(Investigative Ophthalmology and Visual Science. 2000;41:4133-4141.)
© 2000
by The Association for Research in Vision and Ophthalmology, Inc.
Regulation of Human Corneal Epithelial Cell Proliferation and Apoptosis by Dexamethasone
Tristan Bourcier1,
Patricia Forgez2,
Vincent Borderie1,
Sarah Scheer1,
William Rostène2 and
Laurent Laroche1
1 From the Cornea Bank, AP-HP, Paris VI University, the
2 Institut National de la Santé et de la Recherche Médicale (U33g), Saint-Antoine Hospital, Paris, France.
 |
Abstract
|
|---|
PURPOSE. To investigate whether human corneal epithelial cells express the
glucocorticoid receptor (GR) and to assess the influence of
dexamethasone (DEX) on these cells.
METHODS. Human corneal epithelial cells were cultured in medium supplemented
with various concentrations of DEX (ranging from
10-10 to 10-4 M).
Cell proliferation was analyzed by
3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxy-methoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium
inner salt (MTS) assay at 2, 4, and 6 days of culture. Apoptosis
was studied by nucleus labeling using a fluorescent dye and
immunostaining by APO 2.7 at 6 days of culture. GR mRNA was detected in
corneal epithelium and cultured corneal epithelial cells by means of
reverse transcriptionpolymerase chain reaction (RT-PCR).
Immunocytochemical staining of the epithelial cells was performed with
a monoclonal anti-human GR.
RESULTS. RT-PCR and immunocytochemistry showed the expression of GR (mRNA and
protein) in corneal epithelial cells. DEX significantly increased
corneal epithelial cell proliferation with concentrations ranging from
10-10 to 10-6 M, with
a maximum effect at 10-7 M
(P < 0.005). However, DEX also induced apoptosis
of cultured corneal epithelial cells at any concentration used.
CONCLUSIONS. These results indicate that human corneal epithelial cells express the
GR and proliferate in response to DEX stimulation which also induces
corneal epithelial cell apoptosis.
 |
Introduction
|
|---|
Understanding the factors that control corneal wound healing,
corneal cell proliferation, apoptosis, differentiation, and the
modulation of these effects by specific drugs is critical for
clinically relevant problems and successful therapeutic interventions.
Dexamethasone (DEX) is an anti-inflammatory glucocorticoid commonly
used after cataract and penetrating keratoplasty surgeries. It is also
used after refractive surgery (photorefractive keratectomy or laser in
situ keratomileusis) in an attempt to reduce ocular surface
inflammation and to delay corneal wound healing.1
Despite the widespread use and demonstrated clinical effectiveness of
steroids, little is known regarding the specific effects of
glucocorticoids on the function of corneal cells. DEX has been shown to
inhibit inflammation, through inhibition of phospholipase A2 activity
and inhibition of transcription of metalloprotease genes. By preventing
cellular division, glucocorticoids have been shown to decrease
extracellular matrix and scar tissue formation.2
Conflicting data were reported on corneal wound healing, but
investigations have shown that steroid eyedrops impair stromal and
epithelial wound healing.3
4
5
6
7
8
High DEX concentrations have
been shown in vitro to inhibit keratocyte
proliferation.9
10
11
12
We recently demonstrated that cultured human keratocytes proliferate in
response to low concentrations of DEX
(10-9 to
10-5 M).13
DEX also induces keratocyte apoptosis13
which is probably
an initiating factor in the wound-healing response after refractive
surgical procedures.14
15
Although the glucocorticoid receptor (GR) mRNA sequence has been
detected in corneal epithelium by polymerase chain reaction and hot
blot analyses,16
little is known about the effect of
glucocorticoids on corneal epithelial cells and the role of GR in the
regulation of corneal wound healing. This study was initiated to
determine whether human corneal epithelial cells express GR mRNA and
the corresponding protein. DEXs effects on corneal epithelial cell
proliferation and apoptosis were also investigated.
 |
Materials and Methods
|
|---|
Human Corneal Epithelial Cell Culture
This study was performed according to the tenets of the
Declaration of Helsinki. Human corneal epithelial cell primary cultures
were obtained using human donor corneas that were discarded before
transplantation because of low endothelial cell counts. Primary
cultures of human corneal epithelium were started using explants, as
previously described.17
18
Under a tissue culture hood,
Descemets membrane, endothelium, and posterior stroma were removed
with forceps using a dissecting microscope. The anterior cornea with
intact epithelium was covered with 1.2 U/ml Dispase II (Boehringer
Mannheim, Mannheim, Germany) in calcium and magnesium-free
phosphate-buffered saline (PBS) and incubated at 37°C in a humidified
5% CO2 incubator. One hour later, corneas were
placed in culture medium and 1 to 2 mm2
full-thickness epithelial explants were gently peeled off with forceps
from the peripheral areas (12 mm inside the limbus). Four to six
explants were removed from the peripheral cornea. Explants were
placed epithelial side up on 12-well tissue culture plates
(Costar, Cambridge, MA). A 12-mm diameter sterile glass coverslip
was placed on the explant in the well before the addition of culture
medium. One milliliter of medium was then added to the wells. The
culture medium was supplemented hormonal epithelial medium
(SHEM)19
and consisted of a 1:1 mixture of Dulbeccos
modified Eagles medium (DMEM) and Hams F12 (GibcoLife Technology,
Cergy-Pontoise, France) with 10% fetal calf serum (FCS; Gibco), 5
µg/ml insulin (SigmaAldrich, Saint Quentin Fallavier, France), 0.5
mg/ml cholera toxin (Sigma), 10 ng/ml human recombinant epidermal
growth factor (Sigma), 0.5% dimethylsulfoxide, 2 mM
L-glutamine, 100 IU/ml penicillin, 100 µg/ml
streptomycin, and 0.25 µg/ml amphotericin. Steroids were removed from
the FCS by means of a dextran charcoal treatment to eliminate serum
steroids.20
The cultures were incubated at 37°C in 5%
CO2, and the medium changed twice a week. Corneal
epithelial cells were allowed to migrate from the explants onto the
surface of the wells. The cells reached confluence within 21 to 28
days. They were then enzymatically detached using 0.05% trypsin
(Gibco) at 37°C for 2 minutes, after which TC199 medium with 20% FCS
was added to stop the trypsinization. The suspended epithelial cells
were then centrifuged at 400g for 10 minutes. The
supernatant was removed, and fresh medium was added again. The
single-cell suspension was counted in a hemocytometer and 2 x
105 cells/well were plated using 24-well tissue
culture plates (Costar). Second-passage human corneal epithelial cells
were used in all the experiments. They were incubated in 1 ml of SHEM
at 37°C (5% CO2) and were allowed to attach to
the bottom of the well for 24 hours before DEX was added. Epithelial
cells were then cultured in SHEM supplemented with various
concentrations of DEX (10-10, 10-9, 10-8,
10-7, 10-6, 10-5, or
10-4 M) for 6 days.
Drug Preparation and Addition
DEX was purchased from SigmaAldrich. It was dissolved and
serially diluted in absolute ethanol before addition to the culture
medium. On the second day, SHEM was replaced by 1 ml SHEM containing
various concentrations of DEX (10-4,
10-5, 10-6,
10-7, 10-8,
10-9, or 10-10 M). DEX was added to
the culture medium every day at the same concentration. In all
experiments, the ethanol concentration in the culture media was
maintained at 0.1%. All the solutions were filter sterilized and
stored at 4°C in light-protected containers.
The control group consisted of epithelial cells cultured in SHEM with
0.1% absolute ethanol and no DEX. The culture media were renewed every
day. All the experiments were repeated six times. For each
experiment3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxy-methoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium
inner salt (MTS) assays, apoptosis assays, and immunocytochemistryall
cultures were obtained from the same donor cornea. Cultured epithelial
cells were studied daily by means of phase-contrast microscopy.
RNA Preparation
Total RNA extraction was performed on primary and secondary
passages of human corneal epithelial cultures. RNA samples were also
prepared from ex vivo corneal epithelium that was mechanically removed
from donor corneas stored in preservative medium (Inosol;
ChauvinOpsia, Toulouse, France) for less than 1 month.
RNA extraction was performed by the acidic phenol-chloroform guanidine
thiocyanate method described by Chirgwin.21
Total RNAs
were suspended in sterile deionized diethylpyrocarbonate
(DEPC)-treated water, and aliquots were prepared and stored at
-80°C. Total RNA recovery was measured by spectrophotometric
absorbance at 260 nm.
RT-PCR for GR
For reverse transcriptionpolymerase chain reaction
(RT-PCR), total RNA (0.25 µg) was reverse transcribed in a 30-µl
reaction mixture containing 20 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM
MgCl2, 10 mM dithiothreitol, a 1 mM concentration
of each deoxyribonucleoside triphosphate (dNTP), 1 µg oligo (dN), 1
µg oligo (dT), 24 U RNAsin (Promega, Madison, WI), and 200 U Moloney
murine leukemia virus reverse transcriptase (Gibco) at 37°C for 1
hour. The reaction was terminated by heating at 90°C for 5 minutes,
and samples were quick chilled on ice.
One fifth of the RT reaction was used for the PCR amplification of the
human GR. The reaction mixture consisted of 16 mM Tris-HCl (pH 8.3), 40
mM KCl, 1 mM MgCl2, a 0.2 mM concentration of
each dNTP, 50 picomoles of sense primer (ATGAGACCAGATGTAAGCTC), 50
picomoles of antisense primer (AATGCCATAAGAAACATCCA), and 1 U
Taq polymerase (Perkin ElmerCetus, Norwalk, CT). The
primers were synthesized by GibcoLife Technology from previously
published sequences.22
As previously described, a 30-cycle
amplification was completed followed by a final extension step at
72°C for 10 minutes.13
The amplification was performed
in a DNA thermal cycler (model 480; Perkin Elmer-Cetus). The PCR
product (588 bp) was sequenced and exhibited 100% homology with the
sequence from 1262 to 1949 of the
and ß glucocorticoid receptor,
named HSGCRAR and HSGCRBR respectively in GenBank.
PCR Product Analysis
Five microliters of PCR samples were electrophoresed on 1%
agarose gels in 90 mM buffer containing Tris borate and 2 mM EDTA. A
100-bp DNA ladder was routinely introduced (GibcoLife Technology) as
a size marker. Gels were stained with ethidium bromide and photographed
under UV illumination (665 film; Polaroid, Cambridge,
MA).23
RT-PCR Control Samples
A negative control was routinely introduced in all assays to
confirm the absence of contamination. For these controls, RNA was
omitted from the RT reaction mixture and the RT was performed as
described. PCR amplification was performed in the same conditions as
used for the samples. Human corneal keratocytes known to express the GR
were used as a positive control.13
Immunocytochemistry
Primary cultures and second-passage corneal epithelial cells were
studied by indirect immunoperoxidase staining. A monoclonal mouse
anti-human GR (dilution 1:100; MCA 1390; Serotec, Oxford, UK) was used.
A monoclonal anti-human cytokeratin (dilution 1:400, M821; Dako,
Glostrup, Denmark) was used to confirm that cultured cells were
epithelial cells (positive staining for cytokeratin) and not
keratocytes (negative staining for cytokeratin). Monoclonal mouse
anti-human APO 2.7 (dilution 1:50; 2087; Immunotech, Marseille,
France), a mitochondrial protein reliably expressed by cells involved
in the apoptotic pathway, was used.24
Epithelial cells
were grown onto glass slides, washed two times in PBS, and fixed with
methanol. Incubation with the primary anti-GR (or anti-APO
2.7) monoclonal antibody dilution was followed with the
peroxidase-labeled anti-mouse antibody (dilution 1:100; PO447;
Dako). After three washings, the color reaction was developed
(VIP; Vector, Burlingame, CA). Seven-micrometer cryostat sections of
donor corneas were also processed with anti-GR monoclonal antibody.
Negative controls consisted of cryostat section incubated with no
primary antibody and section incubated with anti-vimentin monoclonal
antibody (dilution 1:20; M725; Dako).
MTS Assay
MTS and phenazine methosulfate (PMS) were obtained from Promega
and Sigma, respectively. MTS is a tetrazolium salt that undergoes a
color change caused by its bioreduction of MTS into a water-soluble
formazan. The conversion of MTS into the aqueous-soluble formazan is
accomplished by dehydrogenase enzymes found in active mitochondria and
is such that the reaction occurs only in living cells.25
The quantity of formazan product measured by the amount of 490-nm light
absorbance is directly proportional to the number of living cells in
culture. MTS (2 mg/ml; pH 6.5) was dissolved in PBS and filter
sterilized. A 3-mM PMS solution was also prepared (in PBS) and filter
sterilized. These solutions were stored at -20°C in light-protected
containers. To enhance the cellular reduction of MTS, PMS was added to
MTS immediately before use (MTS-to-PMS ratio, 1:20). The mixture (150
µl) was added to each well. After incubation at 37°C in a
humidified atmosphere with 5% CO2 for 2 hours,
100 µl supernatant was diluted in 1 ml deionized water. The optical
density was measured at 490 nm by means of spectrophotometry.
Epithelial cell growth was analyzed by means of MTS assay after 2, 4,
and 6 days of culture. Epithelial cell proliferation was analyzed with
a hemocytometer and a cell counter (Coulter, Hialeah, FL).
Apoptosis Assay
We also looked for DEX-induced cell apoptosis by nucleus labeling
using a fluorescent dye for nuclei after 6 days of culture. Corneal
epithelial cells were fixed in 4% paraformaldehyde in PBS for 1 hour
at room temperature. After a wash in PBS, the cells were incubated in a
solution of 10 µg/ml Hoechst 33258 (Sigma) in PBS for 15 minutes.
After another wash in PBS, the specimens were mounted in glycerol and
were examined using an epifluorescence microscope (Diaphot TDM; Nikon,
Tokyo, Japan) with UV filters. Six to 12 photographs of each
specimen were taken using the same instrument. Photographs were
analyzed by two observers in a blind fashion. The number of apoptotic
cells and the total number of cells were counted. Condensed and/or
fragmented nuclei appeared highly fluorescent in apoptotic cells.
Cells with ruptured cytoplasmic membranes were considered to be
necrotic cells.26
Primary cultures and second-passage epithelial cells were treated each
day for 6 days with three concentrations of DEX
(10-10,
10-7, and
10-4 M) before the
apoptosis assay. Control samples consisted of corneal epithelial cells
cultured in SHEM medium with no ethanol and corneal epithelial cells
cultured in SHEM with 0.1% absolute ethanol. All experiments were
reproduced three times.
Statistical Analysis
Data were analyzed by analysis of variance and Wilcoxon rank sum
test. Commercial software (SPSS ver. 6.1.3; SPSS, Chicago, IL) was used
for statistical analysis.
 |
Results
|
|---|
Expression of GR mRNA was detected in human corneal epithelium and
cultured epithelial cells. A unique PCR product of 640 nucleotides was
detected with ethidium bromide after gel electrophoresis (Fig. 1)
. The size of this band was consistent with the expected fragment size,
determined from the human GR cDNA.27
Analysis of this
qualitative profile showed that GR mRNA was present in corneal
epithelium and cultured epithelial cells.

View larger version (49K):
[in this window]
[in a new window]
|
Figure 1. Electrophoretic profile of the human GR product obtained from RT-PCR.
Total RNA (0.25 µg) from cultured human epithelial cells and 30 µg
total RNA from cultured human keratocytes were reverse transcribed
using oligo(dN) and oligo(dT) primers. The obtained cDNA were
electrophoresed on a 1% agarose gel, and the bands were visualized by
ethidium bromide staining. Lane 1: Human corneal
epithelial cells; lane 2: human keratocytes, known to
express GR (positive control); lane M: 100-bp DNA
ladder.
|
|
Specific nuclear intracellular staining of GR was observed in cultured
epithelial cells (Fig. 2A
2B
) and, ex vivo, in the whole cornea (Fig. 3)
. Both basal epithelial cells and keratocytes showed positive staining
for GR. Negative controls showed no staining (data not shown).

View larger version (134K):
[in this window]
[in a new window]
|
Figure 2. Immunostaining of cultured human corneal epithelial cells with
monoclonal anti-human GR antibody. Cultured epithelial cells showed
positive staining for GR (A) compared with control
(B). Inverted microscopy. Magnification, x200.
|
|

View larger version (124K):
[in this window]
[in a new window]
|
Figure 3. Immunostaining of cryostat section of human cornea with monoclonal
anti-human GR antibody. The immunoreactivity in the cornea was confined
to basal epithelial cells and keratocytes. No significant
immunoreactivity was observed in the superficial cells of the
epithelium. Inverted microscopy. Magnification, x200.
|
|
After 6 days of culture, DEX induced a biphasic dose-dependent effect
on epithelial cell proliferation. It increased cell proliferation at
concentrations ranging from
10-10 to
10-6 M (Fig. 4)
. The maximum proliferative effect was observed at
10-7 M (P < 0.005). In contrast,
10-4 M DEX induced an
inhibitory effect on cell growth (P < 0.005). There
were no significant effects at days 2 and 4. All the results of the MTS
assay were confirmed by the cell counter and hemocytometer
proliferation assays (data not shown).

View larger version (10K):
[in this window]
[in a new window]
|
Figure 4. Corneal epithelial cell proliferation studied by MTS assay. Human
corneal epithelial cells were cultured with various concentrations of
DEX diluted in 0.1% final absolute ethanol
(10-4, 10-5,
10-6, 10-7,
10-8, 10-9, and
10-10 M) for 6 days. Results are expressed in
optical density, which was measured at 490 nm by means of
spectrophotometry. Bars, SD (n = 6 for each group). The
control group consisted of epithelial cells cultured in
charcoal-treated SHEM with 0.1% absolute ethanol. After 6 days of
culture, DEX induced a dose-dependent increase in epithelial cell
proliferation at concentrations ranging from
10-10 to 10-6 M. The
maximum proliferative effect was observed at
10-7 M (P < 0.005).
However, 10-4 M DEX had an inhibitory effect
on cell growth (P < 0.05). Significantly different
from the control group by the Wilcoxon rank sum test:
*P < 0.05; **P < 0.005.
|
|
In the nucleus labeling assay, the percentage of viable cells decreased
when DEX was added to the culture medium (Figs. 5
6A 6B
). There was no statistical difference in epithelial cell viability
between the SHEM group and the ethanol group (control group).
Epithelial cell apoptosis and necrosis were significantly enhanced by
addition of DEX, whatever the concentration used
(10-10 M,
10-7 M, and
10-4 M; P < 0.05). APO 2.7 immunostaining confirmed the morphologic nucleus
labeling assay data. There was an increased expression of the apoptotic
marker APO 2.7 in the DEX groups compared with that in the control
group (Fig. 6C 6D)
.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 5. Apoptosis assay. Results are expressed for viable (A),
apoptotic (B), and necrotic cells (C) in
percentage of cells (mean ± SD). Apoptosis was significantly
enhanced by addition of
10-4 M,
10-7 M, and
10-10 M DEX to the culture
medium. Epithelial cell necrosis was also significantly enhanced by
addition of DEX to the culture medium. There was no statistical
difference in epithelial cell viability between the SHEM group and the
ethanol group (0.1%). Significantly different from the control group
by the Wilcoxon rank sum test: *P < 0.05.
|
|

View larger version (105K):
[in this window]
[in a new window]
|
Figure 6. Apoptosis assay. The late phase of apoptosis was studied by nucleus
labeling using a fluorescent dye for the nuclei after 6 days of
culture. Condensed and/or fragmented nuclear appeared highly
fluorescent in apoptotic cells (arrows). The percentages
of apoptotic and necrotic epithelial cells were significantly higher in
the 10-7 M DEX group (A) than in
the control group (B; P < 0.05). The early
phase of apoptosis was studied by immunolabeling with APO 2.7 mAb.
There was a much stronger expression of the apoptotic marker APO 2.7 in
the 10-7 M DEX group
(C) than in the control group (D). Magnification:
(A, B) x100; (C, D)
x200.
|
|
There were differences of cell morphology among the different
groups. Cell density was higher in the
10-7 M DEX group (Fig. 7A
) compared with density in the control group (Fig. 7B)
. Most of the
epithelial cells cultured in the presence of
10-7 M DEX were small
polygonal cells in the central area of outgrowth, and elongated cells
with filopodia in the peripheral area. On the contrary, most of the
epithelial cells cultured in
10-4 M DEX had a elongated
morphologic appearance with interconnected filopodial processes (Fig. 7C)
.

View larger version (102K):
[in this window]
[in a new window]
|
Figure 7. Inverted phase-contrast micrographs of human epithelial cells after 6
days of culture and DEX treatment. There were differences in cell
morphology among the groups. Cell density was higher in the SHEM +
10-7 M DEX group (A) compared with
density in the control group (SHEM + 0.1% ethanol; B). The
epithelial cells cultured in the presence of SHEM culture medium +
10-7M DEX diluted in 0.1%
final absolute ethanol were small polygonal cells in the central area
of outgrowth, and elongated cells with filopodia in the peripheral
area. On the contrary, most of the epithelial cells cultured in SHEM +
10-4 M DEX diluted in
0.1% final absolute ethanol had an elongated morphologic appearance
with interconnected filopodial processes (C). Magnification,
x200.
|
|
 |
Discussion
|
|---|
Human corneal epithelium is a stratified squamous epithelium
that forms a barrier between the external environment, tears, and the
intraocular environment. In addition, it contributes to the maintenance
of normal stroma transparency by transporting fluid out of the stroma.
It is known to have a rapid self-renewing capacity. The epithelium is
frequently injured through physical or chemical insult. Wound closure
after corneal abrasions involves a complex series of cellular changes
in both the epithelium and the stroma. Pharmacologic control of
epithelium proliferation appears to offer the potential to regulate
corneal wound healing. It has been hypothesized that stimulation of
epithelial cell proliferation and inhibition of cell differentiation
could promote epithelial hyperplasia associated with regression after
photorefractive keratectomy (PRK).15
However, there is
little specific information regarding the effects of corticosteroids on
corneal epithelial cells.
We observed a dose-dependent effect of DEX on epithelial cell
proliferation with growth stimulation at low concentrations
(10-10 M to
10-6 M) and inhibition at
high concentrations (10-4
M). The similar doseresponse curves for the hemocytometer cell count
and the MTS assay provided evidence that they measured the same
proliferative effect under our experimental conditions. The
proliferative effect of DEX was observed in the presence of FCS from
which steroids had been removed, indicating that it depended only on
exogenous steroids.
The apparent paradoxical biphasic effect of DEX on human corneal
epithelial cell (i.e., proliferation after exposure to low doses of DEX
and inhibition of growth after exposure to high doses) has been already
observed in rabbit conjunctival cells, dermal
fibroblasts,10
retinal pigment epithelial
cells,28
and human corneal keratocytes.13
The
originality of the present work is in the possible effect of low
concentrations of DEX on cultured human corneal epithelial cells. Thus,
low doses of DEX could also have a mitogenic effect on cultured human
epithelial cells.
It has been shown recently that AP1 components (c-Fos,
c-Jun, and Fra-2) are expressed in normal ocular
surface epithelia and dysplastic epithelium.29
These
proto-oncogenes may play an important role in modulating epithelial
cell functions (e.g., proliferation, migration, and differentiation)
during epithelial wound healing. It has been suggested that immediate
expression of nucleoprotein encoding proto-oncogenes could represent
the molecular response that initiates the healing
process.30
Moreover, proto-oncogenes of the Fos/Jun family
have been shown to be massively upregulated in many basal cell layers
of the corneal epithelium after UV exposure.31
DEX and
other steroids could interact through the AP1 proto-oncogenes. GR and
AP1 interactions have recently been described in the glucocorticoid
response elements (GREs), where these two transcriptional factors are
adjacent.32
Products of these proto-oncogenes may bind to
DNA and act to regulate the expression of other genes that encode
structural proteins and enzymes.
Apoptosis in the corneal epithelium has been detected after mechanical
injuries (e.g., corneal trauma, PRK), infection, and UV
exposure.33
34
This event could be considered an
initiating factor in the wound-healing response.35
Epithelial cell apoptosis has also been shown to reflect physiologic
epithelial turnover. A strict equilibrium can be observed, because
epithelial cells that die are thought to be replaced by proliferation
of activated epithelial cells.
Glucocorticoid-induced cell death or apoptosis has been described in
many cell systems including lymphocytes.36
However,
glucocorticoids have been shown to protect other cell types, such as
epithelial cells of the mammary gland,37
hepatocytes,38
and thymocytes.39
Our results
showed that epithelial cell apoptosis and necrosis were significantly
enhanced by addition of DEX. Compared with the results of MTS
proliferation assays, there were no dose-dependent effects of DEX. By
increasing epithelial cell apoptosis, DEX could paradoxically increase
cell activation and the wound-healing response. Moreover, apoptosis
which is considered as a controlled form of cell death, induces little
or no inflammation compared with necrosis. The surrounding tissue could
thus be protected from the release of degradative cytokines, and
apoptosis could constitute a mechanism for epithelial cells to regulate
cell proliferation and loss. The mechanism of apoptosis induced by
glucocorticoids can fall roughly in two categories: induction of
"death genes" by the activated GR or repression of survival
factors. In any case, glucocorticoid-induced apoptosis provides further
evidence for the existence of GR in corneal epithelial cells.
Glucocorticoids mediate their effects after binding to a specific
intracellular receptor belonging to the steroid receptor superfamily:
the GR. Once activated, the GR can mediate its effects through direct
binding on the DNA or through proteinprotein interactions with
transcription factors.40
Wilson identified GR mRNA
sequences in each of the three major cell types of the cornea (i.e.,
corneal epithelial cells, keratocytes, and endothelial
cells),16
as well as in human lacrimal
gland.41
Previous studies have identified GR binding sites
in rabbit corneal epithelium42
43
and cytosol prepared
from whole bovine cornea.44
In the rabbit, it was
demonstrated that cytoplasmic GR translocates to the cell nucleus after
topical administration of DEX.43
We have used the RT-PCR
technique to show that in vitro and ex vivo human corneal epithelial
cells produced mRNA coding for the GR. Immunocytochemistry results
showed the presence of receptor protein and confirmed that GR mRNA is
physiologically relevant in human corneal epithelium. Moreover,
identification of GR in each of the three major cell types of the
cornea suggests that steroids may have autocrine and/or paracrine roles
in the cornea and that endogenous steroids can be found in the cornea.
Midelfart et al.45
recently used nuclear magnetic
resonance (NMR) spectroscopy to study the penetration and metabolism of
DEX phosphate in the rabbit cornea after topical administration. Many
endogenous metabolites were detected among DEX in the extracts of
rabbit cornea. These endogenous metabolites could be synthesized from
cholesterol, which is present in the cornea.46
Further
investigations are needed to determine whether these steroids are
produced by corneal epithelial cells, keratocytes, endothelial cells,
or all three cell types.
In conclusion, we have shown the expression of GR in human corneal
epithelial cells. Such a receptor is functional because DEX
significantly increases epithelial cell proliferation, apoptosis, and
necrosis.
 |
Footnotes
|
|---|
Supported by a grant from the Association Claude Bernard and Institut National de la Santé et de la Recherche Médicale, Equipe de Recherche Clinique Associée.
Submitted for publication March 15, 2000; revised July 5, 2000; accepted July 19, 2000.
Commercial relationships policy: N.
Corresponding author: Tristan Bourcier, Service du Professeur Laroche, CHNO Quinze-Vingts, 28 rue de Charenton, 75012 Paris, France. bourcier{at}quinze-vingts.fr
 |
References
|
|---|
-
Marques, EF, Leite, EB, CunhaVaz, JG (1995) Corticosteroids for reversal of myopic regression after photorefractive keratectomy J Refract Surg 11,S302-S308[Medline][Order article via Infotrieve]
-
Polack, FM, Rosen, PN (1967) Topical steroids and tritiated thymidine uptake Arch Ophthalmol 77,400-404[Medline][Order article via Infotrieve]
-
Waterbury, L, Kunysz, EA, Beuerman, R. (1987) Effects of steroidal and non-steroidal anti-inflammatory agents on corneal wound healing J Ocul Pharmacol 3,43-54[Medline][Order article via Infotrieve]
-
Srinivasan, BD, Kulkarni, PS (1981) The effect of steroidal and nonsteroidal anti-inflammatory agents on corneal re-epithelialization Invest Ophthalmol Vis Sci 20,688-691[Abstract/Free Full Text]
-
Sugar, A, Borosky, JE, Meyer, RF (1984) A randomised trial of topical corticosteroids in epithelial healing after keratoplasty Cornea 3,268-271[Medline][Order article via Infotrieve]
-
Petroutsos, G, Guimaraes, R, Giraud, JP, Pouliquen, Y. (1982) Corticosteroids and corneal epithelial wound healing Br J Ophthalmol 66,705-708[Free Full Text]
-
TomasBarberan, S, Fagerholm, P. (1999) Influence of topical treatment on epithelial wound healing and pain in the early postoperative period following photorefractive keratectomy Acta Ophthalmol Scand 77,135-138[Medline][Order article via Infotrieve]
-
Chung, JH, Kang, YG, Kim, HJ (1998) Effect of 0.1% dexamethasone on epithelial healing in experimental corneal alkali wounds: morphological changes during the repair process Graefes Arch Clin Exp Ophthalmol 236,537-545[Medline][Order article via Infotrieve]
-
Lu, KL, Wee, WR, Sakamoto, T, McDonnell, PJ (1996) Comparison of in vitro antiproliferative effects of steroids and nonsteroidal antiinflammatory drugs on human keratocytes Cornea 15,185-190[Medline][Order article via Infotrieve]
-
Blumenkranz, MS, Claflin, A, Hajek, AS (1984) Selection of therapeutic agents for intraocular proliferative disease: cell culture evaluation Arch Ophthalmol 102,598-604[Abstract]
-
Fiscella, R, Peyman, GA, Elvart, J, Yue, B. (1985) In vitro evaluation of cellular inhibitory potential of various antineoplastic drugs and dexamethasone Ophthalmic Surg 16,247-249[Medline][Order article via Infotrieve]
-
Nguyen, KD, Lee, DA (1992) Effect of steroids and nonsteroidal antiinflammatory agents on human ocular fibroblast Invest Ophthalmol Vis Sci 33,2693-2701[Abstract/Free Full Text]
-
Bourcier, T, Borderie, V, Forgez, P, Lombet, A, Rostene, W, Laroche, L. (1999) In vitro effects of dexamethasone on human corneal keratocytes Invest Ophthalmol Vis Sci 40,1061-1070[Abstract/Free Full Text]
-
Wilson, SE, Kim, WJ (1998) Keratocyte apoptosis: implications on corneal wound healing, tissue organization, and disease Invest Ophthalmol Vis Sci 39,220-226[Free Full Text]
-
Wilson, SE (1997) Molecular cell biology for the refractive corneal surgeon: programmed cell death and wound healing J Refract Surg 13,171-175[Medline][Order article via Infotrieve]
-
Wilson, SE, Lloyd, SA, He, YG (1994) Glucocorticoid receptor and interleukin-1 receptor messenger RNA expression in corneal cells Cornea 13,4-8[Medline][Order article via Infotrieve]
-
Gipson, IK, Grill, SM (1982) A technique for obtaining sheets of intact rabbit corneal epithelium Invest Ophthalmol Vis Sci 23,269-273[Abstract/Free Full Text]
-
Ebato, B, Friend, J, Thoft, RA (1987) Comparison of central and peripheral human corneal epithelium in tissue culture Invest Ophthalmol Vis Sci 28,1450-1456[Abstract/Free Full Text]
-
Jumblatt, MM, Neufeld, AH (1983) ß-adrenergic and serotoninergic responsiveness of rabbit corneal epithelial cells in culture Invest Ophthalmol Vis Sci 24,1139-1143[Abstract/Free Full Text]
-
Ruedl, C, Cappelletti, V, Coradini, D, Granata, G, Di Fronzo, G. (1990) Influence of culture conditions on the oestrogenic cell growth stimulation of human breast cancer cells J Steroid Biochem Mol Biol 37,195-200[Medline][Order article via Infotrieve]
-
Chirgwin, JM, Przybyla, AE, MacDonald, RJ, Rutter, WJ (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease Biochemistry 18,5294-5299[Medline][Order article via Infotrieve]
-
Wilson, SE, Lloyd, SA, He, YG, McCash, CS (1993) Extended life of human corneal endothelial cells transfected with the SV40 large T antigen Invest Ophthalmol Vis Sci 34,2112-2123[Abstract/Free Full Text]
-
Sambrook, J, Fritsch, EF, Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual 2nd ed. Cold Spring Harbor Laboratory Cold Spring Harbor, NY.
-
Zhang, C, Ao, Z, Seth, A, Schlossman, SF (1996) A mitochondrial membrane protein defined by a novel monoclonal antibody is preferentially detected in apoptotic cells J Immunol 157,3980-3987[Abstract]
-
. Cell Titer 96 (1994) Aqueous non radioactive cell proliferation assay. Technical Bulletin 169 Promega Madison, WI.
-
Cavallaro, S, Copani, A, DAgata, V, et al (1996) Pituitary adenylate cyclase activating polypeptide prevents apoptosis in cultured cerebellar granule neurons Mol Pharmacol 50,60-66[Abstract]
-
Hollenberg, SM, Weinberger, C, Hong, ES, et al (1985) Primary structure and expression of a functional human glucocorticoid receptor cDNA Nature 318,635-641[Medline][Order article via Infotrieve]
-
He, S, Wang, HM, Ye, J, Ogden, TE, Ryan, SJ, Hinton, DR (1994) Dexamethasone induced proliferation of cultured retinal pigment epithelial cells Curr Eye Res 13,257-261[Medline][Order article via Infotrieve]
-
Saika, S, Kawashima, Y, Miyamoto, T, et al (1999) Immunolocalization of transcription factor AP1 in human ocular surface epithelia Curr Eye Res 18,477-489[Medline][Order article via Infotrieve]
-
Thompson, H, Thompson, J, Lockyer, J, Beuerman, RW (1989) Protooncogene expression during corneal wound healing Beuerman, RW Crosson, GE Kaufman, HE eds. Advances in Applied Biotechnology Series, Vol. 1. Healing Processes in the Cornea ,59-68 Portfolio Publishing The Woodlands, Texas.
-
Wickert, H, Zaar, K, Grauer, A, John, M, Zimmermann, M, Gillardon, F. (1999) Differential induction of proto-oncogene expression and cell-death in ocular tissues following ultraviolet irradiation of the rat eye Br J Ophthalmol 83,225-230[Abstract/Free Full Text]
-
Pearce, D, Matsui, W, Miner, JN, Yamamoto, KR (1998) Glucocorticoid receptor transcriptional activity determined by spacing of receptor and nonreceptor DNA sites J Biol Chem 273,30081-30085[Abstract/Free Full Text]
-
Gao, J, GelberSchwalb, TA, Addeo, JV, Stern, ME (1997) Apoptosis in the rabbit cornea after photorefractive keratectomy Cornea 16,200-208[Medline][Order article via Infotrieve]
-
Ren, H, Wilson, G. (1996) Apoptosis in the corneal epithelium Invest Ophthalmol Vis Sci 37,1017-1025[Abstract/Free Full Text]
-
Wilson, SE, He, YG, Weng, J, et al (1996) Epithelial injury induces keratocyte apoptosis: hypothesized role for the interleukin-1 system in the modulation of corneal tissue organization and wound healing Exp Eye Res 62,325-338[Medline][Order article via Infotrieve]
-
Guizani, L, PerrinWolff, M, Breard, J, Binetruy, B, Bertoglio, J. (1996) Mechanisms in interleukin-2 protection against glucocorticoid-induced apoptosis: regulation of AP-1 and glucocorticoid receptor transcriptional activities J Interferon Cytokine Res 16,601-609[Medline][Order article via Infotrieve]
-
Fenz, Z, Marti, A, Jehn, B, Altermatt, HJ, Chicaiza, G, Jaggi, R. (1995) Glucocorticoid and progesterone inhibit involution and programmed cell death in the mouse mammary gland J Cell Biol 131,1095-1103[Abstract/Free Full Text]
-
Yamamoto, M, Fukuda, K, Miura, N, Suzuki, R, Kido,, Komatsu, Y. (1998) Inhibition by dexamethasone of transforming growth factor beta1-induced apoptosis in rat hepatoma cells: a possible association with Bcl-xL induction Hepatology 27,959-966[Medline][Order article via Infotrieve]
-
Wyllie, AH (1980) Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activity Nature 284,555-556[Medline][Order article via Infotrieve]
-
Dieken, ES, Miesfeld, RL (1992) Transcriptional transactivation functions localized to the glucocorticoid receptor N terminus are necessary for steroid induction of lymphocyte apoptosis Mol Cell Biol 12,589-597[Abstract/Free Full Text]
-
Wilson, SE, Lloyd, SA, Kennedy, RH (1993) Fibroblast growth factor receptor-1, interleukin-1 receptor, and glucocorticoid receptor messenger RNA production in the human lacrimal gland Invest Ophthalmol Vis Sci 34,1977-1982[Abstract/Free Full Text]
-
Hernandez, MR, Wenk, EJ, Weinstein, BI, Gordon, GG, Dunn, MW, Southren, AL (1981) Corneal-conjunctival uptake of topical 3H-dexamethasone in the rabbit eye Invest Ophthalmol Vis Sci 20,120-123[Abstract/Free Full Text]
-
Southren, AL, Dominguez, MO, Gordon, GG, et al (1983) Nuclear translocation of the cytoplasmic glucocorticoid receptor in the iris-ciliary body and adjacent corneoscleral tissue of the rabbit following topical administration of various glucocorticoids: a rapid screening method for glucocorticoid activity Invest Ophthalmol Vis Sci 24,147-152[Free Full Text]
-
Lin, MT, Eiferman, RA, Wittliff, JL (1984) Demonstration of specific glucocorticoid binding sites in bovine cornea Exp Eye Res 38,333-339[Medline][Order article via Infotrieve]
-
Midelfart, A, Dybdahl, A, Krane, J. (1999) Detection of dexamethasone in the cornea and lens by NMR spectroscopy Graefes Arch Clin Exp Ophthalmol 237,415-423[Medline][Order article via Infotrieve]
-
Cenedella, RJ, Fleschner, CR (1989) Cholesterol biosynthesis by the cornea. Comparison of rates of sterol synthesis with accumulation during early development J Lipid Res 30,1079-1084[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
D. Kolodkin-Gal, G. Zamir, Y. Edden, E. Pikarsky, A. Pikarsky, H. Haim, Y. S. Haviv, and A. Panet
Herpes Simplex Virus Type 1 Preferentially Targets Human Colon Carcinoma: Role of Extracellular Matrix
J. Virol.,
January 15, 2008;
82(2):
999 - 1010.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Hartnett, D. J. Martiniuk, Y. Saito, P. Geisen, L. J. Peterson, and J. R. McColm
Triamcinolone Reduces Neovascularization, Capillary Density and IGF-1 Receptor Phosphorylation in a Model of Oxygen-Induced Retinopathy
Invest. Ophthalmol. Vis. Sci.,
November 1, 2006;
47(11):
4975 - 4982.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Perez, L. G. Mahaira, F. J. Demirtzoglou, P. A. Sotiropoulou, P. Ioannidis, E. G. Iliopoulou, A. D. Gritzapis, N. N. Sotiriadou, C. N. Baxevanis, and M. Papamichail
A potential role for hydrocortisone in the positive regulation of IL-15-activated NK-cell proliferation and survival
Blood,
July 1, 2005;
106(1):
158 - 166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. C. Chen, J.-H. Chang, J. B. Lee, J. Javier, and D. T. Azar
Human Corneal Epithelial Cell Viability and Morphology after Dilute Alcohol Exposure
Invest. Ophthalmol. Vis. Sci.,
August 1, 2002;
43(8):
2593 - 2602.
[Abstract]
[Full Text]
[PDF]
|
 |
|