB) refers to a family of
retinal disorders that produce a profound loss of rod photoreceptor
mediated visual sensitivity. These disorders can be inherited as an
autosomal dominant, an autosomal recessive, or an X-linked
trait.2
Some forms of CSNB have been shown to result from
mutations in genes involved in the rod phototransduction cascade and
are characterized by the absence of a rod a-wave in the
electroretinogram.3
4
In other forms of CSNB, the
electroretinogram (ERG) a-wave is normal; however, the ERG b-wave is
selectively diminished.5
Within this latter group, two
distinct X-linked forms, complete and incomplete, have been identified
in humans.5
In patients with complete X-linked CSNB, it is
not possible to measure postreceptoral rod photoreceptor function in
the ERG. In comparison, patients with the incomplete form of X-linked
CSNB have both modest rod-mediated vision, and postreceptoral
components are present in the ERG. The complete and incomplete forms of
X-linked CSNB also may be distinguished by a number of other clinical
characteristics, including nystagmus, myopia, and impaired visual
acuity.5
Recent linkage analysis of human X-linked
pedigrees indicate that different genes are responsible for the
complete and incomplete forms of CSNB.6
In humans, the
locus for the incomplete form (CSNB2) is localized to
Xp11.236
and is due to mutations in a putative L-type
calcium channel.7
8
The locus for the complete form of
CSNB (CSNB1), which is located more distally between Xp11.3 and
11.4,6
is yet to be cloned.
Recently, we described a spontaneous X-linked mouse mutation (no
b-wave [nob]) that may provide insight into the
process of synaptic transmission from photoreceptors to bipolar cells.
These mice have normal retinal architecture and a normal ERG a-wave,
but lack the ERG b-wave. Therefore, the phenotype in these mice closely
resembles the complete type of X-linked CSNB in humans.9
Here we report that the nob gene is located near the
centromere of the X chromosome in mouse. The minimal region containing
the nob gene is homologous to the region in human containing
the CSNB1 gene.
 |
Materials and Methods
|
|---|
Breeding
Intra- and interspecific breeding strategies were used to generate
mouse pedigrees for linkage analyses. Affected BALB/cByJ nob
males were crossed to normal C57BL/6J females purchased from the
Jackson Laboratory (Bar Harbor, ME). F1 females, which must be
heterozygous (nob/+) for the nob mutation, were
then backcrossed to BALB/cByJ nob males. A total of 88 mice
from the intraspecific backcross were used in the linkage analysis. To
increase the number of polymorphic markers that were informative for
linkage analysis, we also used an interspecific cross. Figure 1
A illustrates the interspecific pedigree between a BALB/cByJ
nob/nob (Mus musculus) female and SPRET/Ei
(M. spretus, Jackson Laboratory) male. Backcrossing the F1
heterozygous females to affected BALB/cByJ males yielded 86
interspecific backcross mice.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 1. (A) Schematic diagram of the structure of the interspecific
pedigree used for linkage analysis. Squares and
circles represent males and females, respectively.
Filled and open symbols represent
affected and normal mice, respectively. (B) Examples of
representative dark-adapted ERGs from a normal (left)
and nob mouse (right). The absence of a
b-wave was considered diagnostic of the nob phenotype.
|
|
Electroretinogram
Mice were phenotyped at 4 to 5 weeks of age, using the ERG. At
this age the ERG has achieved the adult configuration (unpublished
observations). Further, the nob defect is apparent as early
as postnatal day 18,9
and mortality associated with the
administration of anesthetic agents and the other procedures involved
in ERG recording is minimized. After overnight dark adaptation, mice
were anesthetized with ketamine (80 mg/kg) and xylazine (16 mg/kg), and
the pupils were dilated. ERGs were recorded (11000 Hz) to a
high-intensity strobe flash presented in a ganzfeld. Figure 1B
shows
representative examples of dark-adapted ERGs from a normal and a
nob mouse. Affected animals exhibit a normal ERG a-wave and
lack the ERG b-wave. The presence of reproducible a- and b-waves was
taken as evidence of a normal male or a nob/+ female (Fig. 1B)
. The ERGs were repeated on all mice that had a recombination event
in the region of interest. While the mice were still anesthetized, a
small tail biopsy was obtained and frozen for later isolation of DNA.
All procedures were approved by the local Institutional Animal Care and
Use Committee and conformed to the ARVO Statement for the Use of
Animals in Ophthalmic and Vision Research.
Mouse Genotyping
DNA was extracted from each tail biopsy using the Puregene
DNA isolation kit (Gentra Systems, Minneapolis, MN). Samples were
incubated overnight in 400 µl cell lysis solution containing 250
µg/ml proteinase K. The remainder of the protocol was according to
the manufacturers instructions. For PCR purposes, these DNA solutions
were diluted to a concentration of 25 ng/µl.
Thirty-six polymorphic markers, all short, simple sequence
repeats of the dinucleotide (CA)n type, were
selected from the publicly available mouse genetics map
(http://www.informatics.jax.org) and primers for each purchased
(Research Genetics, Inc., Huntsville, AL). Primers flanking a
(CT)23(AT)28 polymorphic
repeat within the Ube1x cDNA (Accession no. U09051) were designed (5'
CCCTGGAGCCTAGTTCAGTG 3' and 5' GGAGTCTCTGTTAGGGAGTA 3'). Polymerase
chain reaction (PCR) conditions were optimized for each primer pair.
PCR reactions contained (in 25 µl) either 10 pmoles (for Ube1x primer
pair) or 3.3 pmoles (for Research Genetics primer pairs) of each
primer, 5 nmoles of each dNTP, 50 ng of genomic DNA, 1.25 U of
Taq polymerase, and 1x Taq assay buffer A
(Fisher Scientific, Itasca, IL). To genotype the mice, the PCR products
were separated by electrophoresis either on 3% agarose gels or, when
the allele sizes between the strains were less than 14 bp, on a 6%
denaturing polyacrylamide gel. For detection of the products on
polyacrylamide gels, one of the primers was end-labeled using
[
-32P]ATP (Amersham, Haywood, CA) and T4
polynucleotide kinase (Promega, Madison, WI).
Two-point LOD scores (Z) were calculated between each marker
and the nob phenotype, using the formulas for phase known
pedigrees. When either
> 0 or
= 0 and
R
0, we used Z(
) =
N(log2) + NR[log(1 -
)] +
R(log
), where
= the recombination fraction,
N = the total number of offspring, and R and
NR are the number of recombinant and nonrecombinant
chromosomes, respectively. When
= 0 and R = 0,
we used Z(
) = N(log2). Haplotypes were
constructed for chromosomes that had recombination events near the
nob critical region.
 |
Results and Discussion
|
|---|
The intraspecific pedigree, BALB/cByJ x C57BL/6J, was fully
informative for markers DXMit64, DXMit140, and DXMit55, and 38 of 88
offspring were informative for the Ube1x marker. All the markers tested
were fully informative for the interspecific (BALB/cByJ x
SPRET/Ei) pedigree.
Linkage was first detected between nob and Ube1x
(Z = 34.8,
= 0.01), which is located at 5.7 cM
on the X-chromosome map. Table 1
shows the composite LOD score data for informative markers
between 1.4 and 45 cM on the mouse map. The most tightly linked marker
is DXMit103 (Z = 25.9,
= 0), which is
positioned at 4.2 cM on the mouse genetic map. To refine the location
of the nob locus further, haplotypes for all mice that
contained recombinant chromosomes between DXMit26 and DXMit81 were
constructed. The positions of the recombination events are shown in
Figure 2 . These data indicate that the nob gene is localized to a 1.9
cM interval between DXMit54 at 3.8 cM and Ube1x at 5.7 cM.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 2. Haplotypes of recombinant chromosomes. The open and
filled boxes represent recombinant and nonrecombinant
alleles, respectively, at the markers indicated. These data indicate
that the nob gene is located between DXMit54 and
Ube1x.
|
|
Figure 3
presents a schematic diagram of the region of the mouse X chromosome
(left) that contains the nob gene and the homologous region
on the human X chromosome (right). This region contains genes for
several human retinal disorders, including CSNB1,6
CSNB2,6
7
8
RP3,10
11
RP2,12
13
and COD1.14
Several other genes also have been mapped to
this region in both human and mouse, which allows the two regions to be
aligned. The order of genes between CYBB and TIMP1 in humans is
retained in mouse. This allows us to exclude RP2 and RP3 as candidates
for nob (Fig. 3)
. A second, slightly more proximal region in
human contains a putative voltage-gated calcium channel gene
(CACNA1F), which corresponds to the CSNB2 locus. This gene
is 5 kb proximal to the SYP gene.7
8
The
homologous location in mouse would place this gene between the
centromere and Syp, excluding it as a candidate for nob. In
comparison, the intervals that contain the genes for CSNB1 in human and
nob in mouse overlap. These data, combined with the
electrophysiological and anatomic data reported
previously,9
strongly suggest that nob and
CSNB1 may result from mutations within the same gene.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 3. Homologous regions of the mouse (left) and human X
(right) chromosomes, in the region containing the mouse
nob gene. Other genes mapped into this region also are
indicated. CSNB1 and CSNB2, congenital stationary night blindness type
1 and 2; RP2 and RP3, retinitis pigmentosa 2 and 3; COD1, X-linked
cone-rod dystrophy; mRPGR, mouse retinitis pigmentosa GTPase regulator.
The marker positions for the mouse and human maps were obtained from
databases accessible via the Internet. (mouse,
http://www.informatics.jax.org; and human,
http://www.ibc.wustl.edu/cgm/cgm.html). The large arrows
on the vertical lines representing the chromosomes show
the position and orientation of the homologous regions between the two
species. The vertical double headed arrows indicate the
minimal region containing the locus indicated. The horizontal
arrows indicate the position of cloned genes. The
numbers next to each vertical line
represent the position, in centimorgans for mouse and in megabases for
human, of the various markers.
|
|
The results presented in this report indicate that the nob
gene in mouse and the CSNB1 gene in humans are likely to be one and the
same. Our ability to produce large numbers of informative meioses
should allow us to refine the genetic location of the nob
gene, which will facilitate its cloning. The identification of the
nob gene will let us investigate whether the nob
and CSNB1 phenotypes are due to mutations in the same gene. In
addition, the nob mice provide a valuable resource, which
will provide insight into another important component of visual
transmission between the photoreceptors and the bipolar cells. Finally,
nob mice should be a useful model with which to investigate
the pathophysiological mechanisms underlying CSNB1.
 |
Footnotes
|
|---|
Supported by National Institutes of Health Grant RO1 EY12354 (RGG); a
National Science Foundation Co-operative Agreement OSR-945,2895, the
Center for Genetics and Molecular Medicine (U of L, RGG); the
Department of Veterans Affairs (NSP); the Bane Foundation (LUC, NSP);
and an unrestricted grant from Research to Prevent Blindness (MAM,
RGG).
Submitted for publication March 23, 1999; accepted May 4, 1999.
Commercial relationships policy: N.
Corresponding author: Ronald G. Gregg, Department of Biochemistry and
Molecular Biology, University of Louisville, 301 E. Muhammad Ali
Boulevard, Louisville, KY 40202. E-mail: ron.gregg{at}louisville.edu
 |
References
|
|---|
-
Molday, RS (1998) Photoreceptor membrane proteins, phototransduction, and retinal degenerative diseases. The Friedenwald Lecture Invest Ophthalmol Vis Sci 39,2491-2513[Medline][Order article via Infotrieve]
-
Krill, AE, Martin, D. (1971) Photopic abnormalities in congenital stationary nightblindness Invest Ophthalmol 10,625-636[Abstract/Free Full Text]
-
Dryja, TP, Berson, EL, Rao, VR, Oprian, DD (1993) Heterozygous missense mutation in the rhodopsin gene as a cause of congenital stationary night blindness Nat Genet 4,280-283[Medline][Order article via Infotrieve]
-
Dryja, TP, Hahn, LB, Reboul, T, Arnaud, B. (1996) Missense mutation in the gene encoding the
subunit of rod transducin in the Nougaret form of congenital stationary night blindness Nat Genet 13,358-360[Medline][Order article via Infotrieve]
-
Miyake, Y, Yagasaki, K, Horiguchi, M, Kawase, Y, Kanda, T. (1986) Congenital stationary night blindness with negative electroretinogram. A new classification Arch Ophthalmol 104,1013-1020[Abstract/Free Full Text]
-
Boycott, KM, Pearce, WG, Musarella, MA, et al (1998) Evidence for genetic heterogeneity in X-linked congenital stationary night blindness Am J Hum Genet 62,865-875[Medline][Order article via Infotrieve]
-
BechHansen, T, Naylor, MJ, Maybaum, TA, et al (1998) Loss-of-function mutations in a calcium-channel
1-subunit gene
in Xp11.23 cause incomplete X-linked congenital stationary night blindness Nat Genet 19,264-267[Medline][Order article via Infotrieve]
-
Strom, TM, Nyakatura, G, ApfelstedtSylla, E, et al (1998) An L-type calcium channel gene mutated in incomplete X-linked congenital stationary night blindness Nat Genet 19,260-263[Medline][Order article via Infotrieve]
-
Pardue, MT, McCall, MA, LaVail, MM, Gregg, RG, Peachey, NS (1998) A naturally occurring mouse model of X-linked congenital stationary night blindness Invest Ophthalmol Vis Sci 39,2443-2449[Abstract/Free Full Text]
-
Meindl, A, Dry, K, Herrmann, K, et al (1996) A gene (RPGR) with homology to the RCC1 guanine nucleotide exchange factor is mutated in X-linked retinitis pigmentosa (RP3) Nat Genet 13,35-42[Medline][Order article via Infotrieve]
-
Yan, D, Swain, PK, Breuer, D, et al (1998) Biochemical characterization and subcellular localization of the mouse retinitis pigmentosa GTPase regulator (mRpgr) J Biol Chem 273,19656-19663[Abstract/Free Full Text]
-
Thiselton, DL, Hampson, RM, Nayudu, M, et al (1996) Mapping the RP2 locus for X-linked retinitis pigmentosa on proximal Xp: a genetically defined 5-cM critical region and exclusion of candidate genes by physical mapping Genome Res 6,1093-1102[Abstract/Free Full Text]
-
Schwahn, U, Lenzner, S, Dong, J, et al (1998) Positional cloning of the gene for X-linked retinitis pigmentosa 2 Nat Genet 19,327-332[Medline][Order article via Infotrieve]
-
Seymour, AB, DashModi, A, OConnell, JR, et al (1998) Linkage analysis
of X-linked cone-rod dystrophy: localization to Xp11.4 and definition
of a locus distinct from RP2 and RP3 Am J Hum Genet 62,122-129[Medline][Order article via Infotrieve]
This article has been cited by other articles:

|
 |

|
 |
 
E. O'Connor, B. Eisenhaber, J. Dalley, T. Wang, C. Missen, N. Bulleid, P. N. Bishop, and D. Trump
Species specific membrane anchoring of nyctalopin, a small leucine-rich repeat protein
Hum. Mol. Genet.,
July 1, 2005;
14(13):
1877 - 1887.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wu, N. S. Peachey, and A. D. Marmorstein
Light-Evoked Responses of the Mouse Retinal Pigment Epithelium
J Neurophysiol,
March 1, 2004;
91(3):
1134 - 1142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Pesch, C. Zeitz, J. E. Fries, S. Munscher, C. M. Pusch, K. Kohler, W. Berger, and B. Wissinger
Isolation of the Mouse Nyctalopin Gene Nyx and Expression Studies in Mouse and Rat Retina
Invest. Ophthalmol. Vis. Sci.,
May 1, 2003;
44(5):
2260 - 2266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. G. Gregg, S. Mukhopadhyay, S. I. Candille, S. L. Ball, M. T. Pardue, M. A. McCall, and N. S. Peachey
Identification of the Gene and the Mutation Responsible for the Mouse nob Phenotype
Invest. Ophthalmol. Vis. Sci.,
January 1, 2003;
44(1):
378 - 384.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. B. Haider, A. Ikeda, J. K. Naggert, and P. M. Nishina
Genetic modifiers of vision and hearing
Hum. Mol. Genet.,
May 15, 2002;
11(10):
1195 - 1206.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. R. Krishna, K. R. Alexander, and N. S. Peachey
Temporal Properties of the Mouse Cone Electroretinogram
J Neurophysiol,
January 1, 2002;
87(1):
42 - 48.
[Abstract]
[Full Text]
[PDF]
|
 |
|