IOVS Read the Free BMJ
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Graham, M. A.
Right arrow Articles by Joyce, N. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Graham, M. A.
Right arrow Articles by Joyce, N. C.
(Investigative Ophthalmology and Visual Science. 2000;41:4124-4132.)
© 2000 by The Association for Research in Vision and Ophthalmology, Inc.

Protein Kinase C Regulation of Corneal Endothelial Cell Proliferation and Cell Cycle

Melanie A. Graham1,2, Ian Rawe1, Darlene A. Dartt1 and Nancy C. Joyce1

1 From the Schepens Eye Research Institute and Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; and the 2 Massachusetts Eye and Ear Infirmary, Boston, Massachusetts.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. The purpose of this study was to determine the role of protein kinase C (PKC) in corneal endothelial cell proliferation.

METHODS. Immunocytochemistry and Western blotting were used to define the PKC isoforms expressed in primary cultures of rat corneal endothelial cells. For proliferation studies, primary cultures of rat corneal endothelial cells were serum-starved for 48 hours and incubated for 2 hours with the PKC inhibitors staurosporine (10-9 to 10-7 M), chelerythrine (10-9 to 5 x 10-8 M), or calphostin C (10-9 to 10-7 M). Individual PKC isoforms were inhibited using PKC{alpha} antisense oligonucleotide transfection or exposure for 1 hour to myristoylated, pseudosubstrate-derived peptide inhibitors against PKC{alpha}, -{alpha}ß{gamma}, -{epsilon}, and -{delta} (10-8 to 10-6 M). Cells were then stimulated with 2.5% serum for 24 hours. Cell proliferation was measured with bromodeoxyuridine (BrDU) and Ki67 immunocytochemistry. Protein level of cyclin E was determined by Western blotting.

RESULTS. PKC{alpha}, -ßII, -{delta}, -{epsilon}, -{iota}, -{eta}, -{gamma}, and -{theta} were detected in corneal endothelial cells. Maximum inhibition of PKC with staurosporine, calphostin C, and chelerythrine reduced cell proliferation to 7%, 31%, and 48% of control, respectively. Myristoylated peptide inhibition of PKC{alpha} and -{epsilon} reduced cell proliferation to 57% and 59% of control, respectively. PKC{alpha} antisense oligonucleotide reduced cell proliferation to 35% of control. Cyclin E protein level was decreased to 70%, 38%, 57%, and 43% of control in cells treated with calphostin C, staurosporine, chelerythrine, and PKC{alpha} antisense, respectively.

CONCLUSIONS. PKC activity, in particular PKC{alpha} and -{epsilon} activity, is important in promoting corneal endothelial cell proliferation. Inhibition of PKC activity prohibits G1/S-phase progression and reduces cyclin E protein levels.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The corneal endothelium is a cell monolayer lining the posterior corneal surface that is critical in preventing corneal edema and maintaining corneal transparency.1 The corneal endothelium is considered to be a nonreplicating tissue, and consequently cell loss through disease or injury, such as from trauma or surgery,2 3 4 5 can result in a permanent decline in cell density and an inability to maintain corneal transparency.6 In addition to congenital hereditary endothelial dystrophy,7 8 9 10 Fuchs’ dystrophy,11 12 and inflammation,13 age alone can account for corneal endothelial cell density decline.6

Although the corneal endothelium is considered a nonreplicating tissue, these cells possess proliferative capacity. Previous studies have revealed that corneal endothelial cells in vivo resemble limbal basal cells in their cell cycle marker profile and are arrested in G1 phase of the cell cycle.14 15 Corneal endothelial cells can also overcome G1-phase arrest in vivo in the iridocorneal endothelial syndromes, characterized by uncontrolled proliferation of endothelial cells, supporting the proliferative capacity of endothelial cells.

Protein kinase C (PKC) is a well-known regulator of cell proliferation. In particular, PKC can mediate G1-phase progression in the cell cycle.16 17 18 19 PKC comprises a family of serine/threonine kinases important in intracellular signaling.20 21 22 In addition to cellular proliferation, PKC has been implicated in the regulation of differentiation, migration, and apoptosis and in tumor promotion.18 19 23 24 Eleven PKC isoforms have been identified in mammalian cells. These isoforms have distinct cellular location and function and are categorized as classical, novel, and atypical according to their activation sites.22 25 The effect of PKC on the cell cycle has been reported to be both stimulatory and inhibitory, influenced by the PKC isoform and cell type studied as well as by the timing and duration of PKC activation or inhibition.16 23 26 PKC has not to our knowledge been extensively studied in the corneal endothelial cell cycle.

Our studies investigate the effect of PKC on corneal endothelial cell proliferation. We identified the PKC isoforms present in the corneal endothelium. We used three nonisoform selective PKC inhibitors—staurosporine, chelerythrine, and calphostin C—to determine the role of PKC activation in serum-stimulated proliferation. These three agents target different sites of the PKC molecule, lending specificity to their inhibition. The roles of individual PKC isoforms were studied with myristoylated pseudosubstrate-derived inhibitory peptides against PKC{alpha}, -{epsilon}, and -{delta}.27 28 29 These peptides bind specifically to the catalytic domain of the targeted PKC isoform, inhibiting enzyme activation. As a second method to inhibit PKC isoforms specifically, cells were transfected with antisense oligonucleotides. Antisense oligonucleotides previously have been used to successfully modulate the activity of individual PKC isoforms.30 31 32 33 34 The effect of PKC on G1 phase of the corneal endothelial cell was studied by evaluating cyclin E protein levels in cells treated with inhibitors of PKC activity.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Corneal Tissue
Corneas were obtained from adult male Sprague–Dawley rats maintained in accordance with the ARVO Statement on the Use of Animals in Ophthalmic and Vision Research. Endothelial cell explant cultures were prepared according to Chen et al.35 Primary cultures were grown to confluency in Medium 199 (M199; GIBCO/BRL, Life Technologies, Grand Island, NY) supplemented with 50 µg/ml gentamicin (GIBCO/BRL, Life Technologies), 10% fetal bovine serum (HyClone, Logan, UT), and 25 ng/ml fibroblast growth factor (Biomedical Technologies, Stoughton, MA). Confluent cells were subcultured at low cell density onto sterile two- or eight-chamber slides (Laboratory Tek, Naperville, IL) and T75 flasks. For serum stimulation and PKC inhibition experiments, subcultured cells were serum-starved in M199 supplemented with 50 µg/ml gentamicin (M199-0) for 48 hours to synchronize cells in G0 phase of the cell cycle before treatment. All incubations were carried out in a 5% CO2-95% air, humidified atmosphere at 37°C.

Antibodies
Polyclonal rabbit antibodies to cyclin E and PKC isoforms -{alpha}, -ßI, -ßII, -{delta}, -{epsilon}, -{gamma}, -{iota}, -{eta}, -µ, -{zeta}, and -{theta} as well as fluorescein isothiocyanate (FITC)-conjugated and horseradish peroxidase (HRP)-conjugated anti-mouse IgG and anti-rabbit IgG antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Bromodeoxyuridine (BrDU) reagents, including mouse monoclonal anti-BrDU, were obtained from Amersham Pharmacia Biotech (Little Chalfont, Buckinghamshire, UK). BrDU-labeling reagents were used according to manufacturer’s protocol. Mouse monoclonal antibody to Ki67 was purchased from Novocastra (Newcastle, UK). FITC-conjugated streptavidin was obtained from Jackson ImmunoResearch Laboratories (West Grove, PA). Nonmuscle myosin antibody was obtained from Biomedical Technologies (Stoughton, MA).

Immunocytochemistry
Endothelial cells subcultured on two- or eight-chamber slides were rinsed with phosphate-buffered saline (PBS; GIBCO/BRL, Life Technologies) and fixed with 70% methanol for 30 minutes at -20°C. All further incubations were at room temperature. Slides were rinsed with PBS, and cells permeabilized for 10 minutes with 0.1% Triton X-100 in PBS. Nonspecific sites were blocked for 12 minutes using 4% bovine serum albumin (BSA) in PBS. Cells were incubated with primary antibody (BrDU: prepared per manufacturer’s protocol; dilutions in PBS: Ki67 1:100, streptavidin 1:200, PKC{alpha} 1:500, PKCßI 1:100, PKCßII 1:200, PKC{delta} 1:100, PKC{eta} 1:100, PKC{iota} 1:200, PKC{theta} 1:100, and PKC{zeta} 1:50) for 2 hours. Slides were rinsed with PBS and incubated with secondary antibody (1:100 dilution in PBS) for 2 hours. Coverslips were mounted in Vectashield containing propidium iodide (PI) or DAPI (4'6 diamidino-2-phenylindole), which stain cell nuclei (Vector Laboratories, Inc., Burlingame, CA). Negative controls for the PKC antibodies have been described earlier.36

Quantification of Proliferating Cells
For proliferation studies, cells were counted in a masked fashion, using the Nikon Eclipse E800 microscope (Garden City, NJ). At least five random 20x fields per specimen were examined. The total number of nuclei (PI or DAPI positive) was counted using the rhodamine or ultraviolet channel, respectively. BrDU- or Ki67-positive cells (FITC-positive) were counted using the FITC channel. Percentage of cells proliferating (% proliferation) was calculated by dividing the number of BrDU or Ki67 positive cells by the total number of cell nuclei. All experiments were conducted in duplicate and repeated at least three times for statistical evaluation unless otherwise noted. Statistical analysis was performed using Jandel Sigma Stat version 2.0 (Jandel Scientific Software, San Rafael, CA) to calculate significance using the paired t-test.

PKC Inhibition
Synchronized serum-starved cells were incubated for 2 hours in M199-0 with or without the PKC inhibitors staurosporine (10-9, 10-8, and 10-7 M), chelerythrine (10-9, 10-8, and 5 x 10-8 M), or calphostin C (10-9, 10-8, and 10-7 M; BIOMOL, Biomolecules for Research Success, Plymouth Meeting, PA). Then 2.5% serum was added for 22 hours to stimulate the cells to enter the cell cycle. BrDU immunocytochemistry was used to indicate S-phase entry and Western blotting techniques evaluated cyclin E protein level.

N-myristoylated, pseudosubstrate-derived inhibitory nonapeptides against PKC{alpha}, -{delta}, -{epsilon}, -{alpha}ß{gamma}, and -{zeta} were a generous gift of Driss Zoukhri (Schepens Eye Research Institute, Boston, MA) and Christian Sergheraert (Institut Pasteur de Lille, Lille, France). Synchronized serum-starved cells were exposed for 1 hour to myristoylated, pseudosubstrate-derived peptide inhibitors (10-8, 10-7, and 10-6 M) and then stimulated with 2.5% serum for 22 hours. Control samples were incubated with no peptide inhibitor. Cell proliferation was determined by Ki67 immunocytochemistry and counterstaining with DAPI.

Antisense and sense oligonucleotides for PKC{alpha} were obtained from Midland Certified Reagent Company (Midland, TX). (Antisense sequence: 5' (PS)GGTAAACGTCAGCCATGGTC3'; sense sequence: 5'(PS)GACCATGGCTGACGTTTACC3'.) Sense oligonucleotide was biotinylated. These sequences do not correspond to sequences of other PKC isoforms and correspond to oligonucleotides used successfully in previously published studies.33 Synchronized serum-starved cells were transfected with PKC{alpha} antisense oligonucleotide during an 18-hour period using the Qiagen Effectene nonliposomal lipid transfection reagents kit (Qiagen, Inc., Valencia, CA). A DNA:Effectene ratio of 1:26 was used. Cells were then stimulated with 2.5% serum for 24 hours. For controls, cells were transfected with PKC{alpha} sense oligonucleotide or with no oligonucleotide before serum stimulation. Viability was assessed using the Live/Dead assay kit (Molecular Probes, Eugene, OR). Transfection efficiency was determined by streptavidin staining of a biotinylated PKC{alpha} sense oligonucleotide. S-phase entry was detected by BrDU immunocytochemistry. Western blotting techniques were used to evaluate cyclin E, PKC{alpha}, and PKCßII protein levels.

Western Blotting
Proteins were isolated by incubating cells for 30 minutes at 4°C in buffer composed of 50 mM Tris, pH 7.4, 250 mM NaCl, 2.5 mM EDTA, 1% NP-40–Triton X-100, 50 mM sodium azide, 0.1 mM sodium orthovanadate, 1 mM phenylmethyl sulfonylfluoride, 10 µg/ml aprotinin, and 10 µg/ml leupeptin (Sigma), homogenizing with a pellet pestle for 1 minute, and incubating overnight at 4°C. Protein content was quantified by spectrophotometry. Samples (with equal protein content) were electrophoresed on 10% polyacrylamide gels and electrophoretically transferred to PVDF membranes (Millipore, Bedford, MA). Membranes were incubated overnight at 4°C with 5% milk in PBS to block nonspecific binding sites, rinsed in 0.1% Triton X-100 in PBS (PBST) and incubated for 2 hours with primary antibody diluted in 5% milk. Antibody dilutions in 5% milk were as follows: cyclin E 1:200, myosin 1:200, PKC{alpha} 1:400, PKCßII 1:200, PKCßI 1:400, PKC{gamma} 1:100, PKC{delta} 1:100, PKC{epsilon} 1:1000, PKC {zeta} 1:50, PKC{eta} 1:100, PKC{theta} 1:50, PKCµ 1:100, PKC{iota} 1:250 in 5% milk. Blots were then rinsed 10 minutes three times with PBST and incubated in secondary antibody (1:10,000 in 5% milk) for 1 hour. After washing the membranes again three times in PBST for 10 minutes, antibody binding was visualized using the enhanced chemiluminescence method (Pierce, Rockford, IL). For quantification, films were digitally scanned using BDS-Image (Biological Detection System, Pittsburgh, PA), scans were analyzed with NIH Image software version 1.58, and protein content was normalized according to myosin protein content. In experiments with cyclin E antibody, the blots were reanalyzed using the myosin antibody. The bands were quantified as described above and the amount of cyclin E was standardized to the amount of myosin present in the same sample.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
PKC Isoforms in the Corneal Endothelium
Eleven PKC isoforms have been identified in mammalian cells, but many tissues do not express all 11 isoforms. Also, individual isoforms may have tissue-specific and opposing activities.22 To improve our understanding of the role of PKC in corneal endothelial cell proliferation and to facilitate the study of individual PKC isoforms, we defined which PKC isoforms are expressed in rat corneal endothelial cells. Rat corneal endothelial cells grown in primary culture were subcultured at low cell density, protein was extracted and evaluated for the expression of PKC isoforms using Western blot analyses. Cells were found to express PKC{alpha}, -ßII, -{delta}, -{epsilon}, -{theta}, -{eta} and -{gamma} (Fig. 1) but not PKCßI, -µ, -{zeta} (data not shown). In addition, corneal endothelial cells were evaluated for expression of PKC isoforms using immunocytochemistry. PKC{alpha}, -ßII, -{delta}, -{theta}, -{eta}, and -{iota} were detectable. PKCßI, and -{zeta} were not detectable (Table 1) .



View larger version (17K):
[in this window]
[in a new window]
  		Figure 1. Identification of PKC isoforms in corneal endothelial cells. Rat corneal endothelial cells were subcultured at low density and evaluated for presence of PKC isoforms via Western blot analysis. Arrow, band of interest. The apparent molecular weights of the PKC isoforms are: PKC{alpha}, 77 kDa; -ßII, 77 kDa; -{delta}, 75 kDa; -{epsilon}, 90 kDa; -{gamma}, 78 kDa; -{eta}, 78 kDa; -{theta}, 80 kDa.

 

View this table:
[in this window]
[in a new window]
  		Table 1. PKC Isoform Expression in the Corneal Endothelium

 
Serum Dependence of Endothelial Cell Proliferation
PKC activity is isoform and cellular specific. When our studies began, it was not known whether PKC inhibition would have proliferative or antiproliferative effects on the corneal endothelial cell. To allow detection of either increased or decreased cell proliferation from PKC inhibition, we defined the amount of serum required to promote a moderate proliferative response. Primary cultures of rat corneal endothelial cells were subcultured at low cell density, serum-starved for 48 hours to synchronize the cells in G0 phase, and incubated for 24 hours with media containing 0% to 10% serum. Cell proliferation was quantified using BrDU staining (a marker of S-phase entry) and PI counterstaining. We found a concentration-dependent proliferative response that saturated at approximately 10% serum concentration (Fig. 2) . Cell proliferation (number of cells BrDU positive divided by the total number of cells indicated by PI staining) was measured at 3%, 15%, 41%, 54%, and 77% for cultures incubated with 0%, 1%, 2.5%, 5%, and 10% serum, respectively. On the basis of these results, 2.5% serum stimulation was used to study the effects of PKC inhibitors as a suboptimal concentration of serum to allow the detection of either proliferative or antiproliferative effects of PKC inhibition.



View larger version (11K):
[in this window]
[in a new window]
  		Figure 2. Serum of 2.5% stimulates a moderate proliferative response in corneal endothelial cells. Serum-starved rat corneal endothelial cells synchronized in G0 phase were stimulated to enter the cell cycle by incubation for 24 hours with media containing 0% to 10% serum. Cell proliferation was quantified using BrDU incorporation and PI counterstaining. Results are mean ± SE of three independent experiments.

 
Effect of PKC Inhibition on Cell Proliferation
Staurosporine can mediate G1-phase arrest and is a well-known inhibitor of PKC but it also inhibits other protein kinases.17 To investigate a specific role of PKC, we studied three pharmacologic inhibitors of PKC (staurosporine, calphostin C, and chelerythrine) that act at different sites on the PKC molecule. Primary explants of rat corneal endothelial cells were subcultured at low cell density and serum-starved for 48 hours before a 2-hour incubation with a PKC inhibitor followed by 24 hours of serum stimulation. Cell proliferation was quantified using BrDU immunocytochemistry and PI counterstaining. Increasing concentrations of PKC inhibitor decreased the number of BrDU-labeled cells compared with control, whereas the total number of cells indicated by PI remained constant. A representative example of the immunocytochemical results is shown in Figure 3 . Using all three pharmacologic inhibitors, we found a concentration-dependent inhibition of cell proliferation. The percentage of proliferating cells was 43%, 24%, and 7% of control value (100%) for staurosporine (10-9, 10-8, and 10-7 M; Fig. 4A ), 70%, 44%, and 31% for calphostin C (10-9, 10-8, and 10-7 M; Fig. 4B ), and 89%, 80%, and 48% for chelerythrine (10-9, 10-8, and 5 x 10-8 M; Fig. 4C ), respectively. From this data we concluded that PKC inhibition reduces corneal endothelial cell proliferation.



View larger version (34K):
[in this window]
[in a new window]
  		Figure 3. Staurosporine inhibition of PKC reduces cell proliferation. Serum-starved rat corneal endothelial cells treated with staurosporine demonstrated a concentration-dependent reduction in S-phase entry indicated by BrDU-positive staining. Left: BrDU-positive staining in cells treated with staurosporine at concentrations 0, 10-9, 10-8, and 10-7 M; right: total number of cells from the same microscopic field, determined by PI staining of nuclei. Magnification, x20.

 


View larger version (14K):
[in this window]
[in a new window]
  		Figure 4. Staurosporine, calphostin C, and chelerythrine concentration-dependent inhibition of cell proliferation. Percent proliferation (determined by dividing the number of BrDU-positive cells by the total number of PI positive cells x 100) was measured in serum-starved endothelial cells treated for 2 hours with staurosporine (A), calphostin C (B), and chelerythrine (C) before serum stimulation for 24 hours. Results are mean ± SE of three independent experiments prepared in duplicate for (A) and (B) and two independent experiments prepared in duplicate for (C). *P < 0.05.

 
Effect of Inhibition of PKC{alpha} and -{epsilon} with Myristoylated, Pseudosubstrate-derived Peptides on Cell Proliferation
Of the PKC isoforms that are expressed in corneal endothelial cells, PKC{alpha}, -ßII, -{delta}, and -{epsilon} have been linked most extensively to cell cycle regulation.16 18 19 To determine which PKC isoforms are important in corneal endothelial cell proliferation, we inhibited these PKC isoforms using N-myristoylated, pseudosubstrate-derived peptides. Primary explants of rat corneal endothelial cells were subcultured at low cell density and serum-starved for 48 hours before a 1-hour incubation with myristoylated, pseudosubstrate-derived peptides against PKC{alpha}, -{alpha}ß{gamma}, -{delta}, and -{epsilon}. (The peptide against PKC{alpha}ß{gamma} indiscriminately inhibits PKC{alpha}, -ßI, -ßII, and -{gamma}. A peptide inhibitor against PKCßII alone has not yet been synthesized.) Cells were then serum-stimulated for 24 hours followed by quantification of cell proliferation using Ki67 immunocytochemistry (a marker of actively cycling cells) and DAPI counterstaining. The percentage of proliferating cells was 57% and 59% of control value (100%) with PKC{alpha} and -{epsilon} inhibition (10-8 M peptide), respectively (Fig. 5) . Treatment with 10-6 M peptide led to cell death/apoptosis, as observed by decreased cell number and nuclear pyknosis on cell microscopy. Inhibition with 10-7 M peptide was less marked (data not shown), which was attributed to the behavior of the myristoyl moiety not dissolving homogeneously in serial dilutions, a phenomenon observed in previous reports.29 Cells treated with PKC{delta} and PKC{alpha}ß{gamma} peptide showed no detectable change in proliferation status. As a negative control to demonstrate the specificity of the peptide inhibitors, no inhibition was noted in cells treated with PKC{zeta} peptide, because PKC{zeta} was not expressed in endothelial cells by our immunocytochemistry and Western blot studies.



View larger version (17K):
[in this window]
[in a new window]
  		Figure 5. Myristoylated, pseudosubstrate-derived peptide inhibition of PKC{alpha} and -{epsilon} result in reduced cell proliferation. Synchronized serum-starved rat corneal endothelial cells were incubated for 1 hour with myristoylated, pseudosubstrate-derived peptides (10-8 M) against PKC{alpha}, -{epsilon}, -{delta}, -{alpha}ß{gamma}, and -{zeta} before serum stimulation for 24 hours and quantification of cell proliferation using Ki67 immunocytochemistry and DAPI counterstaining. Control cells were exposed to no peptide or to PKC{zeta} (not present in corneal endothelial cells). Results are mean of two independent experiments prepared in duplicate.

 
From these findings we concluded that PKC{alpha} and -{epsilon} activity are important in promoting cell proliferation. Also, the antiproliferative effect of PKC{alpha} inhibition is masked with PKC{alpha}ß{gamma} inhibition, suggesting that PKCßII or -{gamma} activity opposes PKC{alpha} activity and may inhibit proliferation.

Effect of Inhibition of PKC{alpha} with PKC{alpha} Antisense Oligonucleotide Transfection on Cell Proliferation
To confirm the antiproliferative effect of PKC{alpha} inhibition, we used an alternative method of inhibiting PKC{alpha} using antisense oligonucleotide transfection. Synchronized serum-starved subcultures of rat corneal endothelial cells were transfected with PKC{alpha} sense or antisense oligonucleotide and serum-stimulated for 24 hours followed by quantification of transfection efficiency, viability, PKC{alpha} protein level, and cell proliferation. After optimizing transfection efficiency using guidelines in the Qiagen Effectene manufacturer’s protocol, we were able to demonstrate a transfection efficiency of more than 90%. Figure 6 illustrates streptavidin staining of biotinylated PKC{alpha} sense oligonucleotide, present in nearly every cell. A viability assay demonstrated that the majority of transfected cells remained viable, as indicated by positive esterase activity with the enzymatic conversion of calcein AM to fluorescent calcein in live cells and ethidium bromide staining of dead cells (data not shown). Western blot analysis of protein, extracted from cells treated as described above, demonstrated that transfection with PKC{alpha} antisense oligonucleotide reduced the amount of PKC{alpha} protein to 5% of nontransfected control (100%; Fig. 7 ), and 12% of sense oligonucleotide transfection control (100%; data not shown). PKC{alpha} antisense oligonucleotide transfection did not reduce PKC ßII protein level (data not shown), indicating the isoform specificity of the antisense oligonucleotide inhibition. Transfection with PKC{alpha} antisense oligonucleotide significantly inhibited proliferation, but PKC{alpha} sense oligonucleotide transfection did not. The percentage of proliferating cells was measured as 35% and 69% of serum (100%), with antisense and sense oligonucleotide transfection, respectively (Fig. 8) .



View larger version (32K):
[in this window]
[in a new window]
  		Figure 6. PKC{alpha} oligonucleotide transfection is more than 90% efficient. Synchronized, serum-starved corneal endothelial cells were transfected with biotinylated PKC{alpha} oligonucleotide before serum stimulation for 24 hours. Streptavidin-staining revealed the presence of biotinylated sense oligonucleotide in nearly all cells (A). The total number of cells is shown with PI nuclear staining (B). Magnification, x20.

 


View larger version (21K):
[in this window]
[in a new window]
  		Figure 7. PKC{alpha} antisense oligonucleotide transfection reduces PKC{alpha} protein level. Synchronized, serum-starved corneal endothelial cells were transfected with PKC{alpha} antisense and sense oligonucleotides and serum-starved for 24 hours followed by protein extraction and analysis by Western blotting techniques. Control cells were not transfected.

 


View larger version (21K):
[in this window]
[in a new window]
  		Figure 8. Inhibition of PKC{alpha} using antisense oligonucleotide transfection reduces cell proliferation. Synchronized serum-starved corneal endothelial cells were transfected with PKC{alpha} antisense oligonucleotide and serum-stimulated for 24 hours followed by quantification of cell proliferation with BrDU immunocytochemistry and PI counterstaining. Control cells were not transfected or were transfected with sense oligonucleotide. Results are mean ± SE of three independent experiments prepared in duplicate. *P < 0.05.

 
These results demonstrate that PKC{alpha} antisense oligonucleotide transfection is efficient, does not produce marked cell death, and specifically reduces PKC{alpha} protein level in corneal endothelial cells. Also, PKC{alpha} inhibition with transfection of PKC{alpha} antisense oligonucleotide results in reduced cell proliferation, supporting the role of PKC{alpha} in promoting cell proliferation.

Effect of PKC Inhibition on Cyclin E Protein Level
Although human corneal endothelial cells do not replicate normally in vivo, they are arrested in G1 phase and maintain proliferative capacity.14 15 We determined that PKC inhibition reduces cell proliferation and questioned whether PKC activity is important in G1-phase arrest. To study the effects of PKC inhibition on the corneal endothelial cell cycle, in particular on G1 phase, we evaluated protein levels of cyclin E, a cell cycle protein synthesized late in G1 phase that is necessary for progression to S phase and proliferation. Synchronized serum-starved subcultures of rat corneal endothelial cells were treated with PKC inhibitors (staurosporine, chelerythrine, calphostin C, PKC{alpha} antisense oligonucleotide transfection) as described above and serum-stimulated for 24 hours before protein extraction and analysis of cyclin E level by Western blotting techniques (Fig. 9A ). These blots were also analyzed using a nonmuscle myosin antibody, and the amount of cyclin E was standardized to the amount of myosin present in each sample. Figure 9B plots the results of three separate experiments, demonstrating a reduction in cyclin E to 71%, 58%, 38%, 47%, and 43% of control (100%) in cells treated with calphostin C (10-8 M), staurosporine (10-8 and 10-7 M), chelerythrine (10-8 M), and PKC{alpha} antisense oligonucleotide transfection, respectively. From this data we concluded that PKC inhibition reduces corneal endothelial cell proliferation by promoting G1-phase arrest and a concomitant reduction in cyclin E protein level. PKC inhibitors were not as effective in reducing cyclin E protein level compared with proliferation, suggesting that another cell cycle component important in G1-phase progression is also a target of PKC.



View larger version (28K):
[in this window]
[in a new window]
  		Figure 9. Cyclin E protein level is decreased with PKC inhibition. Synchronized serum-starved subcultures of corneal endothelial cells were treated for 2 hours with calphostin C (10-8 M), staurosporine (10-8 and 10-7 M), or chelerythrine (10-8 M) or transfected with PKC{alpha} antisense oligonucleotide, before serum stimulation for 24 hours and protein extraction for analysis of cyclin E protein level by Western blotting techniques (A). (B) Graph is the mean of cyclin E protein level standardized to the amount of nonmuscle myosin present in the same samples ± SE of three independent experiments. *P < 0.05.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We determined for the first time that at least eight PKC isoforms are expressed in the corneal endothelium. Our studies demonstrated an inhibition of cell proliferation using three pharmacologic inhibitors of PKC as well as myristoylated, pseudosubstrate-derived peptides against PKC{alpha} and -{epsilon}, and antisense oligonucleotides to inhibit PKC{alpha}. All three methods of PKC inhibition (pharmacologic, pseudosubstrate-derived peptide inhibitors, and antisense oligonucleotide transfection) demonstrated a stimulatory role of PKC in endothelial cell proliferation. We also found that inhibition of PKC, particularly by staurosporine, affects protein levels of cyclin E, suggesting that PKC activity is important in G1-phase progression and that inhibition of PKC arrests cells in G1 phase before stimulation of cyclin E synthesis.

Pharmacologic inhibition was chosen as a means to modulate PKC activity because of the lack of consistent findings noted in preliminary studies in which phorbol esters were used to stimulate PKC activity. This inconsistency may be due to the broad nature of phorbol ester stimulation, activating all but the atypical PKC isoforms, and the critical timing necessary for influencing cell cycle dynamics. Prolonged activation of PKC with phorbol esters leads to downregulation of PKC activity. Hence, phorbol ester treatment may lead to early activation and late inhibition of numerous PKC isoforms, some with possibly opposing activities. Our findings are supported by a study that demonstrated both stimulatory and inhibitory effects of phorbol esters on cell proliferation influenced by the phase of the cell cycle during the time of phorbol ester treatment.16 Our findings are also supported by our data indicating that inhibition with a pseudosubstrate-derived peptide inhibitor against PKC{alpha}ß{gamma} overcame the antiproliferative effect of inhibition of PKC{alpha} alone.

PKC{alpha}, -ßII, -{epsilon}, and -{delta} were chosen for evaluation because they have been shown to be important in cell cycle events in other cell systems.18 19 PKC{alpha} increased cell proliferation in smooth muscle cells and decreased proliferation in breast cancer cells.16 PKC{alpha} and -{epsilon} increased cell proliferation in NIH3T3 cells, whereas PKC{delta} inhibited proliferation in these cells.37 PKCßII has been demonstrated to play a role in G2/M-phase transition.16 In the present studies, both PKC{alpha} and -{epsilon} appear to be important for stimulation of corneal endothelial cell proliferation.

We evaluated the effect of PKC inhibition on cyclin E protein expression to determine whether PKC is important in G1-phase arrest of corneal endothelial cells. Cyclin E positively regulates the activity of cyclin-dependent kinase 2 (cdk2). Activity of cyclinE/cdk2 complex is required for S-phase entry.38 Future studies, evaluating cyclin E activity and its interaction with cdk2, as well as cyclin D, p27, and pRb, will further characterize the cell cycle profile of cells treated with PKC modulators. This will help to better define where in the cycle (between G0 and S phase) cells are affected by PKC activity. As human corneal endothelial cells are arrested in G1 phase, understanding the mechanisms of G1-phase arrest in corneal endothelial cells may facilitate identification of factors that may allow endothelial cells to transiently overcome G1-phase arrest and proliferate in a controlled fashion. Factors, such as specific activators of PKC{alpha} and -{epsilon} may provide treatment for diseases characterized by reduced corneal endothelial cell density and corneal edema.

In conclusion, PKC appears to participate in a signal transduction cascade leading to stimulation of corneal endothelial cell proliferation. The PKC isoforms -{alpha} and -{epsilon}, in particular, demonstrate important activity in cell cycle progression in these cells. Specific PKC isoform activity can be effectively modulated with myristoylated, pseudosubstrate-derived inhibitory peptides and antisense oligonucleotides, and this intervention may be useful in the treatment of disorders with abnormalities of endothelial cell density.


   Acknowledgements
 
The authors thank David Mello, Deshea Harris, and Robin Hodges for their outstanding technical assistance in various phases of this project.


   Footnotes
 
Supported by National Institutes of Health Grants R01 EY05767 (NCJ) and R01 EY09057 (DAD) and the Schepens Eye Research Institute.

Submitted for publication March 6, 2000; revised July 24, 2000; accepted August 17, 2000.

Commercial relationships policy: N.

Corresponding author: Nancy C. Joyce, Schepens Eye Research Institute, 20 Staniford Street, Boston, MA 02114. njoyce{at}vision.eri.harvard.edu


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Svedbergh, B, Bill, A. (1972) Scanning electron microscopic studies of the corneal endothelium in man and monkeys Acta Ophthalmol 50,321-326
  2. Bergman, L, Hartmann, C, Renard, G. (1991) Damage to the corneal endothelium caused by radial keratotomy Fortschr Ophthalmol 88,368-373[Medline][Order article via Infotrieve]
  3. Brooks, AMV, Gillies, WE (1991) Effect of angle closure glaucoma and surgical intervention on the corneal endothelium Cornea 10,489-497[Medline][Order article via Infotrieve]
  4. Rao, GN, Shaw, EL, Arthur, E, Aquavella, JV (1978) Morphologic appearance of the healing corneal endothelium Arch Ophthalmol 96,2027-2030[Abstract/Free Full Text]
  5. Kletzy, DL, Parver, LM, Mathers, WD (1992) Correlation of full-thickness corneal wound length with endothelial cell loss Ophthal Surg 23,342-346
  6. Waring, GOI, Bourne, WM, Edelhauser, HF, Kenyon, KR (1982) The corneal endothelium: normal and pathologic structure and function Ophthalmology 89,531-589[Medline][Order article via Infotrieve]
  7. Rodrigues, MM, Waring, GO, Laibson, PR, Weinreb, S. (1975) Endothelial alterations in congenital corneal dystrophies Am J Ophthalmol 80,678-689[Medline][Order article via Infotrieve]
  8. Kenyon, KR, Maumenee, E. (1973) Further studies of congenital hereditary endothelial dystrophy of the cornea Am J Ophthalmol 76,419-439[Medline][Order article via Infotrieve]
  9. Kenyon, KR, Antine, B. (1971) The pathogenesis of congenital hereditary endothelial dystrophy of the cornea Am J Ophthalmol 72,787-795[Medline][Order article via Infotrieve]
  10. Waring, GO, Rodrigues, MM, Laibson, PR (1978) Corneal dystrophies. II. Endothelial dystrophies Surv Ophthalmol 23,147-168[Medline][Order article via Infotrieve]
  11. Adamis, AP, Filatov, V, Tripathi, BJ, Tripathi, RC (1993) Fuchs’ endothelial dystrophy of the cornea Surv Ophthalmol 38,149-168[Medline][Order article via Infotrieve]
  12. Wilson, SE, Bourne, WM (1988) Fuchs’ dystrophy Cornea 7,2-17[Medline][Order article via Infotrieve]
  13. Hirose, N, Shimomura, Y, Matsuda, M. (1988) Corneal endothelial changes associated with herpetic stromal keratitis Jpn J Ophthalmol 32,14-20[Medline][Order article via Infotrieve]
  14. Joyce, NC, Navon, SE, Roy, S, Zieske, JD (1996) Expression of cell cycle-associated proteins in human and rabbit corneal endothelium in situ Invest Ophthalmol Vis Sci 37,1566-1575[Abstract/Free Full Text]
  15. Joyce, NC, Meklir, B, Joyce, SJ, Zieske, JD (1996) Cell cycle protein expression and proliferative status in human corneal cells Invest Ophthalmol Vis Sci 37,645-655[Abstract/Free Full Text]
  16. Livneh, E, Fishman, DD (1997) Linking protein kinase C to cell-cycle control Review. Eur J Biochem. 248,1-9
  17. Nishi, K, Schnier, JB, Bradbury, EM (1998) The accumulation of cyclin-dependent kinase inhibitor p27kip1 is a primary response to staurosporine and independent of G1 cell cycle arrest Exp Eye Res 243,222-231
  18. Fukumoto, S, Nishizawa, Y, Hosoi, M, Koyama, H, Yamakawa, K, Ohno, S, Mori, H. (1997) Protein kinase {delta} inhibits the proliferation of vascular smooth muscle cells by suppressing G1 cyclin expression J Biol Chem 21,13816-13822
  19. Harrington, EO, Loffler, J, Nelson, PR, Kent, KC, Simons, M, Ware, A. (1997) Enhancement of migration by protein kinase C{alpha} and inhibition of proliferation and cell cycle progression by protein kinase C{delta} in capillary endothelial cells J Biol Chem 272,7390-7397[Abstract/Free Full Text]
  20. Nishizuka, Y. (1984) Turnover of inositol phospholipids and signal transduction Science 255,1365-1370
  21. Hug, H, Sarre, TF (1993) Protein kinase C isoenzymes: divergence in signal transduction? Biochem J 291,329-343
  22. Ron, D, Kazanietz, MG (1999) New insights into the regulation of protein kinase C and novel phorbol ester receptors FASEB J 13,1658-1676[Abstract/Free Full Text]
  23. Tang, S, Morgan, KG, Parker, C, Ware, JA (1997) Requirements for protein kinase C {theta} for cell cycle progression and formation of actin stress fibers and filopodia in vascular endothelial cells J Biol Chem 272,28704-28711[Abstract/Free Full Text]
  24. Joyce, NC, Meklir, B. (1992) Protein kinase C activation during corneal endothelial wound repair Invest Ophthalmol Vis Sci 33,1958-1973[Abstract/Free Full Text]
  25. Newton, AC (1995) Protein kinase C: structure, function, and regulation J Biol Chem 270,28495-28498[Free Full Text]
  26. Ashton, AW, Watanabe, G, Albanese, C, Harrington, EO, Ware, JA, Pestell, RG (1999) Protein kinase C {delta} inhibition of S-phase transition in capillary endothelial cells involves the cyclin-dependent kinase inhibitor p27kip1 J Biol Chem 274,20805-20811[Abstract/Free Full Text]
  27. Hodges, RR, Zoukhri, D, Sergheraert, C, Zieske, JD, Dartt, DA (1997) Identification of vasoactive intestinal peptide receptor subtypes in the lacrimal gland and their signal-transducing components Invest Ophthalmol Vis Sci 38,610-619[Abstract/Free Full Text]
  28. Sohn, UD, Zoukhri, D, Dartt, D, et al (1997) Different protein kinase C isozymes mediate lower esophageal sphincter tone and phasic contraction of esophageal circular smooth muscle Mol Pharmacol 51,462-470[Abstract/Free Full Text]
  29. Zoukhri, D, Hodges, RR, Sergheraert, C, Toker, A, Dartt, DA (1997) Lacrimal gland PKC isoforms are differentially involved in agonist-induced protein secretion Am J Physiol 272,263-269
  30. Dean, NM, Mckay, R, Condon, TP, Bennett, CF (1994) Inhibition of protein kinase C-alpha expression in human A549 cells by antisense oligonucleotides inhibits induction of intercellular adhesion molecule 1 (ICAM-1) mRNA by phorbol esters J Biol Chem 269,16416-16424[Abstract/Free Full Text]
  31. Dean, NM, McKay, R. (1994) Inhibition of protein kinase C-{alpha} expression in mice after systemic administration of phosphorothioate antisense oligonucleotides Proc Natl Acad Sci USA 91,11762-11766[Abstract/Free Full Text]
  32. Liedtke, CM, Cole, T. (1997) Antisense oligonucleotide to PKC-{delta} blocks {alpha}1-adrenergic activation of Na-K-2Cl cotransport Am J Physiol 42,c1632-c1640
  33. Lu, D, Yang, H, Lenox, RH, Raizada, MK (1998) Regulation of angiotensin II-induced neuromodulation by MARCKS in brain neurons J Cell Biol 142,217-227[Abstract/Free Full Text]
  34. Simpson, RU, O’Connell, TD, Pan, Q, Newhouse, J, Somerman, MJ (1998) Antisense oligonucleotides targeted against protein kinase Cß and CßII block 1,25-(OH)2D3-induced differentiation J Biol Chem 273,19587-19591[Abstract/Free Full Text]
  35. Chen, K-H, Harris, DL, Joyce, NC (1999) TGF-ß2 in aqueous humor suppresses S-phase entry in cultured corneal endothelial cells Invest Ophthalmol Vis Sci 40,2513-2519[Abstract/Free Full Text]
  36. Zoukhri, D, Hodges, RR, Willert, S, Dartt, DA (1997) Immunolocalization of lacrimal gland PKC isoforms. Effect of phorbol esters and cholinergic agonists on their cellular distribution J Membr Biol 157,169-175[Medline][Order article via Infotrieve]
  37. Mischak, H, Goodnight, J, Kolch, W, et al (1993) Overexpression of PKC{delta} and {epsilon} in NIH3T3 cells induces opposite effects on growth, morphology, anchorage dependence and tumorigenicity J Biol Chem 268,6090-6096[Abstract/Free Full Text]
  38. Pardee, AB (1989) G1 events and regulation of cell proliferation Science 246,603-608[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. Gross, I. Karagiannides, T. Thomou, H. W. Koon, C. Bowe, H. Kim, N. Giorgadze, T. Tchkonia, T. Pirtskhalava, J. L. Kirkland, et al.
Substance P promotes expansion of human mesenteric preadipocytes through proliferative and antiapoptotic pathways
Am J Physiol Gastrointest Liver Physiol, May 1, 2009; 296(5): G1012 - G1019.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
M. A. Shatos, R. R. Hodges, Y. Oshi, J. A. Bair, D. Zoukhri, C. Kublin, K. Lashkari, and D. A. Dartt
Role of cPKC{alpha} and nPKC{epsilon} in EGF-Stimulated Goblet Cell Proliferation
Invest. Ophthalmol. Vis. Sci., February 1, 2009; 50(2): 614 - 620.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Z. Faghiri and N. G. Bazan
Selective Relocalization and Proteasomal Downregulation of PKC{alpha} Induced by Platelet-Activating Factor in Retinal Pigment Epithelium
Invest. Ophthalmol. Vis. Sci., January 1, 2006; 47(1): 397 - 404.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
M. Kikuchi, D. L. Harris, Y. Obara, T. Senoo, and N. C. Joyce
p27kip1 Antisense-Induced Proliferative Activity of Rat Corneal Endothelial Cells
Invest. Ophthalmol. Vis. Sci., June 1, 2004; 45(6): 1763 - 1770.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
K.-P. Xu, D. Zoukhri, J. D. Zieske, D. A. Dartt, C. Sergheraert, E. Loing, and F.-S. X. Yu
A role for MAP kinase in regulating ectodomain shedding of APLP2 in corneal epithelial cells
Am J Physiol Cell Physiol, August 1, 2001; 281(2): C603 - C614.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Graham, M. A.
Right arrow Articles by Joyce, N. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Graham, M. A.
Right arrow Articles by Joyce, N. C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS