|
|
||||||||
1 From the Departments of Pathology and 2 Ophthalmology, Keck School of Medicine at the University of Southern California; and 3 Doheny Eye Institute, Los Angeles, California.
| Abstract |
|---|
|
|
|---|
) is found
in PVR membranes and regulates many functions of RPE cells. In this
study, the effects of TNF-
on adhesion and migration of RPE cells to
various components of ECM were examined and elucidation of the
mechanism of the response was attempted.
METHODS. Mitogen activated protein kinase (ERK1/2; MAPK) activation was measured
by immunoblot. RPE cells pretreated with TNF-
(10 ng/ml) or TNF-
+ PD98059 (a specific inhibitor of MAPK, 30 µM) for 24 hours were
compared with control RPE. Attachment was measured by modified MTT
assay on fibronectin and collagen types I and IV. Spreading was
measured by staining with fluo3-AM and confocal laser scanning
microscopy. Migration of RPE cells on substrates was determined by
Boyden chamber assay using PDGF-BB (20 ng/ml) as a chemotactic factor.
Integrin expression was determined by flow cytometry and RT-PCR.
RESULTS. TNF-
rapidly activated MAPK and increased the extent of attachment,
spreading and migration on fibronectin and collagen type I
(P < 0.01) but not on collagen type IV. TNF-stimulated
RPE cells showed increased mRNA and surface protein expression for
1
and
5 integrin (P < 0.01) but not
3 integrin
subunit. Neutralizing the anti-
1 antibody inhibited migration on
collagen type I, whereas
5 antibody inhibited fibronectin-induced
migration. Treatment with both TNF and PD98095 reduced attachment and
migration on provisional ECM and reduced the upregulated integrin
expression to control levels.
CONCLUSIONS. After treatment with TNF-
, there is increased expression of specific
integrins associated with increased adhesion and migration on
provisional ECM (fibronectin and collagen type I). This effect is
mediated, at least in part, by activation of MAPK signaling
pathway.
| Introduction |
|---|
|
|
|---|
The provisional ECM found in early stages of PVR is synthesized locally
by several cell types including RPE cells and is composed primarily of
fibronectin and collagen type I.1
4
In contrast, normally
quiescent RPE cells of the intact monolayer sit on a basement membrane
layer that is primarily composed of type IV collagen and laminin on the
inner surface of Bruchs membrane.5
RPE cells interact
with the ECM by way of integrins. Alterations in integrin expression
have been shown in a variety of proliferative disorders and states
including cancer,6
wound healing,7
8
and
angiogenesis.9
Increased expression of certain integrins
including
1,
2,
4,
5,
6, ß1, ß2, and
ß310
11
subunits have been detected in specimens of
human PVR membranes.
Regulation of integrin expression is strongly influenced by cytokines,
including those found in PVR membranes.3
One of the most
prominent of these cytokines is tumor necrosis factor-alpha (TNF-
)
whose mRNA and proteins are widely expressed in PVR
membranes.12
TNF-
is often derived from activated
macrophages although in PVR membranes RPE and glial cells may also be a
source.13
TNF-
stimulates cells by activating one or both of the two known
surface receptors designated as TNF-
receptor (TNFR) type I (p55)
and type II (p75).14
We have previously demonstrated the
presence of p55 mRNA and protein and the relative absence of p75 in
primary cultured RPE cells.15
Activation of the TNFR leads
to a cascade of events resulting in the activation of protein kinase A,
protein kinase C, mitogen-activated protein kinase (MAPK), and
ceramide-dependent protein kinase pathways.16
17
One of
the major subfamilies of the MAPK family is the extracellular
regulating kinases (ERK1 and ERK2).18
We have previously
shown that these MAPK are critical in the proliferation and migration
response of RPE to growth factors such as platelet-derived
growth factor (PDGF).19
Because the MAPK signaling pathway
has been shown to be especially critical in the interaction of
activated cells with ECM,20
we were interested to
determine its role in mediating RPE/ECM interaction in response to
TNF-
.
We hypothesized that TNF-
plays an important role in altering the
attachment and migration of RPE cells to favor provisional ECM
molecules through changes in integrin expression. Such interaction is
hypothesized to occur, in part, through MAPK signaling as part of
generalized activation response of RPE cells.
| Materials and Methods |
|---|
|
|
|---|
(10 ng/ml; Boehringer
Mannheim, Indianapolis, IN) in DMEM with 0.4% FBS in the absence or
presence of the MAPK-specific inhibitor PD98059 (30 µM; New England
Biolabs, Beverly, MA).22
Statistical Analysis
All experiments were repeated three times and compared using the
paired Students t-test; the level of confidence for
statistical significance was determined to be P <
0.01.
Immunoblot Assay
Confluent cells grown in six-well plates were starved for 48 hours
in DMEM with 0.1% bovine serum albumin and then incubated for 10
minutes with 10% FBS or with serum-free medium containing TNF-
(10
ng/ml), TNF + PD98059 (30 µM), or TNF + calphostin C (100 nM). Cells
were lysed, supernatants were collected, and proteins were resolved on
Tris-HCl 7.5% polyacrylamide gels (Ready Gel; Bio-Rad, Hercules,
CA) at 120 V. The proteins were transferred to PVDF blotting
membrane (Millipore, Bedford, MA), and the membranes were probed with
polyclonal antibody specific for the dually phosphorylated forms of
p42/44 MAPK (at amino acids Thr202 and Tyr204, 1:3000 dilution; New
England Biolabs) followed by chemiluminescent detection (Amersham
Pharmacia Biotech, Cleveland, OH).
Adherence Assay
Attachment.
The attachment assay was carried out using fibronectin-coated or
collagen type I or IVcoated 96-well plates (Becton Dickinson
Labware, Bedford, MA). Confluent RPE cells
(105/ml) were trypsinized and resuspended in DMEM
with 0.4% FBS. One hundred microliters of cell suspension
(104 cells) was added to each well and allowed to
attach for 60 minutes The cells were washed gently with PBS twice, and
fresh medium (150 µl) was added to each well with MTT
(3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H
tetrazolium bromide, 5 mg/ml, 20 µl; Sigma). After 5 hours of
incubation, the supernatants were decanted, and the formazan
precipitates were solubilized by the addition of 150 µl of 100% DMSO
(Sigma) and placed on a plate shaker for 10 minutes. Absorbance at 550
nm was determined on a Dynatech MR 600 microplate reader (Chantilly,
VA). Living cell number was proportional to the absorbance of MTT at
550 nm.
Spreading.
The spreading assay was performed on eight-well chamber slides coated
with fibronectin or collagen type I or IV (Becton Dickinson Labware).
RPE cells were plated on the chamber slides and attached for 30 minutes
in a 37°C incubator. The slides were washed with PBS and then stained
with 6 µm Fluo3-AM (Molecular Probes, Eugene, OR) in fresh medium for
35 minutes at 37°C and for 15 minutes at room temperature. The dye
stains the cell cytoplasm and facilitates estimation of cell spreading.
Cells were washed with PBS, and the slides were mounted. A confocal
scanning laser microscope (Zeiss, Thornwood, NY) was used to determine
the surface area of cells at the substratecell interface by optical
section.23
Quantitation was performed by measuring the
contact area of each cell using microplan II software (Donsanto Corp,
Natick, MA).
Attachment Strength.
A modified, centrifugal forcebased adhesion assay was
used.24
25
RPE cells were plated to fibronectin or
collagen type I or IV in coated, 96-well plates at
104/well, attached for 60 minutes, and then
gently washed with PBS. Plates were inversely centrifuged in the
swinging bucket microtiterplate holder of the centrifuge at
500g, 1000g, and 2000g for 2 minutes,
respectively. The remaining cells then were incubated for 5 hours at
37°C with fresh medium containing MTT, and absorbance at 550 nm was
measured as described above.
Migration Assay
Migration was measured by using a modified Boyden chamber
assay19
in 24-well plates in which inserts were coated
with fibronectin or collagen type I or IV (2
µg/cm2), and platelet-derived growth factor
(PDGF, 20 ng/ml, Boehringer Mannheim) was used as the chemoattractant
in DMEM containing 0.4% FBS. After 5 hours incubation, the inserts
were washed three times with PBS, fixed with cold (4°C) methanol for
10 minutes, and counterstained with hematoxylin for 20 minutes. The
number of migrated cells was counted using phase-contrast microscopy
(x320). Four randomly chosen fields were counted per insert.
Antiadhesion monoclonal antibodies (
1,
3,
5; Chemicon,
Temecula, CA) were used in the assay.26
After cells were
trypsinized and resuspended in the medium, antibodies were added
(1:100) and incubated for 30 minutes at 37°C. An irrelevant antibody
served as control. The migration assay was done as above.
Collagen and Fibronectin Receptor Expression
Flow Cytometry.
Trypsinized RPE cells were resuspended in PBS with 5% goat serum (for
reduction of nonspecific staining) for 10 minutes at room temperature.
Anti-integrin monoclonal antibodies (1/100 dilution, Chemicon) were
added to the solution along with 0.4% FBS. After incubation for 1 hour
at 4°C, RPE cells were washed with PBS. Secondary antibodies
(anti-mouse IgG R-Phycoerythrin conjugate; Sigma) were added for 30
minutes at 4°C and washed with PBS. RPE cells were then fixed with
1% paraformaldehyde for 10 minutes. Five thousand cells were used for
flow cytometry analysis and mean channel fluorescence was determined
with a Becton Dickinson FACScan using Consort 30 software.
Reverse TranscriptasePolymerase Chain Reaction (RT-PCR).
Poly(A) + RNA was isolated from control, TNF-treated for 24 hours, and
PD98059 + TNFtreated RPE cells using a Fast Track Kit
(Invitrogen, San Diego, CA), and 35 cycles of PCR were
performed as previously described.15
The oligonucleotide
sequences for
1 primers are as follows: 5'GCCTCCTTTCTTGCTGTGT3', and
5'TGGTTCTCCGTTAGTTGGC3'27
; for
3,
5'CTTCAACCTGGATACCCGA3' and 5'TCCAGCTCTAGGT CATTGC3'28
;
and for
5, 5'GATCGAATTCGGCATCTTCAGGGCT TTGTACACA3' and
5'TCAGGGATCCAAC TTCAGCTG GACTGGCAGAAGCA3'.29
Quantification of PCR Products.
PCR products were diluted in denaturing solution (0.4 N NaOH, 25 mM
EDTA), neutralized with Tris-HCI (1.0 M; pH 8.0), and transferred to
0.45-µm Nytran membranes (Schleicher & Schuell, Keene, NH) using a
Minifold I dot blot apparatus (Schleicher & Schuell). Membranes were
hybridized at 58°C overnight with
[32P]ATP-labeled internal oligonucleotide
probes,
1: 5'TGTTCT GACGTCAGCCCCACATTTCAAGTC3',
3:
5'ACTCACTGCCCACAAGGATGACTGAGCG3',
5:
5'ACTTCTCCAGCCTGAGCTGT-GACTACTTTA3', and ß-actin:
5'CACGGCATCGTC ACCAAC TGGGACATG3'. Membranes were washed three times
with 2x SSC at room temperature, exposed to phosphor screens
(Molecular Dynamics, Sunnyvale, CA), and scanned using a
phosphorimaging scanner (Molecular Dynamics). Radioactive signals of
integrin cDNA were quantified and normalized to the housekeeping
ß-actin values to adjust for differences in loading.30
| Results |
|---|
|
|
|---|
Activation of ERK1/2 MAPK in RPE
resulted in rapid activation of
ERK1/2 as measured by phosphorylation immunoblot (Fig. 1)
. RPE grown in serum-free media demonstrated only weak ERK1/2
phosphorylation (Fig. 1
, lanes 1 and 2). Treatment with 10% FBS
as a positive control resulted in strong MAPK activation (Fig. 1
, lane
3). After 10 minutes of TNF-stimulation, prominent phosphorylation of
ERK1/2 (Fig. 1
, lanes 4 and 5) was present, which was completely
inhibited by pretreatment with the selective MAPK inhibitor PD98059
(Fig. 1 , lanes 8 and 9). There was only partial inhibition of
TNF-induced MAPK activation by the PKC inhibitor calphostin C (Fig. 1
,
lanes 6 and 7).
|
Increases Attachment, Spreading, and Attachment Strength
, there was a marked statistically
significant (P < 0.01) increase in substrate
attachment to either fibronectin or collagen type; however, no
significant changes in attachment to collagen type IV were detected.
Pretreatment of TNF-stimulated RPE cells with PD98059 significantly
decreased the attachment on all three substrates (P <
0.01) compared with TNF-stimulation alone and resulted in levels of
attachment that were not statistically different from cells without TNF
stimulation.
|
|
treated RPE cells showed significantly increased
cell spreading compared with control cells when grown on fibronectin
and collagen type I (P < 0.01). Quantification was
performed by measuring the contact area of each cell using microplan II
software (Donsato Corp.). No increased spreading of TNF-pretreated RPE
was found when they were grown on collagen type IV (Fig. 4A)
. Previous
reports suggested that spreading of fibroblasts is mediated through
protein kinase C (PKC).31
Pretreatment with the PKC
inhibitor calphostin C markedly inhibited TNF-induced spreading on
fibronectin (Fig. 4B) . PKC activation may then result in downstream
activation of ERK1/2 MAPK pathway or may phosphorylate other non-MAPK
targets. Pretreatment of RPE cells with TNF + PD98059 did not decrease
the TNF-increased spreading on fibronectin (Fig. 4B)
, suggesting that
spreading is regulated by the PKC pathway independent of MAPK
activation.
|
Increases Migration
for 24 hours before seeding them in
the upper chamber, there was only a modest increase in the number of
migrating cells through the three ECMs in the absence of chemotactic
stimulus by PDGF. In contrast, after 24 hours pretreatment of RPE
with TNF-
, the migration induced by PDGF placed in the lower
compartment of the Boyden chamber was markedly increased compared with
control RPE cells grown on fibronectin (P < 0.01) and
collagen type I (P < 0.01). This effect of TNF
pretreatment on PDGF chemotaxis was not seen when cells were grown on
collagen type IV (Fig. 5)
. Pretreatment of RPE cells with TNF + PD98059
significantly inhibited (P < 0.01) the TNF enhancement
of migration in response to PDGF on fibronectin and collagen type I
(Fig. 5)
and resulted in levels of migration that were not
significantly different from PDGF alone.
|
. Flow cytometry was used to measure
expression of integrins with distinct substrate affinities including
collagen 1 (
1), collagen IV (
3), and fibronectin (
5). After
pretreatment of RPE cells with TNF-
for 24 hours, cells exhibited
significantly increased surface staining for
1 (P <
0.01) and
5 (P < 0.01) integrin subunits (Fig. 6)
but no significant change for
2 and
3 (data not shown).
TNF-induced
1 and
5 integrin expression was suppressed to control
levels by pretreatment with PD98059 (P < 0.001, Fig. 6
).
|
1,
3, and
5 integrin mRNA expression by control and
TNF-stimulated RPE (Fig. 7A
) was examined by RT-PCR. TNF-
significantly increased
5 and
1
integrin expression (Fig. 7A
, lanes 3 and 9), whereas PD98059 inhibited
this TNF-
effect (Fig. 7A
, lanes 2 and 8). No increase in
3
integrin expression was found after TNF pretreatment (Fig. 7A
, lanes 4,
5, 6). Quantitation of PCR products was performed by dot blot analysis
using an internal probe (Fig. 7B) . After pretreatment with TNF-
,
5 integrin expression was increased fivefold compared with control,
1 integrin expression was increased threefold compared with control,
and
3 expression showed no change.
|
pretreatment increased RPE
migration by regulating expression of integrin receptors, we used
antiadhesion antibodies against
5 integrin (migration on
fibronectin),
1 integrin (migration on collagen type I), and
3
integrin (migration on collagen type IV) (Fig. 8)
. Migration of RPE cells was markedly inhibited by
5 antibody on
fibronectin,
1 antibody on collagen type I, and
3 antibody on
collagen type IV. There was no inhibition by an irrelevant antibody
(data not shown). After treatment with TNF-
, the inhibition of
migration on fibronectin by antibody against
5 integrin was most
prominent, suggesting that the increased migration caused by TNF-
is
associated with increased
5 integrin expression.
|
| Discussion |
|---|
|
|
|---|
and PDGF, to migrate away from monolayer into a
provisional ECM where they participate in epiretinal membrane
formation.1
4
In the early stage of PVR, provisional ECM
components including collagen type I and fibronectin are synthesized
and deposited on the retinal surfaces.33
Movement of an
individual cell from a resting ECM substrate to a provisional ECM
requires initial cell attachment to the new matrix, followed by cell
spreading, stable attachment, and then migration.34
35
In
the absence of TNF-
, control RPE do not demonstrate any significant
preference for provisional ECM, providing little incentive for
migration from the monolayer.4
In the presence of TNF-
,
however, RPE cells attach more strongly and spread more prominently
than untreated control cells on provisional ECMs, but this effect does
not occur when cells are grown on collagen type IV. These TNF effects
are likely to be cell type and ECM-specific because previous studies
have shown that on collagen, TNF stimulates B-cell spreading but
inhibits fibroblast spreading.36
After RPE cells establish adhesion, migration through a retinal hole
into the vitreous is a critical stage of PVR formation. Previously, we
reported that PDGF is a strong chemotactic factor for RPE cells in the
presence of fibronectin.19
37
In this study we provided
evidence that pretreatment of RPE with TNF-
results in a significant
increase in the ability of PDGF to stimulate RPE cell migration on
provisional ECM. This suggests that TNF-
is upregulating a factor
important for PDGF-induced migration because short-term treatment of
RPE with TNF has little effect on RPE migration (results not shown).
Chemotactic migration is a complex phenomenon involving adhesion to
ECM, cell motility, and the effects of chemotactic
factors.38
39
40
Spreading also plays a critical role in
migration with particular relevance to the speed of
migration.41
Multiple mechanisms are involved in control
of the migratory response including growth factor receptor activation
of downstream signaling pathways, alterations in cytoskeletal elements
and motors, and alterations in the expression and activation of
integrins. In other cell types, TNF-
stimulation is associated with
activation of small GTP-binding proteins, phosphorylation of paxillin
and focal adhesion kinase, and reorganization of the actin
cytoskeleton.42
43
Integrins are a class of heterodimeric transmembrane proteins
that play essential roles in many cellular processes involving
cellECM and cellcell interactions.11
We found that
unstimulated RPE cells expressed
1,
3, and
5 integrin subunits
and that expression was strongest for
5. The
1 and
3 integrin
subunits are primarily used for attachment to collagen, whereas
5
provides attachment to fibronectin. After treatment with TNF-
, the
pattern of integrin expression was dramatically modified. The RPE cells
showed a significant increase in
1 and
5 subunits but not in
3
subunit. This predicts and supports our finding that TNF-
treated
cells show increased affinity to fibronectin and collagen 1 but not
collagen IV, based on the receptor specificity. An increase in integrin
expression in other cell types stimulated by TNF-
is associated with
increased cell migration in neutrophils, monocytes, and
fibroblasts.16
The subunit partner of the alpha integrins
is generally the ß1 subunit, which has a unique distribution in the
basal domain of RPE cells and participates in RPE cell migration during
PVR.44
The specific roles of integrins in RPE cell migration were
confirmed by blocking experiments with antiadhesion antibodies for
1,
3, and
5. Those antibodies only partially inhibited
migration on specific ECMs, which suggests that migration on
fibronectin and collagen may be dependent on the simultaneous activity
of several integrins or a coexistent nonintegrin adhesion molecule or
receptor. The inhibition of migration by antibodies to integrins
demonstrates that RPE cell motility is strongly integrin-dependent on
the substrates used. In fact, a disintegrin (Arg-Gly-Asp containing
peptides from viper venom) was effective in suppressing RPE
cellinduced tractional retinal detachment in the rabbit
eye.45
Because TNF-
plays a critical role in regulating integrin
expression, resulting in increased attachment, spreading, and migration
to provisional ECM, we investigated the mechanisms by which TNF-
may
alter RPE cell surface integrin expression. Although TNF-
has been
shown to activate a number of second- and third-messenger pathways in
various human cell types,46
47
48
translation of these
findings to our model is difficult because signaling mechanisms are
highly dependent on the cell type. Because RPE cells predominantly
express p55 TNFR, it is a good model to use for investigating signaling
mechanisms activated through this receptor.15
To determine
whether MAPK might influence integrin expression, we used an inhibitor
(PD98095) that specifically inhibits ERK kinase (MEK).22
We found that blocking the MAPK pathway by PD98059 inhibited
TNF-induced
1 and
5 integrin expression. TNF-
has been shown
to activate MAPK by two pathways, a ras-raf-mek pathway and a
ras-independent pathway mediated through PKC.49
In
contrast to MAPK inhibition, PKC inhibition using calphostin C did not
inhibit TNF-induced integrin expression (data not shown). Although PKC
was found to be important in cell spreading, PKC-independent MAPK
activation appears to be a more significant pathway in TNF activation
of RPE cells. In conjunction with the role of MAPK in adhesion and
migration, the MAPK pathway appears to be a central regulating pathway
in the relationship of TNF-stimulated RPE to the ECM.
The downstream substrates of activated MAPK are largely unknown but include a variety of nuclear and cytoplasmic targets such as transcription factors, cytoskeletal elements, inflammatory mediators, and other Ser/Thr kinases.50 51 52 Although it is not clear which of these targets is involved in the upregulation of integrins, myosin light chain kinase (MLCK) has been implicated as a possible target of MAPK activation in cell migration.53
Thus, TNF-
is a major regulator of RPE activation responses,
including cell attachment, spreading, chemotaxis, and migration. This
regulation appears to be mediated through differential expression of
distinct integrins that determine the matrix attachment of RPE to
Bruchs membrane or provisional matrices during diseases. The MAPK
pathway plays a critical role in the regulated expression of these
integrins and in the downstream activation of RPE by TNF. These results
suggest that both TNF-
and MAPK may be potential therapeutic targets
in disorders such as PVR in which cytokine activation of RPE plays a
central role.
| Acknowledgements |
|---|
| Footnotes |
|---|
Submitted for publication March 13, 2000; revised July 6, 2000; accepted July 25, 2000.
Commercial relationships policy: N.
Corresponding author: David R. Hinton, Department of Pathology, Keck School of Medicine, University of Southern California, 2011 Zonal Avenue, HMR 209, Los Angeles, CA 90033. dhinton{at}hsc.usc.edu
| References |
|---|
|
|
|---|
-induced activation of p42mapk/erk2 in mouse macrophages J Biol Chem 270,27391-27394
rapidly activates the mitogen-activated protein kinase (MAPK) cascade in a MAPK kinase kinase-dependent, c-raf-1-independent fashion in mouse macrophages Proc Natl Acad Sci USA 92,1614-1618
inactivation of collagen receptors: implications for fibroblast function and fibrosis J Immunol 156,4354-4362[Abstract]
5ß1 integrin-mediated cell spreading on fibronectin J Biol Chem 268,21459-21462
induces spreading of B-CCL via the CD11c/CD18 molecule Am J Hematol 44,221-228[Medline][Order article via Infotrieve]
-induced reorganization of the actin cytoskeleton and cell-cell junctions by Rho, Rac, and Cdc42 in human endothelial cells J Cell Physiol 176,150-165[Medline][Order article via Infotrieve]
induces actin cytoskeleton reorganization in glomerular epithelial cells involving tyrosine phosphorylation of paxillin and focal adhesion kinase Mol Med 5,382-392[Medline][Order article via Infotrieve]
through the 55-kDa receptor is dependent on protein kinase C in human retinal pigment epithelial cells Invest Ophthamol Vis Sci 37,597-606
stimulation and phorbol ester treatment on the immunocytochemical staining of intercellular adhesion molecule 1 in human renal carcinoma cell cultures Virchows Arch B Cell Pathol Incl Mol Pathol 63,107-113[Medline][Order article via Infotrieve]
induces tyrosine phosphorylation of mitogen-activated protein kinase in adherent human neutrophils J Immunol 154,4785-4792[Abstract]
This article has been cited by other articles:
![]() |
Y.-W. Peng, M. Zallocchi, D. T. Meehan, D. Delimont, B. Chang, N. Hawes, W. Wang, and D. Cosgrove Progressive Morphological and Functional Defects in Retinas from {alpha}1 Integrin-Null Mice Invest. Ophthalmol. Vis. Sci., October 1, 2008; 49(10): 4647 - 4654. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Li, A. Maminishkis, F. E. Wang, and S. S. Miller PDGF-C and -D Induced Proliferation/Migration of Human RPE Is Abolished by Inflammatory Cytokines Invest. Ophthalmol. Vis. Sci., December 1, 2007; 48(12): 5722 - 5732. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Zhang, J. J. Peairs, P. Yang, J. Tyrrell, J. Roberts, R. Kole, and G. J. Jaffe The Importance of Bcl-xL in the Survival of Human RPE Cells Invest. Ophthalmol. Vis. Sci., August 1, 2007; 48(8): 3846 - 3853. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Yang, J. L. Wiser, J. J. Peairs, J. N. Ebright, Z. J. Zavodni, C. Bowes Rickman, and G. J. Jaffe Human RPE Expression of Cell Survival Factors Invest. Ophthalmol. Vis. Sci., May 1, 2005; 46(5): 1755 - 1764. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Yang, B. S. McKay, J. B. Allen, and G. J. Jaffe Effect of NF-{kappa}B Inhibition on TNF-{alpha}-Induced Apoptosis in Human RPE Cells Invest. Ophthalmol. Vis. Sci., July 1, 2004; 45(7): 2438 - 2446. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Huang, L. Wang, M. Yuan, J. Ma, and Y. Hui Adrenomedullin Affects Two Signal Transduction Pathways and the Migration in Retinal Pigment Epithelial Cells Invest. Ophthalmol. Vis. Sci., May 1, 2004; 45(5): 1507 - 1513. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Priglinger, C. S. Alge, A. S. Neubauer, N. Kristin, C. Hirneiss, K. Eibl, A. Kampik, and U. Welge-Lussen TGF-{beta}2-Induced Cell Surface Tissue Transglutaminase Increases Adhesion and Migration of RPE Cells on Fibronectin through the Gelatin-Binding Domain Invest. Ophthalmol. Vis. Sci., March 1, 2004; 45(3): 955 - 963. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. He, M. L. Jin, V. Worpel, and D. R. Hinton A Role for Connective Tissue Growth Factor in the Pathogenesis of Choroidal Neovascularization Arch Ophthalmol, September 1, 2003; 121(9): 1283 - 1288. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Van Aken, O. De Wever, L. Van Hoorde, E. Bruyneel, J.-J. De Laey, and M. M. Mareel Invasion of Retinal Pigment Epithelial Cells: N-cadherin, Hepatocyte Growth Factor, and Focal Adhesion Kinase Invest. Ophthalmol. Vis. Sci., February 1, 2003; 44(2): 463 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Hogg, I. Grierson, and P. Hiscott Direct Comparison of the Migration of Three Cell Types Involved in Epiretinal Membrane Formation Invest. Ophthalmol. Vis. Sci., August 1, 2002; 43(8): 2749 - 2757. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jin, E. Barron, S. He, S. J. Ryan, and D. R. Hinton Regulation of RPE Intercellular Junction Integrity and Function by Hepatocyte Growth Factor Invest. Ophthalmol. Vis. Sci., August 1, 2002; 43(8): 2782 - 2790. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Geisert Jr, H. J. Abel, L. Fan, and G. R. Geisert Retinal Pigment Epithelium of the Rat Express CD81, the Target of the Anti-proliferative Antibody (TAPA) Invest. Ophthalmol. Vis. Sci., January 1, 2002; 43(1): 274 - 280. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |