(Investigative Ophthalmology and Visual Science. 2000;41:4059-4063.)
© 2000
by The Association for Research in Vision and Ophthalmology, Inc.
The Human cGMP-PDE ß-Subunit Promoter Region Directs Expression of the Gene to Mouse Photoreceptors
Sandra B. Ogueta1,
Adriana Di Polo2,
John G. Flannery3,
Clyde K. Yamashita1 and
Debora B. Farber1,4
1 From the Department of Ophthalmology and Jules Stein Eye Institute, UCLA School of Medicine, Los Angeles, California;
2 Molecular Biology Institute, UCLA;
3 Centre for Research in Neuroscience, McGill University, Montreal, Canada; and
4 Departments of Vision Science and Neuroscience, University of California, Berkeley, California.
 |
Abstract
|
|---|
PURPOSE. We previously demonstrated that 350 bp of the human rod cGMP
phosphodiesterase ß-subunit (ß-PDE) gene promoter are sufficient to
direct high levels of gene expression in human Y-79 retinoblastoma
cells in vitro. In this study the cell specificity and expression
pattern conferred by the short ß-PDE 5' flanking sequence in vivo
were examined.
METHODS. A construct containing the bacterial LacZ gene driven by a fragment of
the ß-PDE 5' flanking region (-297 to +53) was used to generate
transgenic mice. Gene expression was analyzed by measuring
ß-galactosidase activity in tissue homogenates or visualizing
enzymatic activity or protein production at a cellular level by in situ
histochemistry or immunocytochemistry.
RESULTS. Three independently derived transgenic lines were generated carrying
the -297 to +53 ß-PDE 5' flanking region fragment. Within the
retina, the reporter gene was specifically expressed in photoreceptors,
consistent with the localization of endogenous ß-PDE. Significant
expression of LacZ was not observed in other ocular or peripheral
tissues.
CONCLUSIONS. Photoreceptor-specific reporter gene expression is driven in vivo by a
350-bp segment of the ß-PDE 5' flanking sequence. This study
demonstrates the utility of the human ß-PDE promoter for directing
the expression of foreign genes to photoreceptors and suggests that the
-297 to +53 ß-PDE 5' flanking region fragment may have important
implications for therapeutic gene delivery to the visual
cells.
|
Introduction
|
|---|
The human phosphodiesterase ß-subunit (ß-PDE) gene encodes
one of two catalytic subunits present in cGMP phosphodiesterase, a key
enzyme in the rod phototransduction cascade.1
Primary
lesions in this gene have been shown to cosegregate with retinal
degeneration affecting humans,2
3
4
5
6
7
mice,8
9
and dogs.10
11
In light of its participation in the
development of retinal abnormalities, it is relevant to understand the
events that direct expression of the ß-PDE gene in rod
photoreceptors.
In previous studies, we cloned the 5' flanking region of the human
ß-PDE gene and examined the elements controlling its rod-specific
expression in vitro.12
We were able to delineate sequences
involved in transcriptional activation by transiently expressing
various lengths of the 5' flanking region in human Y-79 retinoblastoma
cells.13
Here, we have extended these studies using
transgenic technology to elucidate the participation of regulatory
elements on ß-PDE gene expression in vivo. We have evaluated three
independent transgenic mouse lines carrying the -297/+53 ß-PDE 5'
flanking region fused to the LacZ reporter gene. Biochemical and
immunocytochemical analyses suggest that this sequence contains the
information necessary for the appropriate expression of ß-PDE in
photoreceptor cells.
|
Materials and Methods
|
|---|
ß-PDE–LacZ Fusion Gene Constructs
A fragment of the 5' flanking region of the human ß-PDE
gene extending from -297 to +53 was generated by PCR using
sequence-specific primers.13
The 5' primer, complementary
to residues -297 to -279 (5' AGCAGAAAGCGTCATGCTG 3') contained a
KpnI linker. The 3' primer complementary to
nucleotides +34 to +53 (5' GTGGCTGCCTGTCCCTGG 3') contained an
XbaI linker. The PCR product was digested with
KpnI and XbaI and directionally subcloned into
the pLacF vector14
upstream of the ß-galactosidase
reporter gene to generate plasmid -297LacZ. The insert was fully
sequenced in both directions by the dideoxy chain-termination
method15
to assure 100% identity with the
original template. Primers were synthesized by the
phosphoramidite method on an ABI DNA synthesizer (Foster City, CA)
according to the manufacturer’s specifications.
Generation of Transgenic Mice
Linear DNA of the heterologous construct -297LacZ (free of vector
sequences) was purified and microinjected into the pronuclei of
fertilized one-cell C57BL/6J mouse embryos using standard
procedures.16
Animals were screened for inheritance of the
transgene by Southern blot hybridization and PCR. For Southern blot
analysis, 10 µg of tail genomic DNA was digested to completion with
HindIII and electrophoresed in 1% agarose gels (Promega,
Madison, WI). Gels were then blotted onto Hybond-N+ membranes
(Amersham, Arlington Heights, IL) in 20x standard saline citrate
(SSC). The probe used to detect the chimeric construct was a 1-kb
EcoRI/SacI fragment corresponding to the 3' end
of the LacZ coding sequence. DNA was labeled as previously
described17
using the Klenow fragment of DNA polymerase
(USB, Cleveland, OH) and [
-32P]dCTP (NEN,
Boston, MA). Overnight hybridization was performed using 2 x
107 cpm of labeled probe in 7% SDS, 0.5 M
phosphate buffer, pH 7.0, 1 mM EDTA, and 1% BSA at 65°C. Blots were
washed at a final stringency of 0.2x SSC, 0.1% SDS at 60°C and then
visualized by autoradiography after overnight exposure at -80°C. For
PCR analysis, a 5' primer (5' GGGCTAGCGGGTTCCTAATCTCACTAA3')
complementary to the human ß-PDE promoter residues -47 to -28
and a 3' primer (5'ATGTGCTGCAAGGCGATTAA 3') complementary to LacZ
nucleotides +71 to +90 were used to span the chimeric constructs. PCR
products were electrophoresed on 4% agarose gels and
visualized after ethidium bromide staining.
Transgene Expression Assays
Eyes were enucleated immediately after euthanasia, and the
corneas, lenses, and vitreous were removed. Retinas were dissected and
processed for protein analysis, in situ histochemistry, and
immunocytochemistry.
ß-Galactosidase Activity Measurements
A colorimetric assay using
o-nitrophenyl-ß-D-galactopyranoside (ONPG;
Sigma, St. Louis, MO) was used to detect ß-galactosidase
expression.18
Tissues were homogenized using lysis
reporter buffer (Promega), cell fragments were pelleted, and the
supernatant was then mixed with a 0.1:22:130 mixture of 0.1 M
MgCl2 in 4.5 M ß-mercaptoethanol, ONPG (4 mg/ml
in 0.1 M sodium phosphate buffer, pH 7.5), and 0.1 M sodium phosphate
buffer, pH 7.5. The samples were incubated at 37°C for 30 minutes and
the reaction was stopped with 500 µl 1 M
Na2CO3. The specific
activity of ß-galactosidase in each sample (normalized for cell
protein) was measured from the optical density reading at 420 nm.
Protein concentration was determined as described by
Peterson.19
Background ß-galactosidase enzymatic
activity in wild-type mouse tissues was subtracted from the activity of
the corresponding transgenic tissue.
Histochemistry
Retinal flat mounts from nontransgenic (control) and transgenic
mice were placed on glass slides with the photoreceptors up. Retinas
were washed in PBS (0°C) for 15 minutes and stained in situ with 2 mM
fluorescein-di-ß-galactopyranoside (FDG; Molecular Probes) in an
8:1:1 mixture of water, ethanol, and DMSO for 2 minutes at 20°C.
Retinas were rinsed in PBS and examined by fluorescence
microscopy using the standard fluorescein-isothiocyanate filter set
(excitation, 490 nm; emission, 525 nm).
For histologic examination, eyes were placed into OCT compound (VWR
Scientific, Cerritos, CA), immediately frozen in liquid nitrogen, and
sectioned. Sections were labeled with FDG as described above.
Immunocytochemistry
Retinal samples were prepared for immunocytochemistry by the
technique of Hale and Matsumoto.20
Briefly, posterior
eyecups were fixed in 4% formaldehyde for 15 minutes and rinsed in
PBS, and the retinas dissected from the eyecup and embedded in 5%
agarose in PBS. Sections (100 µm) were prepared on a vibratome and
incubated with a rabbit anti–ß-galactosidase (1:50) antibody
(5'Prime-3'Prime, Boulder, CO) for 12 hours. Sections were then rinsed
in PBS (three times) and incubated with a secondary antibody conjugated
to the Cy3 fluorochrome (1:2000 dilution, Sigma) for 2 hours. Sections
were rinsed, mounted in anti-fading agent (Molecular Probes), and
viewed by confocal laser microscopy.
All animals were handled according to the ARVO Statement for the Use of
Animals in Ophthalmic and Vision Research.
|
Results
|
|---|
Screening of Transgenic Mice
Our group has previously characterized in vitro the potential
cis-acting elements located in the proximal 5' upstream
region of the rod ß-PDE gene that might confer photoreceptor
specificity (Fig. 1A
). Here, we have further investigated the functionality and specificity
of the -297 to +53 fragment using transgenic mice. Three founder mice
for the -297/+53 LacZ construct were identified by Southern blot
analyses of tail DNA (Fig. 1B)
. These mice were bred with C57Bl/6J mice
to generate three independent heterozygous lines. Copy number was
estimated by comparing hybridization signals of probe (pLacF vector) to
transgene and to serial dilutions of a known quantity of the LacF
plasmid (not shown). Lines TgN1, TgN2, and TgN3 carried 10, 2, and 3
copies of the -297/+53 LacZ transgene, respectively.
View larger version (35K):
[in this window]
[in a new window]
|
Figure 1. Diagram of the transgene construct and Southern blot analysis of
transgenic mice. (A) A PCR fragment of the ß-PDE promoter
region (-297 to +53) was cloned immediately upstream of the LacZ gene.
A polyadenylation signal from the mouse protamine gene (Mp1) was
inserted at the 3' end of the construct. The consensus
cis-acting elements that might be conferring
tissue-specificity are detailed. (B) Approximately 10 µg
of HindIII-digested tail DNA of the different founder
animals were loaded onto a 1% agarose gel. After electrophoresis, the
DNA was transferred to a Hybond-N + membrane and hybridized to a
radiolabeled LacZ probe.
|
|
ß-Galactosidase Activity
Measurements of ß-galactosidase activity in homogenates from
retina and other tissues from transgenic mice were used to estimate the
transcriptional efficiency of the ß-PDE 5' flanking region construct
(Table 1)
. The highest ß-galactosidase activity was observed in
retina, and it correlated well with the number of copies of the
-297/+53 LacZ transgene present in the tissue. Thus, retinas from TgN1
animals had more enzyme activity than those of TgN3, and these had in
turn higher activity than retinas from the TgN2 line. Reporter gene
activity was very low or undetectable in brain, heart, and muscle of
all transgenic lines expressing the -297/+53 promoter construct. All
other tissues, including the nonretinal ocular tissues, had very low
ß-galactosidase activity.
In situ Transgene Expression in the Retina
Retinal Whole Mounts.
We used an in situ staining procedure for whole mounts of mouse retinal
tissues to determine whether the ß-PDE 5' flanking region fragment
directed the LacZ gene to the photoreceptors (Fig. 2)
. LacZ-positive cells were identified by fluorescence microscopy using
the fluorogenic ß-galactosidase substrate, FDG. This method is
several-fold more sensitive than standard X-Gal methods. Nonfluorescent
FDG is hydrolyzed in the presence of ß-galactosidase enzyme to
produce UV–excitable fluorescein. Retinal whole mounts (visualized
with transmitted light in Fig. 2A
) exhibited a slight red background
fluorescence in the absence of the FDG substrate (Fig. 2B)
. After the
addition of FDG, slight green background fluorescence was observed in
control retinas from nontransgenic mice (Fig. 2C)
. A highly fluorescent
signal indicative of significant ß-galactosidase activity was
detected in whole mount retinas from -297/+53 LacZ transgenic mice
(Fig. 2D) .
View larger version (30K):
[in this window]
[in a new window]
|
Figure 2. In situ reporter gene expression in whole retina. (A)
Retinal whole mount visualized with transmitted light; (B)
background fluorescence (no FDG staining); (C) wild-type
retina stained with FDG; (D) -297LacZ-transgenic mouse
retina after FDG staining. Magnification, x200.
|
|
Retinal Sections.
Cell types expressing the LacZ reporter in the retina were examined in
FDG-labeled cryosections (Fig. 3)
. Mice carrying the -297/+53 LacZ construct exhibited photoreceptor
cell–specific LacZ expression with the same relative expression level
as found in whole-mount preparations. A conventionally processed
histologic cross section of a normal mouse retina is shown for
orientation in Figure 3A
. LacZ staining in -297TgN mice (Fig. 3B)
was
localized primarily in the outer segments (OS), inner segments (IS),
and synaptic terminals of photoreceptors in the outer plexiform layer
(OPL). A section of a nontransgenic (control) retina is shown for
comparison of nonspecific background fluorescence (Fig. 3C)
. As can be
seen, there is no green-yellowish or green fluorescence indicative of
the presence of the bacterial ß-galactosidase in this
tissue.
View larger version (80K):
[in this window]
[in a new window]
|
Figure 3. Localization of FDG staining in retina sections. Retinal cell types
expressing ß-galactosidase were identified in 8-µm cryosections
labeled with 2 mM FDG. (A) Plastic embedded section of
normal retina shown for reference; (B) -297LacZ-transgenic;
(C) wild-type mouse retina. Sections were exposed to 5
seconds of UV illumination (excitation, 490 nm; emission, 525 nm) in a
conventional fluorescence microscope. Final magnification, x200.
|
|
Immunocytochemistry.
Immunocytochemical studies using a polyclonal antibody against
ß-galactosidase that was conjugated to the Cy3 fluorochrome on
transgenic mice retinas carrying the ß-PDE 5' flanking region
-297/+53 (Fig. 4A
) revealed the same pattern of ß-galactosidase expression as that
seen in the FDG-labeled cryosections. Labeling in photoreceptors was
observed in the outer segments, inner segments, cell bodies (ONL), and
synaptic terminals (OPL). Control animals did not show immunostaining,
but the autofluorescence of their outer segments can be clearly
observed. Also notice the difference in fluorescence intensity scale
between the experimental and control panels (Fig. 4B)
.
View larger version (85K):
[in this window]
[in a new window]
|
Figure 4. Immunolocalization of ß-galactosidase in retinal sections. Confocal
microscopy of retinal sections (100 µm) immunostained with rabbit
anti–ß-galactosidase and then with a secondary antibody conjugated
to the Cy3 fluorochrome. LacZ expression is indicated by a signal with
intensity increasing from red to white
fluorescence. Reporter gene expression is significantly above
background throughout the photoreceptor layer in the
-297LacZ-transgenic mouse retina (A). Signal in
photoreceptor outer segments contains background autofluorescence, as
seen in the nontransgenic control retina (B).
|
|
|
Discussion
|
|---|
The appropriate expression and function of cGMP phosphodiesterase
in rod photoreceptors is a requirement for normal visual function. In
the present study, we used the protein product of the LacZ reporter
gene to examine the cell specificity and expression levels driven by
the ß-PDE promoter in vivo. A construct containing the -297 to +53
nt region of the ß-PDE gene (Fig. 1A)
integrated into the genome of
transgenic mice directed expression of the reporter gene to the retinal
photoreceptors. These results demonstrate a clear correlation with our
previous results obtained in vitro.13
Furthermore, they
indicate that the elements necessary for photoreceptor-specific
expression of the ß-PDE gene in vivo seem to be contained within a
350-nt fragment (-297 to +53 nt) of the proximal 5' flanking region of
the human ß-PDE gene.
Analysis of ß-galactosidase activity in several tissues of the
transgenic mice showed that ß-PDE-driven expression is highest in
the retina and minimal in other tissues (Table 1) . These low levels of
ß-galactosidase activity may be indicative of "leaky"
transcription, because it is possible that some expression of LacZ in
nonretinal tissues may have occurred in cells that do not normally
express ß-PDE. However, it is unlikely that the photoreceptor
cell–specific expression pattern observed was caused by the
integration site of the transgene because similar results were obtained
with all the transgenic lines generated with different founder mice. In
addition to measuring enzymatic activity in bulk pieces of mouse
tissues, we have studied by an in situ histochemical reaction the
localization of our reporter gene at the cellular level in the retina.
A simple staining on an entire or sectioned retina provided a
sensitive, rapid, and reliable method for analyzing cell-type-specific
expression (Figs. 2
3)
. This technique allowed us to obtain valuable
histologic data consistent with the results observed after a
conventional and laborious immunologic staining (Fig. 4)
. Our results
demonstrated that the -297 to +53 fragment of the ß-PDE gene
efficiently directs expression of the reporter gene to the
photoreceptors.
Several years ago, transgenic mouse studies aimed at introducing into
rd mouse rod photoreceptors normal copies of the ß-PDE
gene (the rd mouse has a mutation in the ß-PDE gene that
causes retinal degeneration) used fragments of the 5' flanking region
of the rod opsin gene to drive its expression.21
Although
opsin promoter fragments had proven to be very effective in generating
high rod-specific expression of transgenes, rescue of photoreceptors
was never permanent, neither for the rd mouse nor for other
animals affected with retinal degenerations resulting from different
gene abnormalities.22
A possible explanation for these
results was that the regulatory elements present in the promoters of
the specific genes to be replaced were not available on the rod-opsin
promoter, and therefore, this promoter supported only transiently the
expression of the therapeutic gene product. An alternative
interpretation was that because the opsin promoter is a strong
promoter, after some time it might have caused an accumulation of
overexpressed transgene and an enhancement of the already occurring
cell death. Viral-mediated gene transfer strategies have also used rod
opsin promoters to direct expression of the ß-PDE gene to the visual
cells with only temporary rescue of the
photoreceptors.23
24
Because the results that we have
presented in this article indicate that photoreceptor-specific gene
expression can be achieved in vivo using the -297/+53 fragment of the
human ß-PDE promoter, it is likely that future applications requiring
lower expression levels of transgenes in the visual cells may use
promoters such as the one in the ß-PDE gene. In fact, we have
recently reported the delivery of this same fragment of the ß-PDE 5'
flanking region fused to the ß-PDE cDNA by means of subretinal
injection of EAMs (encapsidated adenoviral minichromosomes) to
the retina of 5-day-old rd mice.25
In these
experiments, we found that we could obtain prolonged ß-PDE transgene
expression and rescue of rod photoreceptor cells in the mutant animals.
In summary, our results suggest that the -297/+53 fragment of the
ß-PDE gene can be used to direct expression of therapeutic genes to
the photoreceptors. Additional studies will help elucidate in more
detail the specific elements responsible for the functional regulation
of the ß-PDE gene expression in vivo.
|
Footnotes
|
|---|
Supported by National Institutes of Health Grants EY 02651 and EY 00331 (DBF) and EY 08980 (JGF), The Foundation Fighting Blindness (DBF), and a Research to Prevent Blindness Career Development award (JGF). DBF is
the recipient of a Research to Prevent Blindness Senior Scientific Investigator award.
Submitted for publication April 13, 2000; revised July 31, 2000; accepted September 6, 2000.
Commercial relationships policy: N.
Corresponding author: Debora B. Farber, Jules Stein Eye Institute, UCLA School of Medicine, 100 Stein Plaza, Los Angeles, CA 90095-7008. farber{at}jsei.ucla.edu
|
References
|
|---|
-
Stryer, L. (1991) Visual excitation and recovery J Biol Chem 266,10711-10714[Free Full Text]
-
McLaughlin, ME, Sandberg, MA, Berson, EL, Dryja, TP (1993) Recessive mutations in the gene encoding the beta-subunit of rod phosphodiesterase in patients with retinitis pigmentosa Nat Genet 4,130-134[Medline][Order article via Infotrieve]
-
Danciger, M, Blaney, J, Gao, YQ, et al (1995) Mutations in the PDE6B gene in autosomal recessive retinitis pigmentosa Genomics 30,1-7[Medline][Order article via Infotrieve]
-
McLaughlin, ME, Ehrhart, TL, Berson, EL, Dryja, TP (1995) Mutation spectrum of the gene encoding the beta subunit of rod phosphodiesterase among patients with autosomal recessive retinitis pigmentosa Proc Natl Acad Sci USA 92,3249-3253[Abstract/Free Full Text]
-
Bayes, M, Giordano, M, Balcells, S, et al (1995) Homozygous tandem duplication within the gene encoding the beta-subunit of rod phosphodiesterase as a cause for autosomal recessive retinitis pigmentosa Hum Mutat 5,228-234[Medline][Order article via Infotrieve]
-
Danciger, M, Heilbron, V, Gao, YQ, Zhao, DY, Jacobson, SG, Farber, DB (1996) A homozygous PDE6B mutation in a family with autosomal recessive retinitis pigmentosa Mol Vis 2,10[Medline][Order article via Infotrieve]
-
Gal, A, Orth, U, Baehr, W, Schwinger, E, Rosenberg, T. (1994) Heterozygous missense mutation in the rod cGMP phosphodiesterase beta-subunit gene in autosomal dominant stationary night blindness Nat Genet 7,64-68[Medline][Order article via Infotrieve]
-
Bowes, C, Li, T, Danciger, M, Baxter, LC, Applebury, ML, Farber, DB (1990) Retinal degeneration in the rd mouse is caused by a defect in the beta subunit of rod cGMP-phosphodiesterase Nature 347,677-680[Medline][Order article via Infotrieve]
-
Pittler, SJ, Baehr, W. (1991) Identification of a nonsense mutation in the rod photoreceptor cGMP phosphodiesterase beta-subunit gene of the rd mouse Proc Natl Acad Sci USA 88,8322-8326[Abstract/Free Full Text]
-
Farber, DB, Danciger, JS, Aguirre, G. (1992) The beta subunit of cyclic GMP phosphodiesterase mRNA is deficient in canine rod-cone dysplasia 1 Neuron 9,349-356[Medline][Order article via Infotrieve]
-
Suber, ML, Pittler, SJ, Qin, N, et al (1993) Irish setter dogs affected with rod/cone dysplasia contain a nonsense mutation in the rod cGMP phosphodiesterase beta-subunit gene Proc Natl Acad Sci USA 90,3968-3972[Abstract/Free Full Text]
-
Di Polo, A, Bowes, C, Farber, DB (1996) Isolation and initial characterization of the 5' flanking region of the human and murine cyclic guanosine monophosphate phosphodiesterase ß-subunit genes Invest Ophthalmol Vis Sci 37,551-560[Abstract/Free Full Text]
-
Di Polo, A, Lerner, LE, Farber, DB (1997) Transcriptional activation of the human rod cGMP-phosphodiesterase beta-subunit gene is mediated by an upstream AP-1 element Nucleic Acids Res 25,3863-3867[Abstract/Free Full Text]
-
Peschon, JJ, Behringer, RR, Brinster, RL, et al (1987) Spermatid-specific expression of protamine 1 in transgenic mice Proc Natl Acad Sci USA 84,5316-5319[Abstract/Free Full Text]
-
Sanger, F, Nicklen, S, Coulson, AR (1977) DNA sequencing with chain-terminating inhibitors Proc Natl Acad Sci USA 74,5463-5467[Abstract/Free Full Text]
-
Hogan, B, Costantini, F, Lacy, E. (1986) Manipulating the Mouse Embryo: A Laboratory Manual Cold Spring Harbor Laboratory Press Plainview, NY.
-
Feinberg, AP, Vogelstein, B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity Anal Biochem 132,6-13[Medline][Order article via Infotrieve]
-
Rosenthal, N. (1987) Identification of regulatory elements of cloned genes with functional assays Methods Enzymol 152,704-720[Medline][Order article via Infotrieve]
-
Peterson, GL (1977) A simplification of the protein assay method of Lowry et al. which is more generally applicable Anal Biochem. 83,346-356[Medline][Order article via Infotrieve]
-
Hale, IL, Matsumoto, B. (1993) Resolution of subcellular detail in thick tissue sections: immunohistochemical preparation and fluorescence confocal microscopy Methods Cell Biol 38,289-324[Medline][Order article via Infotrieve]
-
Lem, J, Flannery, JG, Li, T, Applebury, ML, Farber, DB, Simon, MI (1992) Retinal degeneration is rescued in transgenic rd mice by expression of the cGMP phosphodiesterase beta subunit Proc Natl Acad Sci USA 89,4422-4426[Abstract/Free Full Text]
-
Travis, GH, Groshan, KR, Lloyd, M, Bok, D. (1992) Complete rescue of photoreceptor dysplasia and degeneration in transgenic retinal degeneration slow (rds) mice Neuron 9,113-119[Medline][Order article via Infotrieve]
-
Jomary, C, Vincent, KA, Grist, J, Neal, MJ, Jones, SE (1997) Rescue of photoreceptor function by AAV-mediated gene transfer in a mouse model of inherited retinal degeneration Gene Ther 4,683-690[Medline][Order article via Infotrieve]
-
Bennett, J, Tanabe, T, Sun, D, Zeng, Y, Kjeldbye, H, Gouras, P, Maguire, AM (1996) Photoreceptor cell rescue in retinal degeneration (rd) mice by in vivo gene therapy Nat Med 2,649-654[Medline][Order article via Infotrieve]
-
Kumar-Singh, R, Farber, DB (1998) Encapsidated adenovirus mini-chromosome mediated delivery of genes to the retina: application to the rescue of photoreceptor degeneration Hum Mol Genet 7,1893-1900[Abstract/Free Full Text]
Top
Abstract
Introduction
