| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 From the Jules Stein Eye Institute, UCLA School of Medicine, and the 2 Molecular Biology Institute, UCLA, Los Angeles, California.
Abstract
PURPOSE. Many epidemiologic studies indicate an increased incidence of certain
vision threatening conditions in postmenopausal women. These data
suggest that changes in sex steroid homeostasis may affect the
physiology of the eye. To provide support to this hypothesis,
the expression of estrogen receptor alpha (ER
) in human eye
tissues was investigated.
METHODS. Complementary studies including RNA analysis by reverse transcription
polymerase chain reaction, western blot analysis, and
immunocytochemistry were used to provide evidence of ER expression.
Protein detection was carried out using a mouse monoclonal antibody
raised against an epitope located in the ligand binding domain of the
human receptor. Cellular localization was studied on formalin-fixed
paraffin-embedded eye sections using conventional immunohistochemical
techniques.
RESULTS. Gender and age differences in ER mRNA expression were observed in
retina. The 65-kDa ER protein was detected in the retina and retinal
pigment epithelium (RPE) of young female eyes but not in eye tissues
dissected from men and postmenopausal women. Immunocytochemistry
corroborated ER staining of a young female neurosensory retina and
RPE. In addition, ER could be detected in the ciliary body, in the
iris, and in the epithelium of the lens.
CONCLUSIONS. The presence of the ER in the human eye suggests that the sex
steroid hormone axis may play a role in the pathogenesis of certain
ocular diseases.
Significant gender-based differences in the incidence of many important ocular conditions raise the possibility that estrogens may have direct effects on the eye. Disorders such as age-related macular degeneration (AMD), idiopathic full-thickness macular hole, and cataract have been conclusively associated with gender and age in several epidemiologic studies. These investigations demonstrate an increased prevalence of high morbidity eye diseases in the elderly, and in postmenopausal women in particular.1 2 3 Furthermore, an elderly female population under estrogen replacement therapy has shown a reduced prevalence of nuclear cataract, indicating some beneficial effects of estrogens on lens physiology.4 Although other epidemiologic studies have suggested the prevalence of dry eye and glaucoma among the elderly, especially women, they involved different populations and different clinical end points and as such are inconclusive.5 6 7 Thus, the body of epidemiologic data points to an involvement of estrogens in the normal physiology of the human eye. A single study reported previously by Gans et al. failed to find estrogen and progesterone receptors in conjunctival human tissues.8
Estrogens are steroid hormones long known for their profound effects on
both male and female reproductive systems. Estrogens regulate growth,
differentiation, and function of diverse tissues both within and
outside the reproductive system. The effects of estrogens are mediated
by specific nuclear receptors, the estrogen receptor (ER) and ß
types, that act as hormone-inducible transcription
factors.9
10
11
Relatively recent findings demonstrate
important roles of the steroid hormones in the cardiovascular system,
in specific brain regions, in the liver, and in the maintenance of bone
tissue. Despite the wide range of tissues influenced by estrogens and
the broad transcriptional regulatory properties of the ligand-activated
ERs, the literature contains limited evidence of these receptors in
normal ocular tissues. This, and the large spectrum of physiological
alterations occurring in women after the normal hormonal decline of
menopause, or in males during andropause, motivated our studies. We
report here that the type of estrogen receptor is normally present
in the human eye and that gender and age differences may influence its
expression.
Materials and Methods
Tissue Collection
Human eyes were obtained from the Lions Eye Bank, Phoenix,
Arizona, and stored at -80°C. Tissues from 4 females, ages 35
(postmortem enucleation time [PET] 3 hours), 49 (PET 3 hours), 74
(PET 1.5 hours), and 77 (PET 3.5 hours) and 3 males, ages 27 (PET 3.5
hours), 45 (PET 5 hours), and 76 (PET 3 hours) were studied. In
addition, formalin-fixed paraffin-embedded human eye sections were
obtained from the Pathology Laboratory at the UCLA School of Medicine.
The majority of the samples were harvested during autopsy (females 48,
49, 55, 68, 77, 79, 83, 90, and 93 years of age and males 6, 13, 59,
and 65 years of age) except for a unique specimen obtained after
enucleation belonging to a female donor (age 17 years).
MCF-7 breast adenocarcinoma cells (American Type Culture Collection, ATCC# HTB-22) were grown in Dulbecco’s modified Eagle’s medium/Ham’s F-12 medium, 1:1 (vol/vol; D-MEM/F12; GIBCO–BRL, Grand Island, NY) supplemented with 15% fetal bovine serum (GIBCO–BRL), 1 mM sodium pyruvate (Sigma, St. Louis, MO), and antibiotic antimycotic solution (Sigma).
Detection of ER Transcripts in Retinas
Total RNA was obtained from retinas and MCF-7 cells using TRIzol
(GIBCO–BRL). All the RNA pellets were treated with 10 U/µl of
RNase–free DNaseI (Boehringer Mannheim, Indianapolis, IN) for 60
minutes at 37°C to eliminate DNA contamination. A pair of primers
previously designed by Enmark et al.12
was used to amplify
the ER open reading frame. Polymerase chain reactions (PCR) were
standardized by amplifying a 300–bp fragment of the –tubulin mRNA
with the primers 5'GCCACTTATGCCCCTGTCAT3' and 5'TCTCTGCACCTTGGCCAGGT3'.
First-strand cDNAs were synthesized using 1 µg of total RNA, 50 U of
murine leukemia virus reverse transcriptase (MuLVRTase; Perkin–Elmer,
Branchburg, NJ). The cDNA products were subjected to PCR in a
Robocycler (Stratagene, La Jolla, CA) using 2.5 U AmpliTaq DNA
polymerase (Perkin–Elmer) and the following program: 94°C for 2
minutes, 35 cycles (94°C for 60 seconds, 58°C for 80 seconds,
72°C for 90 seconds), 72°C for 10 minutes. The PCR products were
separated on a 2.5% agarose gel and blotted onto a Hybond N+ membrane
(Amersham Life Science, Arlington Heights, IL), according to the
manufacturer’s recommendations. The blots were then probed with an
internal oligonucleotide that recognized the ER sequence and that
had been radiolabeled with [
-32P]-dATP using
a polynucleotide kinase (Pharmacia Biotech, Piscataway, NJ). Blots were
hybridized overnight at 65°C and washed at a final stringency of
0.2% SSC plus 0.2% sodium dodecyl sulfate (SDS) at 60°C.
Detection of ER by Western Blot Analysis
Retina, retinal pigment epithelium (RPE)/choroid, sclera, and a
pool of anterior eye tissues, including cornea, iris, lens, and ciliary
body, were dissected from frozen eyes. Sclera and cornea–containing
samples were ground in a mortar before extraction. Nuclear extracts
from retina and the MCF-7 cell line were prepared according to the
method described by Fei et al.13
with some modifications.
Briefly, retinas or cell pellets were homogenized in buffer containing
10 mM Tris–HCl, pH 7.6, 25 mM KCl, 0.15 mM spermine, 0.5 mM
spermidine, 1 mM EDTA, 2 M sucrose, 10% glycerol, 1 mM dithiothreitol
(DTT), 0.2% Nonidet P-40, and 0.1 mM phenylmethyl sulfonyl fluoride
(PMSF) using a glass homogenizer and 3 to 4 strokes of a Teflon pestle.
The samples were centrifuged at 38,000 rpm for 30 minutes at 4°C to
sediment the nuclear fraction. Nuclear pellets were resuspended in
buffer A (10 mM Tris–HCl, pH 7.6, 0.4 M NaCl, 1.5 mM
MgCl2, 0.1 mM EGTA, 0.5 mM DTT, 5% glycerol, and
0.5 mM PMSF), and the nuclei were broken in an all-glass Dounce
homogenizer. Homogenates from RPE/choroid, minced sclera, and anterior
eye tissues were obtained after treatment with buffer A under the same
experimental conditions. Cellular debris was removed from each sample
by centrifugation at 14,000 rpm for 30 minutes in an Eppendorf
centrifuge. Protein concentration was determined by the Peterson
technique.14
Samples (20 µg of nuclear retinal extracts, 40 µg of MCF-7 cells
nuclear extracts, 100 µg protein from RPE/choroid, sclera, and
anterior eye fractions or 200 ng of the recombinant ER protein) were
electrophoresed on polyacrylamide gels (10%T/2%C) using a
Tris/tricine buffer system15
for 30 hours at 35 mA
constant current, and then transferred to nitrocellulose by the method
of Towbin et al.16
at 4 V/cm, 10°C, overnight.
Nitrocellulose membranes were blocked in 3% bovine serum albumin
(BSA), 0.1% Tween-20 in Tris-buffered saline (TBS: 500 mM NaCl, 20 mM
Tris, pH 7.6) for 2 hours at 37°C. Blots were then incubated
overnight with primary mouse monoclonal antiserum (1:500 dilution)
produced against the human ER (NeoMarkers, Fremont, CA) and the
products were visualized with the Amplified-Alkaline Phosphatase kit
(Bio–Rad Laboratories, Hercules, CA) using biotin–streptavidin.
Immunocytochemical Localization of ER
Formalin-fixed paraffin-embedded sections (10 µm) were
deparaffinized in xylene and hydrated through graded alcohols.
Immunolocalization of the sex steroid receptor was performed using
conventional immunohistologic techniques. Incubation with the primary
antibody (1.5 µg IgG/ml) was for 20 hours at 4°C in a moist,
air-tight chamber. Slides were exposed for 1 hour to biotinylated goat
anti-mouse immunoglobulin (1:1500 dilution). Antibody dilution was
prepared in PBS containing 0.5% normal goat serum, 2% Triton X-100,
and 5% BSA, and all buffer washes were performed with PBS. As
controls, some sections in each experiment were processed replacing the
primary antibody with normal mouse serum at the same working dilution.
Reactions were visualized using two alternative enzymatic detection
systems, an avidin–biotin–peroxidase/3,3'-diaminobenzidine (DAB) kit
or the alkaline phosphatase kit coupled with the Vector Blue substrate
reagent (Vector Laboratories, Burlingame, CA). Eosin-Y was used as
counterstaining, and sections were permanently mounted in the
recommended mounting solutions according to the manufacturer.
Results
ER mRNA Expression in Human Retina
Reverse–transcription PCR (RT–PCR) was used to amplify the ER
mRNA from different retinal tissues (Fig. 1)
. The primers chosen (5'AATTCAGATAATCGACGCCAG3' and
5'GTGTTTCAACATTCTCCCTCCTC3') amplified a 344–bp fragment from the
ER mRNAs (Fig. 1A)
; a 300–bp fragment amplified from the
-tubulin mRNA served as internal standard for each reaction (Fig. 1B)
. An ER-positive cell line, the mammary adenocarcinoma cell line
(MCF-7), was chosen as control (lane 7), because it had been reported
that MCF-7 cells produce high levels of ER as well as significant
but lower amounts of the beta type.12
17
18
19
Different
ER mRNA expression levels were detected in RNA isolated from retinas
of various donors. Qualitatively, ER transcripts were found in the
retinas of 2 females still having estrus cycles (35 and 49 years of
age; lanes 1 and 2) in contrast with a dim band seen in an older female
retina (74 years of age; lane 3). A retinal mRNA isolated from a
77-year-old female did not exhibit ER RT–PCR product (data not
shown). Two young men (27 and 45 years of age; lanes 4 and 5) and an
old man (76 years old; lane 6) all showed ER transcripts in their
retinal RNAs. Male retinas seemed to have mRNA levels intermediate
between young and old female retinas; in addition, the amount of
transcript did not change with increasing age. An internal ER
specific oligonucleotide probe (5'CCAATGACAAGGGAAGTATGGCT3') confirmed
the identity of the PCR products (Fig. 1C)
.
|
by Western Blot Analysis (Fig. 2)
showed an intensely labeled 65–kDa protein corresponding to the ER
recombinant protein (lane 1). Two lower-molecular-weight bands were
also labeled, but they may correspond to degradation products of the
recombinant protein. Nuclear extracts obtained from the positive
control cell line MCF-7 similarly exhibited the 65–kDa ER protein
(lane 10). ER was present in the nuclear retinal extract and in the
total protein extract from RPE/choroid isolated from the eyes of a
young female donor (lanes 2 and 4, respectively). ER was not
observed in the retina (lane 3) or RPE/choroid (lane 5) samples from
the 77-year-old donor eye; no positive reaction could be detected in
tissues from 2 other older females or 3 men examined under the same
experimental conditions (data not shown). ER seems to be absent from
cornea (lanes 6 and 7) and sclera (lanes 8 and 9) extracts in all the
samples analyzed (only shown are samples from the 35- and 77-year-old
female donors). The additional higher-molecular-weight proteins seen on
the western blot analysis are not specific, because they are also
present in blots analyzed in parallel where the primary antibody was
replaced by normal mouse serum (data not shown).
|
in Human Eye Sections was studied on paraffin-embedded sections from
a 17-year-old female donor eye. In this particular case, the eye was
fixed immediately after enucleation, eliminating any possibility of
rapid ER degradation. Immunohistochemical analysis of sections from
diverse donors (see the Materials and Methods section) corroborated the
results obtained with the 17-year-old donor eye and were in agreement
with the data generated by western blot analysis. The sections from
older eyes showed the predictable cellular death caused by the aging
process.
Immunolocalization of ER-expressing cells was carried out with the
same mouse monoclonal antibody used on the western blot (Figs. 3
,4, and 5).
No positive-labeled nuclei were observed when the primary antibody was
replaced with normal mouse serum (Fig. 3A)
. ER immunostaining was
observed across the neuroretina, in most of the nuclei of the outer
nuclear layer and inner nuclear layer, in a few cells in the outer
plexiform layer, presumably horizontal or bipolar cells, and in some
nuclei of the ganglion cell layer (Fig. 3B)
. Also evident was a strong
reaction in the axons of the ganglion cells. In general, the presence
of positive staining in other subcellular compartments except for
nuclei appears as a common problem of the immunocytological
techniques.20
|
expression in RPE. This
allowed us to distinguish our end product from the pigments normally
present in RPE cells. No positive staining could be observed in the
absence of the primary antibody (Fig. 3C)
in contrast to a strong
reaction in some of the RPE nuclei in its presence (Fig. 3D)
.
Anterior eye tissues such as the lens epithelium (Figs. 3F
and control
3E), the nonpigmented cell layer of the ciliary body epithelium (Figs. 3H
and control 3G), and cells in the stroma of the iris and around the
capillaries (Fig. 3I)
also showed immunoreactivity, indicating the
presence of ER. The receptor could not be visualized in the corneal
epithelium (Fig. 3J) .
Discussion
It is well known that age is a risk factor for loss of visual function in many diseases. Several clinical disorders appear during the aging process. Symptoms observed in menopausal women have been considered related to the abrupt decline in hormonal activity after the reproductive years. The aging male also experiences a number of physical alterations associated with a 30% decrease in circulating testosterone and other minor androgens, as well as prolactin, growth hormone, and insulin growth factor-1, although male estrogen levels remain unchanged throughout life.21
Several epidemiologic observations suggest a potential participation of estrogens in the homeostasis of the eye, but the mechanisms involved remain unclear. Hormone replacement therapies have been associated with a decreased incidence of ocular diseases, such as glaucoma,22 AMD,23 and cataract,24 25 further suggesting a central role for estrogens in ocular physiology. The classic cellular mechanism by which steroids act is through intracellular receptors, which modulate transcription and protein synthesis on the target cell after becoming activated. Recently, an alternative nongenomic pathway has been proposed to explain the rapid onset short-term effects of sex steroids in the brain.26 The authors suggested that cellular signaling mechanisms of neurotransmitters and steroids (estrogens being the most studied) exhibit significant similarities and proposed a new model of action through ligand-gated ion channels or G protein–coupled second-messenger systems.
In this study, we have used three complementary techniques to provide evidence for the presence of ER in the human eye. Our results suggest that the clinically observed modulatory properties of estrogens may be mediated by the expression of the ER in the ocular tissues. Although addressing mechanistic issues requires further study, synergistic estrogen effects through a nongenomic pathway cannot be discarded.
Expression of the ER gene was detected by RT–PCR using a set of
primers located within exons 2 and 4. Differences observed in the ER
mRNA levels of several eyes can be directly associated with gender and
age, because the housekeeping -tubulin gene, used as internal
standard in the reaction, exhibited similar expression in all the
samples. Apparently, gender and age are factors that may influence the
expression of the receptor. This suggests that the reduced amounts of
circulating estrogens in women after menopause and at all times in men
may lead to reduced transcriptional levels of the ER mRNA in the
target ocular tissues.
The high homology displayed between different members of the
superfamily of steroid receptors and the relatively recent finding of a
new ER type, the ERß, have made difficult the identification of a
specific antibody for detection of ER. For our protein analyses, we
used a monoclonal antiserum raised against an epitope located in the E
domain (amino acids 302–553) of the human ER, previously
characterized by Abbondanza et al.27
We considered the
presence of a protein band identical in molecular size to the
recombinant ER protein an additional confirmation of the receptor
identity in our samples. The complete absence of ER in retinal
extracts from three men and three postmenopausal women compared with a
significant protein expression in the retina of a young female was in
agreement with the mRNA differences observed by RT–PCR. However,
production of very low levels of ER, below the sensitivity of
detection of our assays could also explain the absence of the
immunoreactive protein in those samples. It is important to mention
that sample loading was normalized by measuring the amount of
total protein in each extract. Differences observed in the intensity of
nonspecific reactive bands after immunostaining (for instance, retinal
nuclear extracts from the young and old females) could also be the
result of changes in the relative amount of protein occurring during
cellular aging.
At this time, the significance of ER in human eye tissues is not clear.
However, together with epidemiologic evidence, the results presented
here suggest that alterations in ER physiology may be involved in the
pathogenic mechanisms underlying AMD, idiopathic full-thickness macular
hole, glaucoma, cataract, and dry eye. Interaction of steroid–receptor
complexes with responsive genes containing a consensus sequence for ER
binding can result in either induction or repression of transcription,
depending on the target gene and tissue. The broad number of
estrogen–induced proteins (e.g., progesterone receptor, cathepsin D,
2-macroglobulin, cytochrome P-450 aromatase, c–fos,
c–myc, heat shock protein 27, tumor growth factor , pS2)
identified to date may justify the multifaceted involvement of the
steroid hormones in the control of processes such as cell
proliferation, differentiation, physiology, and development.
Interestingly, most of these proteins have been found in human eye
tissues, such as RPE, retina, or ciliary body.28
29
30
31
32
33
Moreover, these proteins seem to be coexpressed with the ER, and, thus,
their regulation in the eye may be controlled by estrogens.
The presence of ER in the epithelia of several ocular tissues
such as retina, lens, ciliary body (nonpigmented), and, also, in the
iris stroma, brings up the possibility that ER could be regulating the
transcriptional expression of different target genes in those tissues.
Furthermore, the localization of ER in neuronal cells of the retina
and in specific brain areas suggests participation of the ER in the
regulation of neuronal function.
In summary, in an attempt to begin to investigate the molecular
mechanisms underlying gender–based predispositions in certain ocular
diseases, we have been able to demonstrate for the first time the
presence and localization of ER in human eye tissues.
Note added in proof
After submission of this manuscript, another group described the
presence of ER in bovine and rat retinas.34
As it could be
predicted, our findings in the human retina exactly correlate with
their description in the homologous mammalian tissue.
Acknowledgements
The authors thank Lynn Gordon, Ben Glasgow, and Vadim Poukens for generously providing many of the tissue samples used in these studies.
Footnotes
Reprint requests: Debora B. Farber, Jules Stein Eye Institute, UCLA School of Medicine, 100 Stein Plaza, Los Angeles, CA 90095-7000.
3 These authors contributed equally to this work. 
Supported by National Institutes of Health Grants EY02651 and EY0331 and a Research to Prevent Blindness Senior Scientific Investigators Award (DBF).
Submitted for publication July 14, 1998; revised March 11, 1999; accepted March 25, 1999.
Proprietary interest category: N.
References
2-macroglobulin and the
2-macroglobulin receptor/low-density-lipoprotein receptor-related
protein in the human eye [ARVO Abstract]. Invest Ophthalmol Vis
Sci. 1998;39(4):S35. Abstract nr 153.
This article has been cited by other articles:
|
|
 |
|
  D. Feskanich, E. Cho, D. A. Schaumberg, G. A. Colditz, and S. E. Hankinson Menopausal and Reproductive Factors and Risk of Age-Related Macular Degeneration Arch Ophthalmol, April 1, 2008; 126(4): 519 - 524. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. de Voogd, R. C. W. Wolfs, N. M. Jansonius, A. G. Uitterlinden, H. A. P. Pols, A. Hofman, and P. T. V. M. de Jong Estrogen Receptors Alpha and Beta and the Risk of Open-angle Glaucoma: The Rotterdam Study Arch Ophthalmol, January 1, 2008; 126(1): 110 - 114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Spoerl, V. Zubaty, F. Raiskup-Wolf, and L. E Pillunat Oestrogen-induced changes in biomechanics in the cornea as a possible reason for keratectasia Br. J. Ophthalmol., November 1, 2007; 91(11): 1547 - 1550. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. S. Boekhoorn, J. R. Vingerling, A. G. Uitterlinden, J. B. J. Van Meurs, C. M. van Duijn, H. A. P. Pols, A. Hofman, and P. T. V. M. de Jong Estrogen Receptor {alpha} Gene Polymorphisms Associated with Incident Aging Macula Disorder Invest. Ophthalmol. Vis. Sci., March 1, 2007; 48(3): 1012 - 1017. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A Eisner, D F Austin, and J R Samples Short wavelength automated perimetry and tamoxifen use Br. J. Ophthalmol., January 1, 2004; 88(1): 125 - 130. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Chowers, D. Liu, R. H. Farkas, T. L. Gunatilaka, A. S. Hackam, S. L. Bernstein, P. A. Campochiaro, G. Parmigiani, and D. J. Zack Gene expression variation in the adult human retina Hum. Mol. Genet., November 15, 2003; 12(22): 2881 - 2893. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Blackburn, E. E. Tarttelin, C. Y. Gregory-Evans, M. Moosajee, and K. Gregory-Evans Transcriptional Regulation and Expression of the Dominant Drusen Gene FBLN3 (EFEMP1) in Mammalian Retina Invest. Ophthalmol. Vis. Sci., November 1, 2003; 44(11): 4613 - 4621. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A J Lee, P Mitchell, E Rochtchina, and P R Healey Female reproductive factors and open angle glaucoma: the Blue Mountains Eye Study Br. J. Ophthalmol., November 1, 2003; 87(11): 1324 - 1328. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kaja, S.-H. Yang, J. Wei, K. Fujitani, R. Liu, A.-M. Brun-Zinkernagel, J. W. Simpkins, K. Inokuchi, and P. Koulen Estrogen Protects the Inner Retina from Apoptosis and Ischemia-Induced Loss of Vesl-1L/Homer 1c Immunoreactive Synaptic Connections Invest. Ophthalmol. Vis. Sci., July 1, 2003; 44(7): 3155 - 3162. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-M. Rakic, V. Lambert, M. Deprez, J.-M. Foidart, A. Noel, and C. Munaut Estrogens Reduce the Expression of YKL-40 in the Retina: Implications for Eye and Joint Diseases Invest. Ophthalmol. Vis. Sci., April 1, 2003; 44(4): 1740 - 1746. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Marin-Castano, S. J. Elliot, M. Potier, M. Karl, L. J. Striker, G. E. Striker, K. G. Csaky, and S. W. Cousins Regulation of Estrogen Receptors and MMP-2 Expression by Estrogens in Human Retinal Pigment Epithelium Invest. Ophthalmol. Vis. Sci., January 1, 2003; 44(1): 50 - 59. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. L. Davis, C.-C. Chan, T. J. Schoen, J. F. Couse, G. J. Chader, and K. S. Korach An estrogen receptor repressor induces cataract formation in transgenic mice PNAS, July 9, 2002; 99(14): 9427 - 9432. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Younan, P. Mitchell, R. G. Cumming, J. Panchapakesan, E. Rochtchina, and A. M. Hales Hormone Replacement Therapy, Reproductive Factors, and the Incidence of Cataract and Cataract Surgery: : The Blue Mountains Eye Study Am. J. Epidemiol., June 1, 2002; 155(11): 997 - 1006. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. E. Freeman, B. Munoz, O. D. Schein, and S. K. West Hormone Replacement Therapy and Lens Opacities: The Salisbury Eye Evaluation Project Arch Ophthalmol, November 1, 2001; 119(11): 1687 - 1692. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. A. Hulsman, I. C. D. Westendorp, R. S. Ramrattan, R. C. W. Wolfs, J. C. M. Witteman, J. R. Vingerling, A. Hofman, and P. T. V. M. de Jong Is Open-Angle Glaucoma Associated with Early Menopause? : The Rotterdam Study Am. J. Epidemiol., July 15, 2001; 154(2): 138 - 144. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Munaut, V. Lambert, A. Noel, F. Frankenne, M. Deprez, J.-M. Foidart, and J.-M. Rakic Presence of oestrogen receptor type {beta} in human retina Br. J. Ophthalmol., July 1, 2001; 85(7): 877 - 882. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Geller, W. M. Oshiro, N. Haykal-Coates, P. R. S. Kodavanti, and P. J. Bushnell Gender-Dependent Behavioral and Sensory Effects of a Commercial Mixture of Polychlorinated Biphenyls (Aroclor 1254) in Rats Toxicol. Sci., February 1, 2001; 59(2): 268 - 277. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Tachibana, T. Kasukabe, Y. Kobayashi, T. Suzuki, S. Kinoshita, and Y. Matsushima Expression of Estrogen Receptor {alpha} and {beta} in the Mouse Cornea Invest. Ophthalmol. Vis. Sci., March 1, 2000; 41(3): 668 - 670. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
