(Investigative Ophthalmology and Visual Science. 2000;41:3590-3599.)
© 2000
by The Association for Research in Vision and Ophthalmology, Inc.
Coordination between Production and Turnover of Interphotoreceptor Retinoid-Binding Protein in Zebrafish
Lisa L. Cunningham14 and
Federico GonzalezFernandez12,3
1 From the Graduate Program in Neuroscience and the
2 Departments of Ophthalmology and
3 Neuropathology, University of Virginia Health Sciences Center, Charlottesville, Virginia.
 |
Abstract
|
|---|
PURPOSE. Interphotoreceptor retinoid-binding protein (IRBP), which is secreted
by the photoreceptors of most vertebrates, is the major soluble protein
component of the interphotoreceptor matrix (IPM). Recent studies
suggest that IRBP is short lived in the IPM (half-life,
11 hours).
The mechanisms coordinating the production and removal of IRBP are not
known. Zebrafish provide a useful system to study the regulation of
these two processes, because its IRBP mRNA levels are under circadian
regulation. In the present study, the relationship between the quantity
of IRBP, the rate of its turnover, and the expression of its mRNA in
the zebrafish retina were examined.
METHODS. Full-length zebrafish IRBP was expressed in Escherichia
coli and an antiserum generated against purified recombinant
IRBP. Western and protein dot blot analyses and indirect
immunofluorescence were used to define the temporal and spatial
patterns of IRBP expression in the adult zebrafish. In vivo and in
vitro metabolic labeling experiments were used to examine the
regulation of IRBP turnover by both environmental light and the
lightdark cycle.
RESULTS. Despite the known rhythmicity in IRBP mRNA expression, neither the
amount of IRBP nor its localization changes significantly during the
lightdark cycle. IRBP is rapidly removed from the zebrafish eye (half
life,
7 hours). This rapid turnover is independent of environmental
lighting conditions during subjective day and is more rapid during the
day than at night.
CONCLUSIONS. Because the amount of IRBP remains constant throughout the day, the
enhanced daytime IRBP mRNA expression may function to compensate for an
increased turnover of the protein during the day. These findings
suggest that the processes of IRBP production and removal are
coordinately regulated.
 |
Introduction
|
|---|
The interphotoreceptor matrix (IPM) mediates critical
interactions between the neural retina and the retinal pigment
epithelium (RPE).1
2
This complex matrix is composed of
interphotoreceptor retinoid-binding protein (IRBP),
S-laminin,3
growth factors,4
5
specific
domains enriched in lectin-binding glycoconjugates,4
5
6
metalloproteases,7
and hyaluronan.8
In the
normal retina the concentrations of individual IPM components appear to
be carefully regulated, and abnormal expression of matrix components
has been associated with disease.9
10
11
12
Little is known
about the mechanisms regulating the amount of any IPM constituent. The
concentration of any molecule in the subretinal space depends on the
rates of both its introduction into and its removal from the IPM. The
rates of both production and removal may be linked to the photoreceptor
circadian oscillator,13
which regulates not only the
expression of many retinal genes but also photoreceptor outer segment
disc shedding,14
a potential mechanism for IRBP removal.
As a first step toward understanding the processes that regulate the
concentrations of the molecular components of the IPM, we examined the
expression and turnover of IRBP, the major soluble protein component of
the matrix. IRBP is a glycolipoprotein that has long been thought to
mediate the transfer of retinoids between the photoreceptors and the
RPE during the visual cycle.14
15
16
Targeted disruption of
the IRBP gene in mice shows that although IRBP is necessary for
photoreceptor survival, it is not essential for a normal rate of visual
pigment regeneration.17
Low levels of IRBP have been
reported for some disease states.12
18
19
20
21
However, the
mechanism responsible for abnormal IRBP expression has not been
established for any of these conditions.
In most vertebrates IRBP is secreted by both rod and cone
photoreceptors.22
23
In the subretinal space IRBP is short
lived and is rapidly cleared from the IPM.24
The mechanism
of this turnover is not known. Our long-term goal is to understand how
the process of IRBP production and the mechanism of its removal from
the matrix are coordinated.
The zebrafish offers a potentially useful system for studying the
relationship between the production of IRBP and the processes
responsible for its removal from the IPM. In this animal, IRBP is
produced primarily by the cones25
and to a lesser extent
by the RPE.26
We have shown that zebrafish IRBP mRNA
expression by non-UV cones is circadian, with higher levels of
expression occurring during the day than at night.25
In
contrast, UV cones express IRBP mRNA at similar levels throughout the
day.25
In this study, we asked whether the amount of IRBP
simply mirrors the expression of its mRNA or whether IRBP and its mRNA
are differentially expressed. The former suggests that a higher
concentration of IRBP in the IPM is required during the day than at
night. The latter suggests a coordination between IRBP production and
degradation.
 |
Methods
|
|---|
Animals
All experiments were approved by the University of Virginia Animal
Care and Use Committee and were conducted in accordance with the ARVO
Statement for the Use of Animals in Ophthalmic and Vision Research.
Adult zebrafish (Danio rerio) were maintained at 28.5°C on
a 12-hr12-hr lightdark cycle for at least 2 weeks before use.
Overhead fluorescent lamps provided a maximum irradiance in the aquaria
of approximately 10.7 µW/cm2. Zebrafish were
maintained according to Westerfield27
and killed by
decapitation with brain pithing.
Production of Recombinant Zebrafish IRBP and Antiserum
The small size of the zebrafish eye precludes extraction and
purification of sufficient quantities of native IRBP for biochemical
characterization and antiserum production. Therefore, we expressed in
Escherichia coli full-length zebrafish IRBP as a thioredoxin
fusion protein. Thioredoxin promotes soluble expression of many
recombinant proteins in E. coli,28
29
including
IRBP.30
To generate the thioredoxinzebrafish IRBP fusion
protein, we used the expression vector pThioHis (Invitrogen, San Diego,
CA). This system incorporates a histidine patch on the surface of the
thioredoxin ("His-patch" thioredoxin),31
allowing the
recombinant protein to be purified by metal-chelate affinity
chromatography. pThioHis uses the trc promoter, and protein
expression is induced by
isopropyl-ß-D-thiogalactopyranoside. We had
previously isolated and sequenced an intron-containing full-length cDNA
for zebrafish IRBP.25
An intronless cDNA was amplified
from total ocular RNA using sense primer
acaaggtacccggggatcctttctctcccacacttattgc and the
antisense primer cttaaggtcgactatagagaggctatatcatttggcttccgt
(the segment of each primer corresponding to the pThioHis multiple
cloning region is in italics; the nucleotides corresponding to the
N-terminal residue and the stop codon are underlined). The cDNA was
excised from pCRII with EcoRI and ligated into the
BamHI-XbaI site of pTrxFus (Invitrogen). The
reading frame was confirmed by DNA sequencing and the construct used to
transform E. coli (ToplO; Invitrogen).
The temperature and duration of protein expression were optimized in
pilot cultures to maximize yield of soluble recombinant protein.
Fermentations were performed in a 7-liter reactor (Applikon, Foster
City, CA). After the cells reached optical density
(OD)550 = 0.5, the temperature was lowered to
30°C before protein expression was induced. Cells were grown for 5
more hours, harvested by centrifugation, resuspended in 50 mM Tris (pH
7.4) and 100 mM NaCl, and ruptured with a French pressure cell. The
zebrafish IRBP-thioredoxin fusion protein was purified from the soluble
fraction by arsenic-based affinity chromatography.32
33
Approximately 9 mg (114 nanomoles) of purified recombinant zebrafish
IRBP was obtained per liter of E. coli. Rabbits received one
intradermal and one subcutaneous injection of 125 µg purified
recombinant zebrafish IRBP-thioredoxin fusion protein suspended in 0.5
ml Freunds complete adjuvant. Resultant antiserum was characterized
by enzyme-linked immunosorbent assay (ELISA) and found to have no
reactivity to thioredoxin (data not illustrated).
Western and Dot Blot Assays
Whole zebrafish eyes were frozen in liquid
N2 and homogenized in phosphate-buffered saline
(PBS) containing 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM EDTA,
1.5 µg/ml leupeptin, 1.5 µg/ml pepstatin A, and 3.0 µg/ml
aprotinin. Insoluble material was removed by centrifugation at
10,000g for 30 minutes at 4°C. Proteins were precipitated
from the supernatant in 6% trichloracetic acid (TCA) and 0.1%
deoxycholic acid, washed with acetone followed by ethanol, and
resuspended in Laemmli buffer containing dithiothreitol
(DTT).34
Protein equivalent to three eyes was fractionated
by sodium dodecyl sulfate (SDS)-10% polyacrylamide gel electrophoresis
(PAGE) and transferred to nitrocellulose membrane (NitroBind; Micron
Separations, Westboro, MA). The blot was washed in rinsing solution
(150 mM NaCl, 27 mM KCl, 25 mM Tris [pH 8.0], 0.005%
nonylphenyl-polyethylene glycol, and 0.001% Tween 20). Blocking was
performed for 2 hours in rinsing solution containing 0.5% bovine serum
albumin (BSA; Sigma, St. Louis, MO), 0.03% nonfat dry milk (Bio-Rad,
Hercules, CA). This was followed by overnight incubation in
anti-zebrafish IRBP serum (or preimmune serum) diluted 1:1000 in
blocking solution. The blot was washed in rinsing solution and
incubated for 2 hours with [125I]-goat
anti-rabbit IgG (ICN, Costa Mesa, CA) in blocking solution.
For dot blots, two eyes per tube were homogenized as for Western blot
analysis. Nitrocellulose membrane was soaked in Tris-buffered saline
(TBS: 150 mM NaCl, 27 mM KCl, 25 mM Tris [pH 8.0]) for 10 minutes and
placed in a dot blot manifold (Bio-Rad). Proteins corresponding to one
third of one eye were applied to each well and allowed to filter by
gravity. Wells were washed with TBS containing 0.05% Tween 20. The
nitrocellulose membrane was then dried and processed as described
earlier. Blots were analyzed using a PhosphorImager (Molecular
Dynamics, Sunnyvale, CA).
Quantitative RT-PCR
IRBP mRNA levels were compared at midlight and middark using
real-time reverse transcriptionpolymerase chain reaction (RT-PCR).
This technique uses a sequence-specific, fluorescently tagged
oligonucleotide probe to detect PCR products as they accumulate. The
probe contains both a reporter fluorescent dye and a quencher dye. When
the target sequence is present, the probe anneals to the PCR product,
and the quencher is cleaved by the 5' nuclease activity of
Taq DNA polymerase. This cleavage greatly increases the
fluorescent signal obtained from the probe. The probe is then cleaved
from the target sequence, allowing continuation of primer extension.
The thermal cycler (ABI Prism 7700; Perkin-Elmer Applied Biosystems,
Foster City, CA) is equipped with a laser and CCD camera to measure
fluorescence after each amplification cycle. Reactions are
characterized by the number of PCR cycles required for the fluorescent
signal to cross a threshold level above baseline.
Total ocular RNA equivalent to 5% of one zebrafish eye was extracted
from aliquots of the homogenized whole zebrafish eyes collected at
midlight and middark used in the dot blot assays. RNA was reverse
transcribed using random hexamer primers. PCR primers were
5'-CAGCAACATCCCTGCACTTC-3' (forward primer) and
5'-ACTTTTGATGAGCGCGATGA-3' (reverse primer). The sequence-specific IRBP
fluorescent probe sequence was 5'-6
FAM-CCAATGAACCCCACACCCGAGAATGT-TAMRA-3', where FAM represents the
fluorescent dye and TAMRA the fluorescent quencher. Cycling conditions
were as follows: (RT step) 25°C for 10 minutes,
48oC for 30 minutes, 95oC
for 5 minutes; (PCR step) 50oC for 2 minutes,
95oC for 10 minutes, and 40 cycles of
95oC for 15 seconds, 60oC
for 1 minute. Fluorescence intensity was measured after each cycle
using the sequence detection system (ABI Prism 7700), and data were
analyzed with the accompanying software (ABI Prism; PerkinElmer
Applied Biosystems).
Metabolic Studies
Both in vivo and in vitro approaches were used for IRBP
labeling studies. For in vivo labeling, adult zebrafish were
anesthetized by brief (
15 seconds) immersion in ice-cold water.
Zebrafish received a single systemic injection of
[35S]methionine (Amersham Life Sciences,
Arlington Heights, IL). The injection was performed using a 10 µl
syringe (Hamilton, Reno, NV) fused to a 5-cm beveled 30-gauge needle.
The needle was inserted into the ventral midline just caudal to the
pectoral fins; it was then passed under the skin caudally for a few
millimeters, and 5 µl (250 µCi) of
[35S]methionine was injected. Fish were out of
water for 15 to 25 seconds during the injection procedure. The
postinjection survival rate was more than 95%. After injection, fish
were maintained in cyclic light for 4 hours to 2 weeks. Whole eyes (10
per tube) were frozen in liquid N2. Eyes were
homogenized in 1 ml of NET buffer (50 mM Tris-HCl [pH 7.5], 150 mM
NaCl, 1 mM EDTA, 0.1% nonylphenyl-polyethylene glycol, 0.25% gelatin,
0.02% sodium azide) containing protease inhibitors (above), and
insoluble material was removed by centrifugation. Before
immunoprecipitation, samples were incubated with preimmune serum
followed by a 50% suspension of protein A-Sepharose CL-4B beads in 20
mM sodium phosphate [pH 8.0], 150 mM NaCl for 30 minutes at 4°C.
Beads were collected by centrifugation and discarded. The supernatant
was incubated with 25 µl anti-IRBP serum at 4°C for 1 hour
followed by protein A-Sepharose for 1 hour. Beads were washed
three times in NET buffer and resuspended in Laemmli buffer
containing DTT.
Two sets of in vitro experiments were performed. In the first, the rate
of IRBP turnover was compared in light versus dark during the day
(lightdark in vitro experiments). In the second study, IRBP turnover
was compared during the day versus at night (circadian in vitro
experiments). For in vitro lightdark labeling studies, eyes were
enucleated 3 hours after light onset. For circadian studies, eyes were
enucleated just after light onset and just before light offset. To
facilitate diffusion of medium into the posterior chamber, the lens was
removed through a corneal incision. The retinaRPE eyecups were
incubated in Dulbeccos modified Eagles medium (Gibco, Gaithersburg,
MD) without methionine supplemented with 0.015% vol/vol HEPES and
equilibrated with 95% O2/5%CO2.
[35S]methionine (0.5 mCi/ml) was added, and
eyes incubated for 1 hour at 22°C with gentle agitation. The chase
consisted of four 15-minute washes with medium containing a fivefold
excess of unlabeled methionine. After 1 hour in chase medium, tubes
(six eyes per tube) were frozen in liquid N2. For
lightdark studies, the remaining eyes were incubated for another 10
hours in either light or dark before they were collected in groups of
six and frozen. For circadian studies, remaining eyes were incubated
for another 8 hours in light or dark without interruption of their
regular lightdark cycle. For both studies IRBP was immunoprecipitated
from the undetached retinaRPE eyecups, as described.
Indirect Immunofluorescence
Adult zebrafish eyes were collected at midlight and middark.
To avoid disturbing the animals during collection, groups of animals
were separated into large beakers approximately 10 hours before
collection. Dark-adapted specimens were collected under dim red light.
Corneas were slit to facilitate the diffusion of fixative into the
globe. Eyes were fixed in 4% paraformaldehyde in 0.10 M phosphate
buffer (pH 7.4) for 12 hours at 4°C. The tissues were dehydrated
through graded ethanols and embedded in paraffin. Three-micrometer
sections on polylysine-coated slides were cleared, rehydrated, and
incubated in blocking solution (0.5% BSA; 2% calf serum; 0.08%
Triton X-100 in PBS) before overnight incubation at 4°C in
anti-zebrafish IRBP serum diluted 1:1000 in blocking solution. Sections
were then incubated for 2 hours in Oregon Green-conjugated goat
anti-rabbit IgG (Molecular Probes, Eugene, OR) diluted 1:200 in
blocking solution. Sections were protected from light during this and
all preceding steps. 4',6-diamidino-2-phenylindole (DAPI,
Sigma) was used as a nuclear counterstain. Sections were mounted in
fluorescent mounting medium (Fluoromount-G; Southern Biotechnology,
Birmingham, AL). Fluorescence microscopy was performed on an Axioplan 2
microscope (Zeiss, Thornwood, NY) equipped with a CCD camera
(Microview; Princeton Instruments, Trenton, NJ) and imaging software
(MetaMorph; Universal Imaging, West Chester, PA).
 |
Results
|
|---|
Immunofluorescent Localization of IRBP in the Zebrafish Retina
The distribution of IRBP in the retina at midlight and
middark was studied by indirect immunofluorescence (Fig. 1)
. Representative hematoxylin and eosinstained sections, which are
shown alongside the immunofluorescence, correlate the anatomic changes
due to retinomotor movements to the different fluorescence patterns at
midlight and middark.35
36
37
During light adaptation cone
photoreceptors contracted inward and rod photoreceptors
elongated, whereas RPE pigment granules migrated into apical processes.
In darkness the positions were reversed: pigment granules migrated
sclerad into the RPE cell body, whereas rods contracted and cones
elongated. Thus, in a light-adapted retina, cones were positioned for
light capture, whereas RPE pigment granules shielded rods from
illumination. In darkness, rods were positioned for maximum light
capture with cones located behind them.

View larger version (110K):
[in this window]
[in a new window]
|
Figure 1. Immunolocalization of IRBP in the adult zebrafish retina at midlight
(A, B, and C) and middark
(D, E, and F). Hematoxylin and
eosinstained sections (A, D) and schematic
diagrams (B, E) are shown to correlate
immunofluorescence patterns (C, F) with
retinomotor activity. (A, B) At midlight, cones were
contracted, rods were elongated, and RPE processes were filled with
pigment granules to the level of the cone inner segments.
(C) Immunolocalization of IRBP at midlight. IRBP was
restricted to the region between the outer limiting membrane and the
apical RPE border. There was relatively less fluorescence in the middle
of this region. Inset (from region indicated by *): Higher
magnification shows IRBP immunofluorescence outlining cone outer
segments (arrow). (D, E) At middark cones were
elongated, rods were contracted, and RPE pigment granules collected in
the RPE soma. (F) Immunolocalization of IRBP at middark. The
distribution of IRBP was similar to that at midlight except that the
fluorescence was more uniform throughout the IPM, and there was a zone
of decreased fluorescence near the RPE. Inset (from region
indicated by *): IRBP outlined both rod (arrow) and cone
(arrowhead) outer segments at middark. Nuclei were labeled
with DAPI. ROS, rod outer segments; PG, pigment granules; CN, cone
nuclei; OLM, outer limiting membrane; RN, rod nuclei; OPL, outer
plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer;
GC, ganglion cell layer; SS, short single cone; LS, long single cone;
DC, double cone; R, rod photoreceptor. Scale bar, (A,
C, D, F) 50 µm; (C,
F; insets) 20 µm.
|
|
At both midlight and middark IRBP was restricted to the region between
the neural retina and the RPE. At midlight (Fig. 1C)
the central
portion of this region was less fluorescent than that at midnight.
Intense fluorescence surrounded cones (Fig. 1C , inset). At middark
(Fig. 1F)
the fluorescence intensity was more uniform throughout the
region between the RPE and the neural retina. IRBP appeared to outline
the outer segments of both photoreceptor types, although rod outer
segments were obscured by RPE pigment granules at midlight. At middark
(Fig. 1F)
, IRBP immunofluorescence outlined both rod and cone outer
segments.
Western and Dot Blot Analyses
The quantity of IRBP throughout the lightdark cycle was
monitored by Western and dot blot analyses. As in our previous
study,25
to minimize errors associated with tissue
dissections, we extracted total soluble proteins from intact globes
rather than from IPM obtained from detached retinas. The Western blot
analysis is shown in Figure 2
. Eyes were collected in pairs at 3-hour intervals throughout the
lightdark cycle. At each time point a single immunoreactive band of
relative molecular mass (Mr) of 76.6 was
identified, consistent with the size of zebrafish and other teleost
IRBPs.25
Phosphorimaging did not show a significant
difference in the amount of IRBP at any time point in the lightdark
cycle.

View larger version (45K):
[in this window]
[in a new window]
|
Figure 2. Western blot analysis of IRBP throughout the lightdark cycle.
(A) Representative Western blot analyses are shown for each
time point. The time (in hours relative to light onset) is shown at the
top of each panel. The arrow indicates the IRBP band
(Mr = 77). (B) The average IRBP band
density is shown for each time point. Error bars represent ± SEM
for four pairs of eyes per time point.
|
|
Having established the specificity of the antiserum, we further
analyzed IRBP levels by dot blot analysis, which allowed the sample
size to be efficiently increased. Figure 3
shows the relationship between loading level and signal intensity.
Binding specificity was further established by comparison to BSA
incubated with immune serum and to total soluble ocular proteins
incubated with either preimmune serum or with immune serum preadsorbed
with recombinant IRBP (Fig. 3B)
. For the experimental samples shown in
Figure 4a
loading level of 0.3 eyes/dot was selected. This loading level fell
within the dynamic range of the assay while providing adequate signal
intensity.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 3. Dot blot assay for quantification of IRBP. Soluble ocular proteins
equivalent to 0.3 eyes were immobilized on nitrocellulose and treated
with anti-zebrafish IRBP serum followed by I25I-labeled
goat anti-rabbit IgG. Signal intensity was quantified by
phosphorimaging. (A) Phosphorimager dot signal intensity
versus fraction of zebrafish eye. Each point represents the average of
two measurements. Representative dots corresponding to the first five
plotted data points are shown below the curve. (B) Control
dot blots. Top: Dot loaded with 200 µg BSA; blot was
incubated with immune serum (dot density, 40).
Middle: Dot loaded with soluble ocular proteins equivalent
to 0.3 eye; blot was incubated with preimmune serum (dot density, 51).
Bottom: Dot loaded with soluble ocular proteins equivalent
to 0.3 eye; blot was incubated with rabbit immune serum preadsorbed
with recombinant zebrafish IRBP (dot density, 12).
|
|

View larger version (42K):
[in this window]
[in a new window]
|
Figure 4. IRBP dot blot and real-time RT-PCR analysis. (A) IRBP levels
throughout the lightdark cycle. Zebrafish eyes were homogenized in
pairs, and total soluble ocular proteins equivalent to 0.3 eye were
loaded per dot (error bars indicate ± SEM, n = 8 dots
per time point). Representative dot signals are shown above each bar.
Equivalent dots incubated with preimmune serum are shown at far
right (Pre). IRBP mRNA levels in the whole eye
(curve) are shown superimposed on the protein level for each
time point (replotted from Rajendran et al.25
).
(B) Real-time RT-PCR analysis of IRBP mRNA levels at
midlight and middark. The analysis was performed on aliquots of the
same samples used in Figure 3A
. Fluorescence values (mean ± SEM)
for RNA collected at midlight (n = 5) and middark (n
= 4) are shown for each PCR cycle after cycle 10. Fluorescence
intensity increased more rapidly in tubes containing RNA collected at
midlight than at middark. Inset: Standard curve obtained
from loading increasing amounts of total RNA. Amount of RNA loaded is
plotted against the number of PCR cycles required for the fluorescent
signal to reach threshold value.
|
|
Figure 4A
shows the mean IRBP dot densities at 3-hour intervals
throughout the lightdark cycle. IRBP levels did not change
significantly during the 24-hour period. The constant level of IRBP in
the whole eye was in contrast to the known circadian expression of IRBP
mRNA (also in the whole eye; overlay in Fig. 4A
).25
To
show that IRBP mRNA levels were rhythmic in the same animals used for
the dot blot assay, we used quantitative real-time RT-PCR to compare
the level of IRBP mRNA expression at midlight with that at middark. The
real-time RT-PCR approach allows for measurement of the amplified
product after each PCR cycle using a fluorescent probe. The reaction is
characterized by the number of cycles required for the fluorescent
signal to rise above the noise (i.e., reach a threshold value). The
data in Figure 4B show that the fluorescence intensity for IRBP mRNA
increased more rapidly for eyes collected at midlight (cycles to reach
threshold: 18.06 ± 0.36) than at middark (cycles to reach
threshold: 19.98 ± 0.32). The shift of 1.92 cycles between
midlight and middark tubes was compared with a standard curve (Fig. 4B
,
inset) generated by amplifying IRBP mRNA from varying amounts of total
ocular RNA. This comparison yielded an estimate of the increase in IRBP
mRNA of 4.94-fold at midlight versus middark. This estimate is
consistent with the previously reported rhythmicity of IRBP mRNA
expression.25
Metabolic Labeling Studies
The turnover of IRBP was characterized by in vivo and in vitro
metabolic labeling experiments. Both approaches used
immunoprecipitation to isolate the radiolabeled IRBP from total
ocular-soluble proteins. The specificity of the immunoprecipitation
assay is shown in Figure 5
. Anti-zebrafish IRBP serum was incubated with the total soluble ocular
proteins in the absence (lanes 2 and 4) and presence (lanes 3 and 5) of
an excess of purified recombinant zebrafish IRBP-thioredoxin fusion
protein. In the Coomassie bluestained gel (left) the major band at
Mr of approximately 55 represents the
immunoglobulins. The band at Mr of approximately
82 in lane 3 is the added recombinant IRBP-thioredoxin fusion protein.
The fluorogram (right) shows the radiolabeled immunoprecipitated
proteins. The radiolabeled protein band of Mr
76.6, which is the most prominent band in lane 4, has an
electrophoretic mobility identical with that of zebrafish IRBP
identified by Western blot in Figure 2 . When the antibody was
preadsorbed with the recombinant IRBP the Mr of
76.6 band (and fainter higher and lower bands) disappeared. This
triplet (Mrs = 82.4, 76.6, and 73.5) is
identified by the bracket to the right of the fluorogram. Faint bands
at Mrs of approximately 200 and 43 in lane 4 are
prominent in the preadsorbed control (lane 5). These bands and another
at Mr of approximately 65 may represent proteins
that bind to the recombinant zebrafish IRBP. Whether these proteins
normally interact with IRBP in the IPM is under study in our
laboratory.

View larger version (103K):
[in this window]
[in a new window]
|
Figure 5. Immunoprecipitation of IRBP from eyes of zebrafish injected
systemically with [35S]methionine.
[35S]IRBP was immunoprecipitated from the soluble
fraction of homogenized whole eyes. Left:
Coomassie bluestained gel; right: its fluorogram.
Lane 1: Molecular weight standards. Lanes
2 and 4: Total soluble ocular proteins incubated
with anti-zebrafish IRBP serum. The darkest band in the IRBP triplet
has electrophoretic mobility (Mr = 76.6) equal to IRBP
identified by Western blot (Fig. 2)
. Lanes 3 and
5: The immune serum was preadsorbed with recombinant
zebrafish IRBP. The recombinant IRBP is the Mr = 82
band in lane 3 (the recombinant IRBP is larger than
native IRBP because of the thioredoxin fusion tag). Preadsorption of
immune serum with recombinant IRBP (lane 5) resulted in
elimination of three bands with Mrs of 82.4, 76.6, and
73.5.
|
|
In Figure 6
zebrafish were killed 4 hours to 14 days after a single systemic
injection of [35S]methionine. The
fluorograms in Figure 6A
represent the emergence and
disappearance of [35S]IRBP and
[35S]opsin. Note that the immunoprecipitated
[35S]IRBP bands represent a triplet similar to
that seen in Figure 5
. [35S]IRBP accumulated in
the eye for 12 to 24 hours after injection before declining. By 14 days
[35S]IRBP levels had decreased to approximately
that seen at 4 hours. [35S]opsin, which
migrates on SDS-PAGE as a group of bands with Mr
of 36 to 39,38
39
accumulated in the zebrafish eye at
approximately the same rate as [35S]IRBP.
Unlike [35S]IRBP, the amount of
[35S]opsin remained constant for
approximately 12 days before declining by 14 days after injection.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 6. In vivo metabolic labeling studies of IRBP and opsin turnover. Adult
zebrafish were injected with [35S]methionine and
maintained in cyclic light for 4 hours to 14 days after injection. IRBP
was immunoprecipitated using rabbit anti-zebrafish IRBP. Opsin was
resolved from the insoluble fraction by SDS-10% PAGE. (A)
Representative phosphorimaging bands of IRBP and opsin are shown for
various time points after injection of
[35S]methionine. (B) Time course of
turnover of [35S]IRBP () and
[35S]opsin ( ). Each point represents one to
two experiments in which 10 eyes were pooled; opsin data are normalized
to IRBP peak expression value. The maximum biological half-life of IRBP
is 6 days.
|
|
To better achieve a pulse label of photoreceptor proteins, we exposed
isolated retina-RPE eyecups to a pulse of
[35S]methionine followed by a chase containing
an excess of unlabeled methionine. The incorporation of
[35S]methionine into IRBP and transducin were
measured immediately after the chase and after 10 hours in either
constant light or constant dark. The specific activity of transducin
did not significantly change during the 10-hour chase incubation in
either light or dark (Fig. 7)
. In contrast, IRBP-specific activity decreased fourfold in both light
and dark.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 7. IRBP turnover in light versus dark during the day. Retina-RPE eyecups
were subjected to a [35S]methionine pulsechase. A first
group of eyecups was collected 1 hour after the chase. Two remaining
groups of eyecups were incubated for an additional 10 hours in either
light or dark. (A) Representative phosphorimaging bands of
immunoprecipitated 35S-IRBP and
35S-transducin (as well as Coomassie
bluestained bands used to calculate transducin specific activity) are
shown for each collection time point. (B) Quantification of
IRBP and transducin in light and dark. IRBP band densities decreased
significantly during 10 hours of either light or darkness, whereas
transducin specific activity remained high (n = 57 tubes
of six eyes each for each time point; mean ± SEM).
|
|
To compare the rate of IRBP turnover during the day with that during
the night, we repeated the [35S]methionine
pulsechase paradigm using retina-RPE eyecups collected just after
light onset with those collected just before light offset. The
incubations were terminated 1 hour and 8 hours after the pulsechase.
IRBP was immunoprecipitated from the total ocular soluble proteins.
Results are shown in Figure 8
. The specific activity of IRBP was lower in the 1-hour nighttime group
than in the 1 hour daytime group. This is consistent with the fact that
the level of IRBP mRNA expression in the morning is higher than that at
night. At 8 hours, the level of [35S]IRBP
decreased approximately 60% for the daytime group. For the nighttime
group, there was not a significant change in the amount of
[35S]IRBP between the 1- and 8-hour time
points.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 8. IRBP turnover during the day versus the night. Eyecups from animals
killed just after light onset (day) or just before light offset (night)
were subjected to a [35S]methionine pulsechase and then
incubated for 1 or 8 hours without interruption of their established
lightdark cycle (i.e., "day" eyecups were incubated in the light,
and "night" eyecups were incubated in the dark). IRBP was
immunoprecipitated and the amount of radiolabel associated with the
IRBP band measured by phosphorimaging (representative bands are shown
in the inset). [35S]IRBP signal intensity
decreased approximately 60% during the day but changed little
overnight. Data represent mean ± SEM for four to five tubes (six
eyes per tube).
|
|
 |
Discussion
|
|---|
IRBP appeared to distribute itself throughout the IPM. Although
IRBP mRNA expression is largely cone specific,25
indirect
immunofluorescence showed that the protein was not restricted to the
cone matrix sheath but was associated with the IPM of rods as well as
cones. Although the immunofluorescence showed IRBP associated with the
matrix immediately surrounding rod and cone outer segments, the finding
that IRBP turnover occurs at a faster rate than that of either opsin or
transducin suggests that IRBP may not be tightly bound to outer
segments. It also suggests that the mechanism of IRBP turnover likely
differs from that of opsin and transducin, each of which are turned
over through outer segment disc shedding. The possibility that IRBP can
move within the matrix was also suggested by others who observed
changes in the spatial distribution of IRBP in the light compared with
the dark. In the present study, the pattern of IRBP immunofluorescence
was different at midlight compared with middark but probably for a
different reason. We found that the outer segment region showed less
immunofluorescence at midlight than at middark. Although this pattern
is reminiscent of that for albino rats,40
in the present
study, the reduced immunofluorescence in the central region of the
subretinal compartment at midlight was probably due to quenching of the
fluorescent signal by RPE pigment granules.
Quantitative RT-PCR experiments indicated that IRBP mRNA levels were
approximately five times higher at midlight than at middark. This is
consistent with our previous mRNA dot blot study that showed a four- to
sevenfold increase in the amount of IRBP mRNA at midlight compared with
middark.25
In situ hybridization studies have shown that
nighttime IRBP mRNA expression is restricted to the UV-sensitive cone
photoreceptors. In contrast, all cone subtypes express IRBP mRNA during
the day.25
Taken together, our Western blot and immunofluorescence studies showed
that the quantity of IRBP in the zebrafish eye remained constant
throughout the lightdark cycle. This is in contrast to the circadian
expression of its mRNA. One explanation for the differential expression
of IRBP and its mRNA is that the rate of removal of IRBP is an
important regulator of its concentration in the matrix. To explore this
issue we used metabolic labeling to examine the turnover of IRBP.
Because the small size of the zebrafish eye precludes the use of
intraocular injections for protein labeling, we used in vivo systemic
injections and in vitro pulsechase paradigms.
The in vivo systemic injections significantly underestimated the IRBP
turnover rate compared with the in vitro pulsechase studies. The main
issue is that [35S] released from the breakdown
of labeled proteins was partly reincorporated into newly synthesized
IRBP. Because of this tracer recycling, the estimate of an IRBP
half-life of 6 days (based on the data from the
[35S]methionine systemic injections) is an
overestimate of the true half-life. Nevertheless, these in vivo
experiments show that the turnover of IRBP was significantly faster
than that of opsin. Opsin turnover occurs by RPE internalization and
degradation during the circadian process of photoreceptor outer segment
disc shedding.14
Removal of
[35S]opsin occurred when the radiolabeled discs
reached the distal tip of the outer segment and were internalized by
the RPE. Because of the time involved in the displacement of the
labeled band to the RPE we did not see a reduction in radiolabeled
opsin until after 12 days. In contrast, the amount of radiolabeled IRBP
began to decrease only 2 days after the injection.
The retina-RPE eyecup pulsechase experiments showed that the rate of
IRBP turnover was faster than estimated by the in vivo study. In the
eyecup preparation the biological half-life of IRBP during the day (in
either light or dark) was approximately 7 hours. This estimate is
consistent with recent studies in Xenopus laevis in which
intraocular injections of carboxyl-terminal labeled leucine
([1-14C]leucine) were used to estimate the IRBP
turnover rate.24
The early decarboxylation of leucine
during its degradation liberates the radiolabel as
[14C]CO2, which is not
significantly recycled into new protein. In the present in vitro study,
recycling of the radiolabel was not an issue, because in the eyecup
preparation, the pulse could be followed by a chase. Thus, the expense
of [1-14C]leucine is avoided. Our data suggest
that during the day, IRBP is rapidly removed from the subretinal space
by a process that is not dependent on environmental lighting
conditions.
IRBP turnover could not be detected at night, offering a possible
explanation for the differential expression of IRBP and its mRNA. It is
plausible that the rate of IRBP production is matched to the rate of
its removal from the IPM. According to this working model, gene
expression and protein turnover in the zebrafish retina are coordinated
to achieve a constant concentration of IRBP in the IPM throughout the
day. Higher daytime IRBP mRNA levels may compensate for an increased
daytime degradation of IRBP. At night, IRBP mRNA levels may decrease to
match the reduced rate of IRBP degradation. It should be pointed out
that this model relies on the assumption that the level of IRBP mRNA is
directly related to IRBP synthesis. Although our data do not rule out a
contribution of regulatory mechanisms controlling ribosome access to
the translation start codon,41
the finding that IRBP
production is lower at night (when the mRNA level is lowest) than
during the day (Fig. 8)
suggests that IRBP mRNA expression directly
correlates with the rate of IRBP synthesis.
The notion that the mechanism(s) responsible for the removal of IRBP
from the subretinal space plays an important role in regulating the
extracellular IRBP concentration is consistent with the work of others.
Light-deprived mice show a marked reduction in IRBP mRNA without a
decrease in the amount of IRBP.9
The maintenance of IRBP
levels despite reduced IRBP mRNA expression could be explained by a
decreased rate of IRBP removal during light deprivation. Others have
noted that retinol deprivation or replenishment depresses or enhances
IRBP expression, respectively, without altering the level of its mRNA
or the rate of its gene transcription.42
The accumulation
of IRBP in the vitiligo mouse despite normal IRBP mRNA
levels also suggests that if we are to understand what controls the
concentrations of matrix components, we must consider not only the
mechanisms regulating IPM production but also those responsible for
removal of specific matrix components from the subretinal compartment.
Because its Stokes radius is greater than the photoreceptor
Müller cell zonulae adherens exclusion limit, IRBP cannot simply
leave the IPM by diffusion but must be cleared from the subretinal
compartment by endocytosis and/or proteolysis.43
Although
certain IPM components may be removed enzymatically,8
IRBP
proteolytic fragments are not observed in IPM extracts, and
RPE-conditioned media do not degrade native IRBP.44
RPE
phagocytosis of shed photoreceptor outer segment discs is another
possible uptake pathway, and immunoelectron microscopy has detected
IRBP within RPE phagosomes.45
46
However, several lines of
evidence suggest that disc shedding is not the primary mechanism of
IRBP turnover. First, in our in vivo and in vitro metabolic labeling
experiments, IRBP turned over faster than either opsin or transducin.
Because disc shedding is the primary mechanism of both opsin and
transducin turnover, the finding that IRBP was removed faster than
either opsin or transducin suggests that disc shedding is not the
primary mechanism of IRBP turnover. Second, in our in vitro experiments
the pulse labeling was performed after most disc shedding would have
occurred. Phagocytosis of rod discs occurs in all vertebrates shortly
after lights on.14
While the timing of zebrafish rod disc
shedding has not been studied, zebrafish retinomotor activity shows
rhymthmicity similar to that of other teleosts (Gregory M. Cahill,
personal communication, August, 2000). If zebrafish rod disc shedding
is also rhythmic, occurring as in other teleosts shortly after light
onset,47
48
then the observed clearance of IRBP could not
occur through phagocytosis of rod discs since the animals were not used
until 3 hours after light onset. Third, although our experiments
measured IRBP removal from the whole eye, a similar conclusion has been
reached in studies of IRBP turnover in
Xenopus.46
In those studies in which the larger
size of the Xenopus eye permitted separate analysis of IRBP
in the retina, IPM, and RPE, the amount of IRBP in the RPE did not
increase after disc shedding.46
A potential mechanism for IRBP removal from the IPM is nonphagocytic
endocytosis. Endosomes containing IRBP have been observed in both the
RPE and photoreceptors.45
46
Furthermore, there is
evidence that photoreceptor IRBP uptake is receptor mediated and
targeted to the lysosomal system.49
Taken together, the
above data implicate nonphagocytic endocytosis as a likely mechanism
for IRBP removal. Ongoing studies in our laboratory will define the
mechanism(s) responsible for the coordination of IRBP production and
its removal from the IPM.
 |
Acknowledgements
|
|---|
The authors thank Oswald Steward and Thomas Briese for assistance
with RT-PCR experiments and Ellen Van Niel and Yonde Bao for
preparation of plasmid constructs.
 |
Footnotes
|
|---|
4 Present address: Virginia Merrill Bloedel Hearing Research
Center, Department of Otolaryngology-HNS, University of Washington, Box
357923, Seattle, WA 98195-7923. 
Supported by National Institutes of Health Grant EY09412 (FG-F); the
Thomas F. Jeffress and Kate Miller Memorial Trust (FG-F); a
WyethAyerst Laboratories Scholarship through the Business and
Professional Womens Foundation (LLC); and an unrestricted grant from
Research to Prevent Blindness to the Department of Ophthalmology at the
University of Virginia Health Sciences Center.
Submitted for publication February 22, 2000; revised May 15, 2000;
accepted June 9, 2000.
Commercial relationships policy: N.
Corresponding author: Federico GonzalezFernandez, Department of
Ophthalmology, University of Virginia Health Sciences Center, PO Box
10009, Charlottesville, VA 22908. fg2z{at}virginia.edu
 |
References
|
|---|
-
Bok, D. (1993) The retinal pigment epithelium: a versatile partner in vision J Cell Sci 17,189-195
-
Mieziewska, K. (1996) The interphotoreceptor matrix, a space in sight Microsc Res Tech 35,463-471[Medline][Order article via Infotrieve]
-
Hunter, DD, Murphy, MD, Olsson, CV, Brunken, WJ (1992) S-laminin expression in adult and developing retinae: a potential cue for photoreceptor morphogenesis Neuron 8,399-413[Medline][Order article via Infotrieve]
-
Hageman, GS, KirchoffRempe, MA, Lewis, GP, Fisher, SK, Anderson, DH (1991) Sequestration of basic fibroblast growth factor in the primate retinal interphotoreceptor matrix Proc Natl Acad Sci USA 88,6706-6710[Abstract/Free Full Text]
-
Hewitt, AT, Lindsey, JD, Carbott, D, Adler, R. (1990) Photoreceptor survival-promoting activity in interphotoreceptor matrix preparations: characterization and partial purification Exp Eye Res 50,79-88[Medline][Order article via Infotrieve]
-
Johnson, LV, Hageman, GS (1991) Structural and compositional analyses of isolated cone matrix sheaths Invest Ophthalmol Vis Sci 32,1951-1957[Abstract/Free Full Text]
-
Plantner, JJ (1992) The presence of neutral metalloproteolytic activity and metalloproteinase inhibitors in the interphotoreceptor matrix Curr Eye Res 11,91-101[Medline][Order article via Infotrieve]
-
Hollyfield, JG, Rayborn, ME, Tammi, M, Tammi, R. (1998) Hyaluronan in the interphotoreceptor matrix of the eye: species differences in content, distribution, ligand binding and degradation Exp Eye Res 66,241-248[Medline][Order article via Infotrieve]
-
Kutty, G, Duncan, T, Nickerson, JM, et al (1994) Light deprivation profoundly affects gene expression of interphotoreceptor retinoid-binding protein in the mouse eye Exp Eye Res 58,65-75[Medline][Order article via Infotrieve]
-
Lazarus, HS, Sly, WS, Kyle, JW, Hageman, GS (1993) Photoreceptor degeneration and altered distribution of interphotoreceptor matrix proteoglycans in the mucopolysaccharidosis VII mouse Exp Eye Res 56,531-541[Medline][Order article via Infotrieve]
-
Smith, SB, Lee, L, Nickerson, J, Chader, GJ, Wiggert, B. (1992) Synthesis and secretion of interphotoreceptor retinoid-binding protein (IRBP) and developmental expression of IRBP mRNA in normal and rd mouse retinas Exp Eye Res 54,957-963[Medline][Order article via Infotrieve]
-
Wiggert, B, van, VT, Kutty, G, et al (1994) An early decrease in interphotoreceptor retinoid-binding protein gene expression in Abyssinian cats homozygous for hereditary rod-cone degeneration Cell Tissue Res 278,291-298[Medline][Order article via Infotrieve]
-
Cahill, GM, Besharse, JC (1993) Circadian clock functions localized in xenopus retinal photoreceptors Neuron 10,573-577[Medline][Order article via Infotrieve]
-
Besharse, JC (1982) The daily light/dark cycle and rhythmic metabolism in the photoreceptor-pigment epithelial complex Prog Retinal Res ,81-124 Pergamon Press Oxford.
-
Crouch, RK, Chader, GJ, Wiggert, B, Pepperberg, DR (1996) Retinoids and the visual process Photochem Photobiol 64,613-621[Medline][Order article via Infotrieve]
-
Saari, JC (1994) Retinoids in photosensitive systems Sporn, MB Roberts, AB Goodman, DS eds. The Retinoids: Biology, Chemistry and Medicine ,351-385 Raven Press New York.
-
Palczewski, K, Van Hooser, JP, Garwin, GG, Chen, J, Liou, GI, Saari, JC (1999) Kinetics of visual pigment regeneration in excised mouse eyes and in mice with a targeted disruption of the gene encoding interphotoreceptor retinoid-binding protein or arrestin Biochemistry 38,12012-12019[Medline][Order article via Infotrieve]
-
Smith, SB, Duncan, T, Kutty, G, Kutty, RK, Wiggert, B. (1994) Increase in retinyl palmitate concentration in eyes and livers and the concentration of interphotoreceptor retinoid-binding protein in eyes of vitiligo mutant mice Biochem J 300,63-68
-
Bridges, CD, Price, J, Landers, RA, et al (1986) Interstitial retinol-binding protein (IRBP) in subretinal fluid Invest Ophthalmol Vis Sci 27,1027-1030[Abstract/Free Full Text]
-
Narfstrom, K, Nilsson, SE, Wiggert, B, Lee, L, Chader, GJ, van Veen, T. (1989) Reduced level of interphotoreceptor retinoid-binding protein (IRBP), a possible cause for retinal degeneration in the Abyssinian cat Cell Tissue Res 257,631-639[Medline][Order article via Infotrieve]
-
Newsome, DA, Chader, GJ, Wiggert, B, et al (1988) Interphotoreceptor retinoid-binding protein levels in subretinal fluid from rhegmatogenous retinal detachment and retinopathy of prematurity Arch Ophthalmol 106,106-110[Abstract/Free Full Text]
-
GonzalezFernandez, F, Kittredge, KL, Rayborn, ME, et al (1993) Interphotoreceptor retinoid-binding protein (IRBP), a major 124 kDa glycoprotein in the interphotoreceptor matrix of Xenopus laevis: characterization, molecular cloning and biosynthesis J Cell Sci 105,7-21[Abstract]
-
Porrello, K, Bhat, SP, Bok, D. (1991) Detection of interphotoreceptor retinoid binding protein (IRBP) mRNA in human and cone-dominant squirrel retinas by in situ hybridization J Histochem Cytochem 39,171-176[Abstract]
-
Cunningham, LL, Yang, L, Gonzalez-Fernandez, F. (1999) Interphotoreceptor retinoid-binding protein (IRBP) is rapidly cleared from the Xenopus interphotorecetor matrix Exp Eye Res 68,399-410[Medline][Order article via Infotrieve]
-
Rajendran, RR, Van, NE, Stenkamp, DL, Cunningham, L, Raymond, PA, Gonzalez-Fernandez, F (1996) Zebrafish interphotoreceptor retinoid-binding protein: differential circadian expression among cone subtypes J Exp Biol 199,2775-2787[Abstract/Free Full Text]
-
Stenkamp, DL, Cunningham, LL, Raymond, PA, Gonzalez-Fernandez, F. (1998) Novel expression pattern of interphotoreceptor retinoid-binding protein (IRBP) in the adult and developing zebrafish retina and RPE Mol Vis 4,26-39[Medline][Order article via Infotrieve]
-
Westerfield, M. (1995) The Zebrafish Book 3rd ed. University of Oregon Press Eugene, OR.
-
LaVallie, ER, DiBlasio, EA, Kovacic, S, Grant, KL, Schendel, PF, McCoy, JM (1993) A thioredoxin gene fusion expression system that circumvents inclusion body formation in the E. coli cytoplasm Biotechnology 11,187-193[Medline][Order article via Infotrieve]
-
McCoy, JM, LaVallie, ER (1994) Expression and purification of thioredoxin fusion proteins Ausubel, FM Brent, R Kingston, RIet al eds. Current Protocols in Molecular Biology ,16:8.1-16.8.14 John Wiley & Sons, Inc.
-
Baer, CA, Retief, JD, Van Niel, E, Braiman, MS, Gonzalez-Fernandez, F. (1998) Soluble expression in E. coli of a functional interphotoreceptor retinoid-binding protein module fused to thioredoxin: Correlation of vitamin A binding regions with conserved domains of C-terminal processing proteases Exp Eye Res 66,249-262[Medline][Order article via Infotrieve]
-
Lu, Z, DiBlasioSmith, EA, Grant, KL, et al (1996) Histidine patch thioredoxins: mutant forms of thioredoxin with metal chelating affinity that provide for convenient purifications of thioredoxin fusion proteins J Biol Chem 271,5059-5065[Abstract/Free Full Text]
-
Kalef, E, Walfish, PG, Gitler, C. (1997) Arsenical-based affinity chromatography of vicinal dithiol-containing proteins: Purification of L1210 leukemia cytoplasmic proteins and the recombinant rat c-erb Aß T3 Receptor Anal Biochem 212,325-334
-
Zhou, GY, Jauhiainen, M, Stevenson, K, Dolphin, PJ (1991) Human plasma lecithin: cholesterol acyltransferase. Preparation and use of immobilized p-aminophenylarsenoxide as a catalytic site-directed covalent ligand in enzyme purification J Chromatogr 568,69-83[Medline][Order article via Infotrieve]
-
Laemmli, UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227,680-685[Medline][Order article via Infotrieve]
-
Burnside, B, Adler, R, OConnor, P. (1983) Retinomotor pigment migration in the teleost retinal pigment epithelium, I: roles for actin and microtubules in pigment granule transport and cone movement Invest Ophthalmol Vis Sci 24,1-15[Abstract/Free Full Text]
-
Levinson, G, Burnside, B. (1981) Circadian rhythms in teleost retinomotor movement: a comparison of the effects of circadian rhythm and light condition on cone length Invest Ophthalmol Vis Sci 20,294-303[Abstract]
-
McCormack, CA, McDonnell, MT (1994) Circadian regulation of teleost retinal cone movements in vitro J Gen Physiol 103,487-499[Abstract/Free Full Text]
-
Johnson, RL, Grant, KB, Zankel, TC, et al (1993) Cloning and expression of goldfish opsin sequences Biochemistry 32,208-214[Medline][Order article via Infotrieve]
-
Szel, A, Takacs, L, Monostori, E, Diamantstein, T, Vigh-Teichmann,, Röhlich, P (1986) Monoclonal antibody-recognizing cone visual pigment Exp Eye Res 43,871-883[Medline][Order article via Infotrieve]
-
Uehara, F, Matthes, MT, Yasumura, D, LaVail, MM (1990) Light-evoked changes in the interphotoreceptor matrix Science 248,1633-1636[Abstract/Free Full Text]
-
Day, DA, Tuite, MF (1998) Post-transcriptional gene regulatory mechanisms in eukaryotes: an overview J Endocrinol 157,361-371[Abstract]
-
Liou, GI, Matragoon, S, Chen, DM, et al (1998) Visual sensitivity and interphtoreceptor retinoid binding protein in the mouse: regulation by vitamin A FASEB J 12,129-138[Abstract/Free Full Text]
-
BuntMilam, AH, Saari, JC, Klock, IB, Garwin, GG (1985) Zonulae adherens pore size in the external limiting membrane of the rabbit retina Invest Ophthalmol Vis Sci 26,1377-1380[Abstract/Free Full Text]
-
Padgett, LC, Lui, GM, Werb, Z, LaVail, MM (1997) Matrix metalloproteinase-2 and tissue inhibitor of metalloproteinase-1 in the retinal pigment epithelium and interphotoreceptor matrix: vectorial secretion and regulation Exp Eye Res 64,927-938[Medline][Order article via Infotrieve]
-
Schneider, BG, Papermaster, DS, Liou, GI, Fong, SL, Bridge, CD (1986) Electron microscopic immunocytochemistry of interstitial retinol-binding protein in vertebrate retinas Invest Ophthalmol Vis Sci 27,679-688[Abstract/Free Full Text]
-
GonzalezFernandez, F, Cunningham, LL (1999) Role of RPE in IRBP endocytosis [ARVO abstract] Invest Ophthalmol Vis Sci 40(4),S591Abstract nr 3103.
-
McCormack, CA, Hayden, TJ, Kunz, YW (1989) Ontogenesis of diurnal rhythms of cAMP concentration, outer segment disc shedding and retinomotor movements in the eye of the brown trout, Salmo trutta Brain Behav Evol 34,64-72
-
Szamier, RB, Ripps, H. (1983) The visual cells of the skate retina: structure, histochemistry, and disc-shedding properties J Comp Neurol 215,51-62[Medline][Order article via Infotrieve]
-
Hollyfield, JG, Varner, HH, Rayborn, ME, Liou, GI, Bridges, CD (1985) Endocytosis and degradation of interstitial retinol-binding protein: differential capabilities of cells that border the interphotoreceptor matrix J Cell Biol 100,1676-1681[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
V. Krishnamoorthy, V. Jain, P. Cherukuri, S. Baloni, and N. K. Dhingra
Intravitreal Injection of Fluorochrome-Conjugated Peanut Agglutinin Results in Specific and Reversible Labeling of Mammalian Cones In Vivo
Invest. Ophthalmol. Vis. Sci.,
June 1, 2008;
49(6):
2643 - 2650.
[Abstract]
[Full Text]
[PDF]
|
 |
|