IOVS Proceedings of the National Academy of Sciences
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Inatani, M.
Right arrow Articles by Honda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Inatani, M.
Right arrow Articles by Honda, Y.
(Investigative Ophthalmology and Visual Science. 2000;41:4338-4346.)
© 2000 by The Association for Research in Vision and Ophthalmology, Inc.

Neuroglycan C, a Neural Tissue–Specific Transmembrane Chondroitin Sulfate Proteoglycan, in Retinal Neural Network Formation

Masaru Inatani1, Hidenobu Tanihara2, Atsuhiko Oohira3, Yasumasa Otori4, Akihiro Nishida1, Megumi Honjo1, Noriaki Kido1 and Yoshihito Honda1

1 From the Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine; the 2 Department of Ophthalmology, Tenri Hospital; the 3 Department of Perinatology, Institute for Developmental Research, Aichi Human Service Center; and the 4 Department of Ophthalmology and Visual Science, Osaka University, Japan.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Neuroglycan C (NGC) is a transmembrane chondroitin sulfate proteoglycan present exclusively in central nervous system tissues. In the current study the expression pattern and characterization of NGC during the development of the retina were investigated.

METHODS. Expressional changes of NGC mRNAs during rat retinal development were examined by semiquantitative reverse transcription–polymerase chain reaction (RT-PCR). The localization and characterization of NGC core proteins were investigated by immunoblot analysis and immunohistochemistry using an anti-NGC antibody.

RESULTS. Immunohistochemical analysis revealed that NGC was highly expressed in the nerve fiber layer (NFL) and inner plexiform layer (IPL) in rat postnatal developing retina. At embryonal stages, NGC immunoreactivities were faint. In contrast, at postnatal developmental stages (approximately postnatal day [P]7), intense immunoreactivity was observed in the NFL and IPL, where active dendrite branching was observed, and conventional synapses began to be formed. As retinal layer differentiation proceeded (from P14 to P42), immunoreactivities in the inner retinal layers gradually became fainter. Immunoblot and semiquantitative RT-PCR analyses showed that the peak level of NGC expression occurred on approximately P7 and P14. Glycosylation of the NGC core protein changed as the retinal layers matured. In immunoelectron microscopic analysis, NGC immunoreactivity was located on the axonal membranes of neuronal cells in the postnatal retina, whereas immunoreactivity was reduced on membranes at the adult stage. In retinal ganglion cells in vitro, NGC was highly localized in their spiny budding neurites.

CONCLUSIONS. The results show spatiotemporal expression patterns of NGC, and suggest that it plays a role in the formation of neural networks in retinal development.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Proteoglycans are members of the extracellular matrices that include core protein covalently attached glycosaminoglycans (GAGs) as side chains.1 2 3 Multiple proteoglycan species with different structural features are expressed in a regulated manner in developing central nervous system tissues.4 5 6 There is much evidence that proteoglycans are involved in axonal outgrowth, synaptogenesis, and neuronal cell differentiation.7 8 9 10 11 12 13 14 15 16 Moreover, proteoglycans are present in the extracellular space as soluble molecules, as well as on the cell surface as transmembrane components or glycosylphosphatidylinositol-anchored molecules.17 Our previous studies have shown that soluble proteoglycans, such as neurocan18 and phosphacan,19 which are present in the extracellular space, are abundantly localized in retinal synaptic layers at rat postnatal stages when the retinal neural network is formed.

Neuroglycan C (NGC), a central nervous tissue-specific transmembrane chondroitin sulfate proteoglycan (CSPG), is expressed in developing rat brain.20 This membrane-bound CSPG is present also in the cerebrum of various vertebrates, including humans, and is evolutionally conserved, indicating that NGC may be essential to nervous tissue development and maintenance.21 Although the exact function of NGC is unknown, an immunohistochemical study showed that NGC is localized in Purkinje cells in developing mouse cerebellum and that NGC is localized on thick dendrites on which the climbing fibers form synapses and not on the thin branches on which the parallel fibers form synapses, indicating that NGC may be involved in neural network formation.22 However, reports on the roles of transmembrane proteoglycans in the extension and guidance of neurites in developing neuronal cells are limited.23 24 25 Neural retina consists of exquisitely formed layer-by-layer structures in which neurons are connected for visual perception. Thus, elucidation of the actions of NGC-associated events in the formation of the retinal neural network should shed light on the potential role of this membrane-bound proteoglycan in the complex neurogenesis of central nervous system tissues.

Herein, we report that NGC expression is regulated spatiotemporally during retinal development and that characterization of its side chains is changed as retinal development proceeds. Furthermore, in purified retinal ganglion cells in culture, NGC is expressed abundantly in spiny budding neurites. Our studies suggest that NGC plays an important role in the formation of neural networks in retinal development.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunohistochemistry
All animals were given water and food ad libitum, and all studies were conducted in accordance with the ARVO Statement for Use of Animals in Ophthalmic and Vision Research. The animals were killed by intraperitoneal injection of an overdose of pentobarbital. Wistar rats at various developmental stages (embryonic day [E]16 to postnatal day [P]42) were used in our experiments. Preparation of retinal sections for immunohistochemical analysis was performed as described previously.26 Briefly, retinal frozen sections (16 µm) were obtained by fixation of rat eyes with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 2 hours at 4°C. Sections were covered with 50 mM glycine-PBS before each slide was covered for 1 hour with the blocking solution (2% bovine serum albumin [BSA], 2% horse normal serum, and 2% goat normal serum in PBS), and then incubated for 2 hours with anti-rat NGC antiserum21 diluted 1:2000. After removal of the antibody, sections were incubated for 30 minutes at room temperature with biotinylated anti-rabbit IgG (Vector, Burlingame, CA) diluted 1:200. Slides were covered for 45 minutes at room temperature with avidin DH and biotinylated horseradish peroxidase H reagents, using the ABC kit (Vectastain Elite ABC Kit; Vector). Diaminobenzidine tetrahydrochloride (DAB; Dako Japan, Kyoto, Japan) was used for staining the sections. The retinal sections for each comparison were immunolabeled during the same experiment and, additionally, DAB substrate incubation time in all developmental retinal sections was 3 minutes.

Immunoelectron Microscopy
Immunoelectron microscopy using the silver-enhancement technique was performed as previously described.27 Briefly, after incubation with the anti-NGC antibody as described, the sections were incubated with an anti-rabbit polyclonal IgG coupled with 1.4-nm gold particles (Nanoprobes, Stony Brook, NY), followed by fixation with 1% glutaraldehyde in 0.1 M phosphate buffer (PB) for 10 minutes. The sample-bound gold particles were then enhanced at 20°C for 14 minutes by use of the HQ-silver kit (Nanoprobes), after which they were postfixed with 0.5% osmium oxide in 0.1 M PB at pH 7.3, dehydrated by passage through a graded series of ethanol, and embedded in epoxy resin. From these samples, ultrathin sections were cut, stained with uranyl acetate and lead citrate, and observed with an electron microscope (JEM-1200EX; JEOL, Tokyo, Japan).

Cell Culture
As described previously,28 29 retinal ganglion cells from P8 rat retina were purified by the immunopanning procedure. Briefly, the retinal tissue was dissociated to single cells in Hanks’ balanced salt solution (HBSS) containing 15 U/ml papain and 70 U/ml collagenase. The dissociated cells were incubated in a polypropylene tube coated with an anti-rat macrophage monoclonal IgG (Chemicon, Temecula, CA) diluted 1:50 to exclude macrophages and then incubated in a tube coated with an anti-rat Thy 1.1 monoclonal IgG (Chemicon) diluted 1:300. The tube was gently washed with PBS five times, and adherent retinal ganglion cells were collected by centrifugation at 2000 rpm for 5 minutes. To determine purity, retinal ganglion cells were labeled in a retrograde manner by injecting 1 mg/ml 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine (DiI)into the superior colliculi of anesthetized P5 rats. As described previously,29 during this immunopanning method, approximately 85% of the collected cells were labeled by DiI. The purified retinal ganglion cells were plated at a low density of approximately 500 cells/cm2 on 12-mm glass coverslips coated with 50 µg/ml poly-L-lysine and 10 µg/ml laminin. The cells were cultured in Neurobasal medium (Life Technologies, Rockville, MD) with 1 mM glutamine, 10 µg/ml gentamicin, B27 supplement (Life Technologies), 40 ng/ml human brain-derived neurotrophic factor (BDNF; Diaclone Research, Besançon, France), 40 ng/ml rat ciliary neurotrophic factor (CNTF; Diaclone Research) and 5 µM forskolin (Sigma, St. Louis, MO). Cultures were maintained at 37°C in 5% CO2 incubator. The immunohistochemical studies using anti-NGC antibody were performed at 1, 3 and 7 days after incubation began. Fluorescein-conjugated anti-rabbit IgG (Vector) was used as the second antibody. Slides were examined under a confocal microscope.

Semiquantitative RT-PCR and Subsequent Southern Blot Analysis
After enucleation of the rat eyes at various stages of development, neural retinas were removed with scissors and forceps under an operating microscope. Retinal total RNA extracted by the acid guanidium thiocyanate-phenol chloroform extraction method was used to synthesize template cDNAs for subsequent reverse transcription–polymerase chain reaction (RT-PCR) experiments with the use of reverse transcriptase (First-Strand cDNA Synthesis Kit; Amersham Pharmacia Biotech, Uppsala, Sweden) as described previously.18 After normalization of each cDNA concentration using primers to ß-actin, AGCTGAGAGGGAAATCGTGC (sense) and ACCAGACAGCACTGTGTTGG (antisense),30 PCR experiments using primers to NGC were performed. The following conditions were used: denaturation at 95°C for 30 seconds, annealing at 65°C for 30 seconds, and polymerization at 72°C for 1 minute for 19 cycles (ß-actin primers) or 30 cycles (NGC primers). The sequences of the sense and the antisense primers for NGC were ACGAGCGAAAATGGAACAGA designed from the extracellular domain and GTGGAGAGGGAGAAGTTATC designed from the cytoplasmic domain, respectively.20 The PCR products were separated by 2% agarose gel electrophoresis, and transferred to a membrane (Hybond-N+; Amersham Pharmacia Biotech), by the capillary transfer method with 20x SSC. In Southern blot analysis, internal oligonucleotide probe (GGCTTTGTCAGACACAATGG designed from the transmembrane domain) was labeled by enhanced chemiluminescence 3'-oligolabeling and detection systems (Amersham Pharmacia Biotech) to exclude the nonspecific bands. To investigate relative levels of NGC gene expression, semiquantitative analysis was performed by measurement of the optical densities of the hybridized bands using image analysis software (Image 1.59, National Institutes of Health, Bethesda, MD). A standard curve was generated from the optical densities of hybridizing bands from serial dilutions of template cDNAs, and the linearity of the created standard curve among the selected concentrations was confirmed. The relative levels of mRNA expression were calculated.

Immunoblot Analysis
As described previously,18 rat retinal tissues at various developmental stages were homogenized in 50 µl ice-cold PBS containing 10 mM N-ethylmaleimide (NEM), 20 mM EDTA, and 2 mM phenylmethylsulfonyl fluoride (PMSF). The homogenates were then mixed with 200 µl of 20 mM Tris-HCl buffer (pH 7.5) containing 2% sodium dodecyl sulfate (SDS), 10 mM NEM, 20 mM EDTA, and 2 mM PMSF and boiled for 5 minutes. After digestion with protease-free chondroitinase ABC (EC 4.2.2.4; Seikagaku, Tokyo, Japan) to remove chondroitin sulfate side chains, as described previously,31 the sample (protein concentration: 50 µg) was electrophoresed by sodium dodecylsulfate–polyacrylamide gel electrophoresis (SDS-PAGE) on a 3% stacking gel and a 6% separating gel, and then transferred electrophoretically to a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA). The membrane was incubated in the blocking solution for 1 hour at room temperature, incubated in the anti-NGC polyclonal antibody for 2 hours, and subsequently incubated in biotinylated anti-rabbit IgG for 30 minutes at room temperature. Immunoreactive materials on the membrane were detected using the ABC kit (Vectastain Elite; Vector).

Membrane-Bound Protein Fractions
Preparation of the retinal cell membrane-bound fraction was performed as described previously32 with slight modification. In brief, 60 eyes and 20 eyes were enucleated from P14 and P42 rats, respectively, and retinal tissues were collected in HBSS. The wet weight of each total collected retinal tissue from P14 and P42 rats was approximately 1 g. Retinal tissue was homogenized with a tight-fitting glass-Teflon Potter homogenizer (Wheaton, Millville, NJ) in 5 ml of 0.32 M sucrose, 5 mM EDTA, 1 mM benzamidine, and 50 mM Tris-HCl (pH 7.5) containing 100 µM PMSF, 10 µM leupeptin and 10 µM pepstatin as protease inhibitors. The homogenized solution was centrifuged at 1000 g for 5 minutes at 4°C, after which the supernatant (SUP-I) was stored. The pellet was homogenized in 2.5 ml of the same solution and the homogenate subjected again to centrifugation. The resultant supernatant (SUP-II) was added to the previously prepared supernatant (SUP-I), and the combined solution was subjected to ultracentrifugation at 105,000g for 60 minutes at 4°C. The pellet was washed with 5 ml of the same solution and subjected to ultracentrifugation. The final pellet contained the membrane-bound proteins. The pellet was solubilized with SDS buffer and precipitated with ethanol. The precipitated material was subjected to digestion by glycosidase enzymes, as follows.

Glycosidase Digestion
The membrane-bound protein fractions were digested by glycosidase enzymes to remove oligosaccharides of glycoproteins, as described previously.33 The precipitated membrane-bound protein fraction (200 µg protein) was suspended in 75 µl of a solution containing 5 mM EDTA, 5 mM NEM, 1 mM PMSF, 0.1 mM pepstatin, 50 mM sodium acetate (pH 5), and 20 mU neuraminidase (EC 3.2.1.18; Seikagaku). The solution was then incubated at 37°C for 120 minutes. The same volume of a solution containing 5 mM EDTA, 5 mM NEM, 1 mM PMSF, 0.1 mM pepstatin, 15 mM sodium acetate, and 50 mM Tris-HCl (pH 7.4) was added to the sample solution, after which the mixture was incubated at 37°C for an additional 120 minutes in the presence of 40 mU keratanase (EC 3.2.1.103; Seikagaku). Proteins were precipitated from the mixture with ethanol and denatured by boiling for 2 minutes in 13 µl of a solution containing 1% SDS and 10 mM sodium phosphate (pH 7.2). The sample solution was diluted with 137 µl of a solution containing 1% N-octyl-ß-D-glucoside (Wako, Osaka, Japan), 5 mM EDTA, 5 mM NEM, 1 mM PMSF, 0.1 mM pepstatin, 10 mM sodium phosphate (pH 7.2), 5 mU O-glycanase (EC 3.2.1.97; Boehringer Mannheim, Tokyo, Japan), and/or 5 U N-glycanase (EC 3.2.2.18; Boehringer Mannheim), and the reaction mixture was incubated at 37°C overnight. The samples treated with glycosidases were subjected to immunoblot analysis.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Spatiotemporal Expression of NGC during Retinal Development
The spatial expression of NGC during retinal development (from E16 to P42) was studied by immunohistochemistry using the anti-NGC polyclonal antibody. NGC immunoreactivities were faint at E16, when only homogeneous retinal (neuroblast) cells were present throughout the retina (Fig. 1) , including retinal pigment epithelium (RPE). At birth (P0), as the ganglion cell layer (GCL) and inner plexiform layer (IPL) formed, immunoreactivities were present in the inner layers, including the nerve fiber layer (NFL), GCL, and IPL. Moreover, the RPE was stained at the same stage. At P7, as the NFL and IPL became well differentiated, immunoreactivities in the NFL and IPL became intense. At P14, as the outer layers, such as the outer nuclear layer (ONL) and the layer of rods and cones became differentiated, the area of outer segments (OS) of the photoreceptor cells as well as the RPE became stained intensely, whereas immunoreactivities in the inner layers became gradually fainter. As retinal layer differentiation proceeded (from P21 to P42), the immunoreactivities in the inner retinal layers became gradually fainter. Of interest, the GCL was less stained than the NFL and the IPL. Between P21 and P42, the OS and RPE remained stained, whereas immunoreactivity in the NFL and IPL were reduced. The other retinal layers were barely stained throughout development.



View larger version (113K):
[in this window]
[in a new window]
 
Figure 1. Immunohistochemistryfor NGC during retinal development. NGC immunoreactivity was faint at E16 when homogeneous retinal (neuroblast) cells were present throughout the retina, including the RPE. Approximately at birth (P0), immunoreactivities were present in the inner layers, including the NFL, GCL, and IPL. Moreover, the RPE was also stained at the same stage. At P7, immunoreactivities in the NFL and IPL became more intense. Between P14 and P42, the photoreceptor cells OS became stained intensely, whereas immunoreactivities in the inner layers gradually became faint. In adult rat retina (P42), the RPE and OS were still stained intensely, whereas the NFL and IPL were weakly stained; the other retinal layers were barely stained. ONL, outer nuclear layer. Scale bar, 50 µm.

 
NGC in Membranes of Axons and RPE Cells
Immunoelectron microscopy revealed that NGC immunoreactivity was located on the axonal membranes of retinal ganglion cells in the NFL at P7 (Fig. 2A ). In contrast, the immunoreactivity was reduced on the membranes at the adult stage (P42; Fig. 2B ). Moreover, the membranes of neuronal processes in the IPL at P7 were highly immunopositive (Fig. 2C) , whereas those at P42 were only faintly positive (Fig. 2D) . On the basal infoldings of the basal surface of RPE cells, intense NGC immunoreactivity was found at P7 (Fig. 2E) as well as at P42. However, the apical membranes of RPE cells showed no NGC immunoreactivities at P7. On the other hand, intense NGC immunoreactivities were found on the apical membranes of RPE cells at P42 (Fig. 2F) . Of note, microvilli on the apical membrane were also stained, whereas the cell membranes of outer segments of photoreceptor cells were barely stained (Fig. 2G) , which indicates that the DAB-stained immunoreactivities around the outer segments in the light microscopic study represented microvilli of RPE cells.



View larger version (190K):
[in this window]
[in a new window]
 
Figure 2. Localization of NGC in the NFL, IPL, and RPE of P7 and P42 rats. (A) NFL of P7 rat. NGC immunoreactivity (large arrows) was located on the axonal membranes of retinal ganglion cells. NF, axonal nerve fiber of retinal ganglion cells. (B) NFL at adult stages (P42). Immunoreactivity was reduced on the axonal membranes. (C) IPL at P7. The membrane of neuronal processes in the IPL was highly immunopositive (large arrowheads). NP, neuronal process. (D) IPL at P42. The immunoreactivity (large arrowheads) was faint on the membrane. (E) RPE at P7. NGC (small arrows) was localized on the basal infoldings on the surface of RPE cells. RP, retinal pigment epithelial cells; BI, basal infoldings; BM, Bruch’s membrane. (F, G) Apical surface of the RPE at P42. NGC (small arrowheads) was localized on the apical membrane, including microvilli. MV, microvilli of RPE. Scale bar: (A through D), 200 nm; (E, F, and G), 500 nm.

 
NGC in Budding Neurites of Retinal Ganglion Cells In Vitro
As described previously,29 retinal ganglion cells extended their neurites for 3 days after seeding in the serum-free medium supplemented with neurotrophic factors (CNTF and BDNF) and forskolin. The next day, after selective culture of retinal ganglion cells, the cells had only short neurites. NGC immunoreactivities were found on the surfaces of the soma and short extending neurites (Fig. 3) . At 3 and 7 days, long neurites (more than 50 µm) were expressed from the cell bodies, and many short, spine-like divergent neurites extended from the long neurites. NGC immunoreactivities were intense on the budding (short extending) neurites, whereas the long neurites were more lightly stained. Moreover, the short neurites budding directly from the soma were also stained intensely.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 3. NGC localization of cultivated retinal ganglion cells. (A) Retinal ganglion cells at 1 day after seeding. When the cells (arrows) had short neurites only, surfaces of the cell bodies and the short neurites were immunopositive. (B) Cells at 3 days in vitro. NGC immunoreactivities were intense on the budding neurites (arrowheads), whereas the long neurites were more lightly stained. The short neurites budding directly from the cell bodies were also stained intensely. Scale bar, 50 µm.

 
Increased Expression of NGC mRNA in Postnatal Rat Retina
Because detection of a positive band of mRNA expression for NGC requires a large amount (more than 100 µg of brain total RNA) of neural tissue,20 it is difficult to evaluate relative levels of mRNA expression in rat retina during development. Thus, we used semiquantitative RT-PCR techniques for that purpose, as described previously.18 26 RT-PCR using primers specific for NGC showed that cDNA fragments of the expected length (380 bp) were amplified in experiments using rat retinal cDNAs. Southern blot analysis using the internal probe showed that the amplified PCR products of the expected length were hybridized with internal probes, indicating that they were derived from the expected sequence of the NGC core protein gene. To quantify relative levels of mRNA expression of NGC core protein gene during retinal development, we performed semiquantitative RT-PCR experiments and subsequent Southern blot analysis after normalization to ß-actin (Fig. 4) . The semiquantitative analyses demonstrated that the peak of gene expression for NGC was at P7. At E16, the expression was 4.5% ± 1.6% of the maximum at P7 (defined as 100%). At early postnatal stages (P0), the expression increased intensely, reaching a peak at P7 and then decreasing gradually. At the adult stage (P42), the expression was 35.8% ± 7.3% of the peak level at P7.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. Representative PCR experiments and Southern blot analyses of NGC gene expression during retinal development. cDNA concentration was normalized to ß-actin gene expression. After normalization to ß-actin, PCR was performed using the NGC primers. PCR products of the expected length (380 bp) were amplified, and Southern blot analysis with the internal probe showed that the amplified PCR products were hybridized with the internal probes. The intensities of the hybridized bands, using an internal oligonucleotide, peaked on P7 (n = 3). Error bar, SE.

 
Temporal Expression of NGC Core Protein in Developing Retina
To examine temporal alterations in the expression of NGC in developing retina, retinal homogenates (each 50 µg of protein) at various developmental stages from E16 to P42 were treated with chondroitinase ABC, and then subjected to immunoblot analysis (Fig. 5A ). At E16, NGC-immunopositive bands were barely detectable by immunoblot analysis. At approximately the time of birth (between E18 and P3), the intensity of the 120-kDa immunopositive band increased gradually, then increased rapidly at P7, and reached the peak level at P14, after which, the intensity decreased gradually. Intensities of the immunopositive bands were semiquantified by using a densitometric analysis, and relative levels were calculated as the percentage of the mean level at the peak (P14; Fig. 5B ). The mean level (± SE) at E16 was 1.5% ± 0.8% of the peak intensity at P14 (defined as 100%) and then increased gradually. The level at P3 was 34.0% ± 5.3%, increased rapidly, and was near the peak level (94.5% ± 5.4%) at P7. After the peak at P14, the intensity gradually decreased to 32.5% ± 5.7% at P42.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. Immunoblot analysis for NGC during retinal development. (A) Representative immunoblot analysis using retinal homogenates from E16 to P42 treated with chondroitinase ABC. Intensity of the 120-kDa immunopositive band increased gradually as retinal development proceeded (between E16 and P14), and then the intensity decreased after P14. Of note, the immunopositive bands were detectable as higher molecular mass (130 kDa) after P21. The positions of molecular mass markers are indicated in kilodaltons. (B) Densitometric analysis of intensities of immunopositive bands. The relative levels were calculated as the percentage of the mean levels at peak (P14; n = 3). Error bar, SE.

 
Unexpectedly, and as shown by SDS-PAGE, the immunopositive bands were of higher molecular mass (130 kDa) at late postnatal stages (between P21 and P42), indicating that the electromobility of the NGC after the digestion by chondroitinase ABC at late postnatal stages was different from that at embryonal and early postnatal stages.

NGC without Chondroitin Sulfate Side Chains in Adult Rat Retinal Tissues
To investigate characteristics of GAG side chains of NGC, we performed immunoblot analyses with and without the treatment with chondroitinase ABC (Fig. 6) . In homogenates from P3 (Fig. 6 ; lane 2), P7 (lane 4), and P14 (lane 6) retinas, without the digestion by chondroitinase ABC, diffuse bands were detected at approximately 150 kDa, demonstrating the same results as cerebral homogenates (P42) without digestion by chondroitinase ABC (lane 10). Additional faint bands of 120 kDa were also detectable at these developmental stages. After digestion by chondroitinase ABC (lanes 1, 3, and 5), the 120-kDa bands were more intense, indicating that most NGC during early postnatal stages bear chondroitin sulfate chains. The molecular mass of the NGC-immunopositive band after digestion by chondroitinase ABC (120 kDa) was equal to that of the band of cerebral homogenates (P42) after digestion by chondroitinase ABC (lane 9). In addition, the molecular mass of the immunopositive band in homogenate of P42 retinas was not affected by treatment with chondroitinase ABC (lanes 7 and 8), which indicates that NGC expressed in adult rat retina (P42) has no chondroitin sulfate chains.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 6. Immunoblot analysis using the retinal homogenates at various developmental stages treated with (+) or without (-) chondroitinase ABC (CHase ABC). In homogenates from P3 (lane 2), P7 (lane 4), and P14 (lane 6) retinas and P42 cerebrum (lane 10), diffuse bands were detected at approximately 150 kDa, without digestion by chondroitinase ABC. Additional faint 120-kDa bands were detectable in homogenates of P3 (lane 2), P7 (lane 4), and P14 (lane 6) retinas. After digestion by chondroitinase ABC (lane 1, P3; lane 3, P7; lane 5, P14), the 120-kDa bands were shown intensely. A band with a molecular mass higher than those in the other retinal and cerebral homogenates (lane 9) was detected in homogenates of P42 retina, with (lane 7) as well as without (lane 8) digestion by chondroitinase ABC. The applied protein volumes in lanes 1, 2, 7, and 8 were twice as much as those in lanes 3, 4, 5, and 6, and 9 and 10. Lanes 1 and 2, P3; lanes 3 and 4, P7; lanes 5 and 6, P14; lanes 7 and 8, P42; lanes 9 and 10, cerebral tissues (P42). The positions of the molecular mass markers are indicated in kilodaltons.

 
Changed Oligosaccharides of NGC Core Proteins during Retinal Development
To investigate the above-mentioned alteration in molecular mass (from 120 kDa to 130 kDa) in NGC core proteins during development, we conducted additional immunoblot analyses using treatments with glycosidases. We purified the membrane-bound protein fractions from retinal tissues as described so that glycosidases could react with the oligosaccharides linked to the NGC core protein. After digestion by chondroitinase ABC, the immunopositive bands from the membrane-bound protein fractions from P14 (Fig. 7 ; lane 1a) and P42 (lane 1b) retinas were detected at 120 kDa and 130 kDa, respectively, similar to results using retinal homogenates. Subsequent neuraminidase treatment of the chondroitinase ABC-digested membrane-bound fractions from P14 (lane 2a) and P42 (lane 2b) resulted in increased mobility of the immunopositive band on SDS-PAGE. Subsequent digestion with keratanase did not affect the mobilities at either P14 (lane 3a) or P42 (lane 3b). Although additional digestion by O-glycanase did not increase the mobilities (lanes 4a and 4b), N-glycanase digestion increased (lanes 5a and 5b) mobility of the immunopositive band. Finally, after subsequent digestions with these glycosidases, the molecular mass of the immunopositive band of P42 retinas became 100 kDa (lane 6b), which was equal to that of P14 retinas (lane 6a). Taken together, these results show that NGC in adult (P42) rat retinal tissues does not have chondroitin sulfate side chains but contains more oligosaccharides than that in earlier postnatal stages (P14).



View larger version (61K):
[in this window]
[in a new window]
 
Figure 7. Effects of glycosidase digestion on the electrophoretic mobility of the immunopositive bands in membrane-bound protein fractions. The P14 (lanes marked a) and P42 (lanes marked b) retinal membrane-bound protein fractions were digested sequentially with chondroitinase ABC (lanes 1a and 1b), neuraminidase (lanes 2a and 2b), keratanase (lanes 3a and 3b), O-glycanase (lanes 4a and 4b), and N-glycanase (lanes 5a and 5b). Some samples were digested sequentially with chondroitinase ABC, neuraminidase, keratanase, and a mixture of O-glycanase and N-glycanase (lanes 6a and 6b). Finally, after subsequent digestion with these glycosidases, the molecular mass of the immunopositive band from P42 retinas became 100 kDa (lane 6b), which was equal to that from P14 retinas (lane 6a). The applied protein volumes in lanes 1a through 6a were one third those applied to lanes 1b through 6b. The positions of molecular mass markers are indicated in kilodaltons.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In our immunohistochemical studies, NGC was highly expressed in developing rat retina. In particular, at early postnatal stages (between P0 and P14), when active dendrite branching and conventional synapses between amacrine cells and ganglion cells are observed in the inner retinal layers,34 35 36 intense NGC immunoreactivities were found in the NFL and IPL, which are rich in neural axons. Moreover, our immunoelectron microscopy showed that, in the developing retinal inner layers, NGC was immunolocalized on axons of neuronal cells, including ganglion cells, which is supported by results of the immunohistochemical studies using retinal ganglion cells in culture. At late postnatal and adult stages (between P14 and P42), when synapse formation and dendrite branching are almost complete in the inner layers of the retina,36 immunoreactivities decrease. In our immunoelectron study, expression of NGC on the cell membranes of axons was reduced at these stages. The temporal expression of NGC on cell membranes of neuronal cells, in particular axon-rich layers, suggests that NGC may be involved in neural network formation in rat retinas.

Recently, a transmembrane proteoglycan with a domain structure similar to that of NGC was identified in the developing chicken central nervous system.37 This molecule is termed chicken acidic leucine-rich epidermal growth factor (EGF)–like domain containing brain protein (CALEB). CALEB is restricted to the developing and adult nervous system and is localized on neuronal and glial surfaces in the cerebellum and retina. Because of high homology of sequences of the characteristic domains (except for the chondroitin sulfate-attachment domain) between NGC and CALEB, they may form a new proteoglycan family of the central nervous system. Furthermore, antibodies to CALEB interfere with neurite formation of embryonal tectal cells.37 Our present results from immunohistochemical studies on cultivated retinal ganglion cells showed that NGC is highly immunolocalized on the spiny branchlets budding from neurites, as well as on the short neurites budding directly from soma, which implies a similar role of NGC as shown in CALEB for neurite extension.

Additionally, based on results of our immunoelectron microscopic studies, NGC was also expressed on the cell membranes of RPE cells. At the early postnatal stage (P7), NGC was localized on basal infoldings of RPE cells. It was not present on the apical surfaces of RPE cells at this early postnatal stage, when the constituents of the apical surfaces remain obscure. In adult retina (P42), the microvilli are formed on the apical surfaces, and the outer segments of photoreceptor cells have been completely differentiated. At this stage, NGC was expressed on the apical surfaces, including microvilli, of RPE cells. Because RPE cells originate from the same optic vesicle as do retinal neuronal cells,38 and can transdifferentiate to neural retina in culture in the presence of basic fibroblast growth factor,39 the significance of NGC localization on basal infoldings and microvilli may be similar to that on budding neurites of retinal ganglion cells. Immunoreactivities in the RPE remain strong even though the retinal layer formation has been completed. The rod tips of photoreceptor cells are phagocytosed by RPE cells even in adult retina, and this plays a crucial role in maintenance of the visual perception system.40 Because the cell membranes of microvilli and basal infoldings of RPE cells are associated with phagocytosis even in adult rat retina, constitutive expression of NGC in RPE cells, but not in neuronal cells, may be necessary to regulate cellular behavior of RPE cells.

Although Northern blot analysis is typically used to identify mRNA expression, the elucidation of mRNA expression for NGC requires a large amount (more than 100 µg) of total RNA because of its low expression, even at the maximal expression stage during brain development. In our present studies, however, we attempted to elucidate relative levels of mRNA expression for NGC from the minimal to maximal expression stages, and thus used semiquantitative RT-PCR techniques. Our semiquantitative RT-PCR experiments demonstrated that gene expression of the NGC core protein increased rapidly as retinal development proceeded, reached a peak level at P7, and then decreased gradually. The result of immunoblot analysis also showed that large amounts of NGC core protein were found at P7, although the peak amount was at P14, which is supported by our results from the RT-PCR experiments as well as immunohistochemical studies. Thus, our results show that mRNA and protein expressions of NGC were abundant during early postnatal stages, the time at which the neural network is formed.

Another point we should note is that chondroitin sulfate chains are no longer present in NGC core protein after P21. Some proteoglycans are expressed as nonproteoglycan forms (this nomenclature indicates proteoglycans without any GAG side chains) in certain situations.41 42 43 44 45 46 In mouse cerebellum, the core protein of NGC also shifts from the proteoglycan form to the nonproteoglycan form during development.22 Moreover, our immunoblot analyses revealed that characteristics of GAG side chains linked to retinal NGC also alter. Chondroitinase ABC treatments resulted in different molecular masses between retinas on P14 (120 kDa) and P42 (130 kDa), which suggested the difference of other modification (including oligosaccharides) of core proteins than GAG side chains. This hypothesis was supported by our results from immunoblot experiments after the digestion of a series of glycosidases. Each final molecular of core protein is 100 kDa in rat retinas on P14 and P42. Thus, we conclude that retinal NGC contains oligosaccharides that alter in molecular characteristics during retinal development and are linked to core proteins.

In summary, in our immunohistochemical and immunoelectron studies expression of NGC was spatiotemporally regulated in developing retina, and the immunoreactivities were found in short extending neurites of retinal ganglion cells in culture, suggesting a role in the formation of the retinal neural network. Furthermore, in our biochemical studies, glycosylation of NGC underwent changes during retinal development indicating that it could exist as either a glycoprotein or as a proteoglycan.


    Footnotes
 
Supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture, Japan.

Submitted for publication June 2, 2000; revised August 3, 2000; accepted August 17, 2000.

Commercial relationships policy: N.

Corresponding author: Hidenobu Tanihara, Department of Ophthalmology, Tenri Hospital, 200 Mishima-cho, Tenri, Nara 632-8552, Japan. tanihara{at}pearl.ocn.ne.jp


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lindahl, U, Höök, M. (1978) Glycosaminoglycans and their binding to biological macromolecules Annu Rev Biochem 47,385-417[Medline][Order article via Infotrieve]
  2. Ruoslahti, E. (1988) Structure and biology of proteoglycan Annu Rev Cell Biol 4,229-255
  3. Iozzo, RV (1998) Matrix proteoglycans: from molecular design to cellular function Annu Rev Biochem 67,609-652[Medline][Order article via Infotrieve]
  4. Herndon, ME, Lander, AD (1990) A diverse set of developmentally regulated proteoglycans is expressed in the rat central nervous system Neuron 4,949-961[Medline][Order article via Infotrieve]
  5. Oohira, A, Katoh–Semba, R, Watanabe, E, Matsui, F. (1994) Brain development and multiple molecular species of proteoglycan Neurosci Res 20,195-207[Medline][Order article via Infotrieve]
  6. Margolis, RK, Rauch, U, Maurel, P, Margolis, RU (1995) Neurocan and phosphacan: two major nervous tissue-specific chondroitin sulfate proteoglycans Perspect Dev Neurobiol 3,273-290
  7. Milev, P, Friedlander, DR, Sakurai, T, et al (1994) Interactions of the chondroitin sulfate proteoglycan phosphacan, the extracellular domain of a receptor-type protein tyrosine phosphatase, with neurons, glia, and neural cell adhesion molecules J Cell Biol 127,1703-1715[Abstract/Free Full Text]
  8. Friedlander, DR, Milev, P, Karthikeyan, L, Margolis, RK, Margolis, RU, Grumet, M. (1994) The neuronal chondroitin sulfate proteoglycan neurocan binds to the neural cell adhesion molecules Ng-CAM/L1/NILE and N-CAM, and inhibits neuronal adhesion and neurite outgrowth J Cell Biol 125,669-680[Abstract/Free Full Text]
  9. Maeda, N, Noda, M. (1996) 6B4 proteoglycan/phosphacan is a repulsive substratum but promotes morphological differentiation of cortical neurons Development 122,647-658[Abstract]
  10. Small, DH, Mok, SS, Williamson, TG, Nurcombe, V. (1996) Role of proteoglycans in neural development, regeneration, and the aging brain J Neurochem 67,889-899[Medline][Order article via Infotrieve]
  11. Kappler, J, Stichel, CC, Gleichmann, M, et al (1998) Developmental regulation of decorin expression in postnatal rat brain Brain Res 18,328-332
  12. Margolis, RU, Margolis, RK (1997) Chondroitin sulfate proteoglycans as mediators of axon growth and pathfinding Cell Tissue Res 290,343-348[Medline][Order article via Infotrieve]
  13. Rauch, U. (1997) Modeling an extracellular environment for axonal pathfinding and fasciculation in the central nervous system Cell Tissue Res 290,349-356[Medline][Order article via Infotrieve]
  14. Powell, EM, Fawcett, JW, Geller, HM (1997) Proteoglycans provide neurite guidance at an astrocyte boundary Mol Cell Neurosci 10,27-42
  15. Fidler, PS, Schuette, K, Asher, RA, et al (1999) Comparing astrocytic cell lines that are inhibitory or permissive for axon growth: the major axon-inhibitory proteoglycan is NG2 J Neurosci 15,8778-8788
  16. Garwood, J, Schnadelbach, O, Clement, A, Schutte, K, Bach, A, Faissner, A. (1999) DSD-1-proteoglycan is the mouse homolog of phosphacan and displays opposing effects on neurite outgrowth dependent on neuronal lineage J Neurosci 19,3888-3899[Abstract/Free Full Text]
  17. Oohira, A, Matsui, F, Tokita, Y, Yamauchi, S, Aono, S. (2000) Molecular interactions of neural chondroitin sulfate proteoglycans in the brain development Arch Biochem Biophys 374,24-34[Medline][Order article via Infotrieve]
  18. Inatani, M, Tanihara, H, Oohira, A, Honjo, M, Honda, Y. (1999) Identification of a nervous tissue-specific chondroitin sulfate proteoglycan, neurocan, in developing rat retina Invest Ophthalmol Vis Sci 40,2350-2359[Abstract/Free Full Text]
  19. Inatani, M, Tanihara, H, Oohira, A, Honjo, M, Kido, N, Honda, Y. (2000) Spatiotemporal expression patterns of 6B4 proteoglycan/phosphacan in the developing rat retina Invest Ophthalmol Vis Sci 41,1990-1997[Abstract/Free Full Text]
  20. Watanabe, E, Maeda, N, Matsui, F, et al (1995) Neuroglycan C, a novel membrane-spanning chondroitin sulfate proteoglycan that is restricted to the brain J Biol Chem 270,26876-26882[Abstract/Free Full Text]
  21. Yasuda, Y, Tokita, Y, Aono, S, et al (1998) Cloning and chromosomal mapping of the human gene of neuroglycan C (NGC), a neural transmembrane chondroitin sulfate proteoglycan with an EGF module Neurosci Res 32,313-322[Medline][Order article via Infotrieve]
  22. Aono, S, Keino, H, Ono, T, et al (2000) Genomic organization and expression pattern of mouse neuroglycan C in the cerebellar development J Biol Chem 275,337-342[Abstract/Free Full Text]
  23. Dou, CL, Levine, JM (1994) Inhibition of neurite growth by the NG2 chondroitin sulfate proteoglycan J Neurosci 14,7616-7628[Abstract]
  24. Ethell, IM, Yamaguchi, Y. (1999) Cell surface heparan sulfate proteoglycan syndecan-2 induces the maturation of dendritic spines in rat hippocampal neurons J Cell Biol 144,575-586[Abstract/Free Full Text]
  25. Kinnunen, A, Niemi, M, Kinnunen, T, Kaksonen, M, Nolo, R, Rauvala, H. (1999) Heparan sulphate and HB-GAM (heparin-binding growth-associated molecule) in the development of the thalamocortical pathway of rat brain Eur J Neurosci 11,491-502[Medline][Order article via Infotrieve]
  26. Inatani, M, Tanihara, H, Honjo, M, Hangai, M, Kresse, H, Honda, Y. (1999) Expression of proteoglycan decorin in neural retina Invest Ophthalmol Vis Sci 40,1783-1791[Abstract/Free Full Text]
  27. Mizoguchi, A, Yano, Y, Hamaguchi, H, et al (1994) Localization of rabphilin-3A on the synaptic vesicle Biochem Biophys Res Commun 202,1235-1243[Medline][Order article via Infotrieve]
  28. Barres, BA, Silverstein, BE, Corey, DP, Chun, LL (1988) Immunological, morphological, and electrophysiological variation among retinal ganglion cells purified by panning Neuron 1,791-803[Medline][Order article via Infotrieve]
  29. Otori, Y, Wei, JY, Barnstable, CJ (1998) Neurotoxic effects of low doses of glutamate on purified rat retinal ganglion cells Invest Ophthalmol Vis Sci 39,972-981[Abstract/Free Full Text]
  30. Nudel, U, Zakut, R, Shani, M, Neuman, S, Levy, Z, Yaffe, D. (1983) The nucleotide sequence of the rat cytoplasmic ß-actin gene Nucleic Acids Res 11,1759-1771[Abstract/Free Full Text]
  31. Oohira, A, Matsui, F, Matsuda, M, Takida, Y, Kuboki, Y. (1988) Occurrence of three distinct molecular species of chondroitin sulfate proteoglycan in the developing rat brain J Biol Chem 263,10240-10246[Abstract/Free Full Text]
  32. Maeda, N, Hamanaka, H, Shintani, T, Nishiwaki, T, Noda, M. (1994) Multiple receptor-like protein tyrosine phosphatases in the form of chondroitin sulfate proteoglycan FEBS Lett 354,67-70[Medline][Order article via Infotrieve]
  33. Maeda, N, Hamanaka, H, Oohira, A, Noda, M. (1995) Purification, characterization and developmental expression of a brain-specific chondroitin sulfate proteoglycan, 6B4 proteoglycan/phosphacan Neuroscience 67,23-35[Medline][Order article via Infotrieve]
  34. Weidman, TA, Kuwabara, T. (1968) Postnatal development of the rat retina. An electron microscopic study Arch Ophthalmol 79,470-484[Abstract/Free Full Text]
  35. Weidman, TA, Kuwabara, T. (1969) Development of the rat retina Invest Ophthalmol 8,60-69[Free Full Text]
  36. Maslim, J, Webster, M, Stone, J. (1986) Stages in the structural differentiation of retinal ganglion cells J Comp Neurol 254,382-402[Medline][Order article via Infotrieve]
  37. Schumacher, S, Volkmer, H, Buck, F, et al (1997) Chicken acidic leucine-rich EGF-like domain containing brain protein (CALEB), a neural member of the EGF family of differentiation factors, is implicated in neurite formation J Cell Biol 136,895-906[Abstract/Free Full Text]
  38. Morse, DE, McCann, PS (1984) Neuroectoderm of the early embryonic rat eye. Scanning electron microscopy Invest Ophthalmol Vis Sci 25,899-907[Abstract/Free Full Text]
  39. Zhao, S, Thornquist, SC, Barnstable, CJ (1995) In vitro transdifferentiation of embryonic rat retinal pigment epithelium to neural retina Brain Res 677,300-310[Medline][Order article via Infotrieve]
  40. Young, RW, Bok, D. (1969) Participation of the retinal pigment epithelium in the rod outer segment renewal process J Cell Biol 42,392-403[Abstract/Free Full Text]
  41. Lin, JH, McLean, K, Morser, J, et al (1994) Modulation of glycosaminoglycan addition in naturally expressed and recombinant human thrombomodulin J Biol Chem 269,25021-25030[Abstract/Free Full Text]
  42. Yamada, H, Watanabe, K, Shimonaka, M, Yamaguchi, Y. (1994) Molecular cloning of brevican, a novel brain proteoglycan of the aggrecan/versican family J Biol Chem 269,10119-10126[Abstract/Free Full Text]
  43. Pangalos, MN, Efthimiopoulos, S, Shioi, J, Robakis, NK (1995) The chondroitin sulfate attachment site of appican is formed by splicing out exon 15 of the amyloid precursor gene J Biol Chem 270,10388-10391[Abstract/Free Full Text]
  44. Oohira, A, Kushima, Y, Matsui, F, Watanabe, E. (1995) Detection of Alzheimer’s ß-amyloid precursor related proteins bearing chondroitin sulfate both in the juvenile rat brain and in the conditioned medium of primary cultured astrocytes Neurosci Lett 189,25-28[Medline][Order article via Infotrieve]
  45. Acharya, S, Rodriguez, IR, Moreira, EF, et al (1998) SPACR, a novel interphotoreceptor matrix glycoprotein in human retina that interacts with hyaluronan J Biol Chem 273,31599-31606[Abstract/Free Full Text]
  46. Fransson, LÅ (1987) Structure and function of cell-associated proteoglycans Trends Biochem Sci 12,406-411



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. Nakanishi, S. Aono, K. Hirano, Y. Kuroda, M. Ida, Y. Tokita, F. Matsui, and A. Oohira
Identification of Neurite Outgrowth-promoting Domains of Neuroglycan C, a Brain-specific Chondroitin Sulfate Proteoglycan, and Involvement of Phosphatidylinositol 3-Kinase and Protein Kinase C Signaling Pathways in Neuritogenesis
J. Biol. Chem., August 25, 2006; 281(34): 24970 - 24978.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Inoue, M. Yoneda, J. Zhao, O. Miyaishi, A. Ohno-Jinno, T. Kataoka, Z. Isogai, K. Kimata, M. Iwaki, and M. Zako
Molecular Cloning and Characterization of Chick SPACRCAN
J. Biol. Chem., April 14, 2006; 281(15): 10381 - 10388.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Aono, Y. Tokita, T. Shuo, S. Yamauchi, F. Matsui, K. Nakanishi, K. Hirano, M. Sano, and A. Oohira
Glycosylation Site for Chondroitin Sulfate on the Neural Part-time Proteoglycan, Neuroglycan C
J. Biol. Chem., November 5, 2004; 279(45): 46536 - 46541.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
V. L. Bonilha, S. K. Bhattacharya, K. A. West, J. Sun, J. W. Crabb, M. E. Rayborn, and J. G. Hollyfield
Proteomic Characterization of Isolated Retinal Pigment Epithelium Microvilli
Mol. Cell. Proteomics, November 1, 2004; 3(11): 1119 - 1127.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Hassel, M. Schreff, E.-M. Stube, U. Blaich, and S. Schumacher
CALEB/NGC Interacts with the Golgi-associated Protein PIST
J. Biol. Chem., October 10, 2003; 278(41): 40136 - 40143.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Y. Zhang, U. Rauch, and M.-T. R. Perez
Accumulation of Neurocan, a Brain Chondroitin Sulfate Proteoglycan, in Association with the Retinal Vasculature in RCS Rats
Invest. Ophthalmol. Vis. Sci., March 1, 2003; 44(3): 1252 - 1261.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. Inatani, M. Honjo, A. Oohira, N. Kido, Y. Otori, Y. Tano, Y. Honda, and H. Tanihara
Spatiotemporal Expression Patterns of N-Syndecan, a Transmembrane Heparan Sulfate Proteoglycan, in Developing Retina
Invest. Ophthalmol. Vis. Sci., May 1, 2002; 43(5): 1616 - 1621.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Inatani, M.
Right arrow Articles by Honda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Inatani, M.
Right arrow Articles by Honda, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS