|
|
||||||||
1 From the Dr. A. Q. Khan Research Laboratories, Biomedical and Genetic Engineering Division, Islamabad, Pakistan; and the 2 Department of Molecular Genetics, Institute of Ophthalmology, University College London, United Kingdom.
| Abstract |
|---|
|
|
|---|
METHODS. Genomic DNA was amplified across the polymorphic microsatellite poly-CA regions identified by markers. Polymerase chain reaction (PCR) products were separated by nondenaturing polyacrylamide gel electrophoresis. Alleles were assigned to individuals, which allowed calculation of LOD scores using the Cyrillic and MLINK software program. The retinal guanylate cyclase (RETGC-1, GDB symbol GUC2D) and pigment epithelium-derived factor (PEDF) genes were analyzed by heteroduplex analysis and direct sequencing for mutations in diseased individuals.
RESULTS. Based on a whole genome linkage analysis the first locus for this combined phenotype has been mapped to chromosome 17p13. Linkage analysis gave a two point LOD score of 3.21 for marker D17S829. Surrounding this marker is a region of homozygosity of 15.77 cM, between the markers D17S1866 and D17S960; however, the crossover for the marker D17S1529 refines the region to 10.77 cM within which the disease gene is predicted to lie. Mutation screening of the nearby RETGC-1 gene, which has been shown to be associated with LCA1, revealed no mutations in the affected individuals of this family. Similarly, another prime candidate in the region PEDF was also screened for mutations. The factor has been shown to be involved in the photoreceptor differentiation and neuronal survival. No mutations were found in this gene either. Furthermore, RETGC-1 was physically excluded from the critical disease region based on the existing physical map.
CONCLUSIONS. It is therefore suggested that this combined phenotype maps to a new locus and is due to an as yet uncharacterized gene within the 17p13 chromosomal region.
| Introduction |
|---|
|
|
|---|
Anterior keratoconus is a bilateral noninflammatory progressive corneal ectasia with an incidence of between 50 and 230 per 100,000 in the general population, dependent on the clinical detection method used and diagnostic criteria applied.7 8 There are a number of well-described clinical signs, including stromal thinning, conical protrusion, a ring-like deposition of iron around the base of the cone (Fleischers ring), fine vertical lines in the deep stroma and Descemets membrane (Vogts striae), anterior stromal scarring, and enlarged corneal nerves. Gross alterations in the corneal curvature can be detected by retroillumination techniques; however, early or mild forms of the disease may go undetected unless the anterior corneal topography is studied with computer-assisted videokeratography. The disease is rarely congenital but usually appears at puberty, and although one eye may be affected first, the condition is always eventually bilateral. Corneal distortion and scaring lead to irregular astigmatism, myopia, and mild-to-marked impairment of vision. The occurrence of breaks in Descemets membrane can lead to acute hydrops, swelling of the adjacent cornea due to localized edema, and acute ectasia, resulting in a sudden marked decrease in visual acuity. Electron microscopy suggests that the earliest histopathologic changes may occur in the corneal epithelium. The basal cells appear to degenerate and release proteolytic enzymes that destroy underlying stromal tissue. Stromal keratocytes near the cone also show degenerative changes, as does the endothelium, the latter leading to localized overproduction of Descemets membrane.9 10
Keratoconus is most commonly an isolated disorder, although it has been described in association with a large number of ocular and systemic disorders, and there is an established association with Downs syndrome, mitral valve prolapse, and LCA.9 10 The study of families of keratoconus patients provides evidence for a genetic role in the etiology of keratoconus.8 Although there is an established association between Downs syndrome and keratoconus, the karyogram of the patients of this family did not have trisomy 21. In the family presented the keratoconus is associated with LCA.
Here we provide data supporting the first genetic linkage of LCA with keratoconus to chromosome 17p13.1. RETGC-1 gene has been physically mapped in this region and is known to be associated with LCA1 therefore; it was the possible candidate for this phenotype. RETGC-1 is predominantly found in the cone outer segments of the retina, suggesting that the high RETGC-1 activity in cones may be responsible for the rapid recovery of cGMP concentration to the dark level.11 Although RETGC-1 maps just outside our critical region, mutation screening for this gene was done to exclude the possibility of this gene being responsible for this phenotype.
The pigment epithelium-derived factor (PEDF) gene has also been mapped to the short arm of chromosome 17, distal to the recoverin gene locus and very close to the RP13 locus in a large South African family.12 PEDF, a 50-kDa protein secreted by human fetal retinal pigment epithelial cells, is a neurotrophic factor that may aid the development, differentiation, and survival of the adjacent neural retina. The wider distribution of PEDF mRNA in the central nervous system suggests that this factor could have pleotrophic, neurotrophic, and neuroprotective effects on nonretinal neurons as well.13 The gene for PEDF is highly expressed by both fetal human and young adult retinal pigment epithelium cells. No mutation has yet been reported in PEDF gene in any of the eye disorder except few polymorphic variations.14 However, because this gene lies within our critical region, mutation screening for this gene has also been carried out.
| Methods |
|---|
|
|
|---|
|
|
Microsatellite and Linkage Analysis
Genomic DNA was amplified using primers that specifically amplify
the polymorphic microsatellite poly-CA regions identified by markers.
PCR products were separated by nondenaturing polyacrylamide gel
electrophoresis (Protogel; National Diagnostics) and visualized under
UV illumination after staining with ethidium bromide. Alleles were
assigned to individuals, and genotypic data were used to calculate the
LOD scores using the Cyrillic and MLINK software program
(Cherwell Scientific Publishing Ltd, Oxford, UK). Allele frequencies
were calculated from the spouses in this family and a control
ethnically matched population. The phenotype was analyzed as an
autosomal recessive trait, with complete penetrance, and a frequency of
0.0001 for the affected allele.
Mutation Screening
The 18 exons of RETGC-1, which are expressed as
protein, were amplified using the intronic primers and annealing
temperatures essentially as described by Perrault et al.2
The exceptions were as follows: (1) The 5' portion of exon 2 was
amplified with (forward/reverse, 5'-3') primers
TTACGGGGAGAACCCTAGGGGAGGCCG/AGAGAAGATGGGGTCGCAAG at
an annealing temperature of 68°C; (2) middle portion of exon 2
CTCTCCGCCGTGTTCACGGT/GCGATCCCGGCTTCTTCGGC at 60°C; (3) 3' portion of
exon 2 TCCGGTGAACCCTGCGGCCT/TGCCGGCAGGACCAGCCGAC at 68°C; (4) a
different forward primer was used for exon 8, GCATTCTGGGACAGTGAGCC; and
(5) exons 6 and 7 were amplified with the same published primers but at
lower annealing temperatures of 55°C, exon 11 at 68°C, exon 15 at
58°C, and exon 17 at 68°C.
New intronic forward and reverse primers were designed for the eight exons of the PEDF gene (Table 1) and were used, at 55°C annealing temperature, for mutation screening in this family.
|
Direct Sequencing
Products of PCR amplification were sequenced using the PRISM Ready
Reaction Sequencing Kit (PerkinElmer, PE Biosystems), and the
products were analyzed on an ABI 373A XL automated sequencer. All PCR
products were sequenced in the forward and reverse directions.
| Results |
|---|
|
|
|---|
|
The PEDF gene has been physically mapped to the 17p13.3 between markers D17S849 and D17S938, which lies within our critical region (Fig. 3) . Because it was the possible candidate gene for the disease, the gene was also screened for mutations in this family. Heteroduplex and direct sequencing of the eight exons revealed no disease-associated mutations.
|
The family investigated in the present study presented with LCA and early onset keratoconus, cosegregating in an autosomal recessive manner. The incidence of keratoconus associated with LCA is between 30% and 50% above the age of 15 years.8 In a study by Elder20 of children with LCA, he demonstrated that keratoconus was specifically linked to LCA due to genetic factors rather than poor visual acuity per se. It is possible that the close association of keratoconus with LCA in this pedigree could be due to mutations in two genes in very close proximity to each other. Alternatively, the gene defect causing the LCA could predispose the formation of the keratoconus phenotype in this family.
The RETGC-1 gene, which is associated with LCA1 and CORD6,2 21 has been excluded as a candidate in this family, both by mutation screening and by physical exclusion indicated by mapping in YACs based on the physical mapping of the gene by Perrault et al.2 PEDF, another candidate in the region, has also been excluded as the disease gene. The genes associated with CORD5, RP13, and CACD are yet to be identified, however when they are they will provide additional candidates for this phenotype.
Heredity plays a significant role in at least a portion of keratoconus patients. Von Ammon first described the familial incidence of keratoconus in 1830; it has since been found that familial incidence varies from less than 5% to as high as 20%.22 23 Topographic studies of the corneal surface to evaluate 28 family members of 5 unrelated patients with keratoconus found abnormalities in 50% of the family members, which was significantly higher than in the controls.14 In another study of the 12 patients with clinical disease, 7 of the patients had at least one parent with evidence of subclinical keratoconus.24 These observations were mainly of dominant inheritance of the keratoconus phenotype, recessive inheritance being much more difficult to identify in an outbred population. Interestingly, a recent report by Rabinowitz et al.25 suggests a keratoconus gene locus near the centromere of chromosome 21 based on nonparametric linkage analysis. The identification of this locus in an inbred family will have a bearing on future genetic studies of keratoconus in the general population.
The region to which this family maps is known to be one of the most gene-rich regions of the genome due to the greatest concentration of mapped expressed sequence tags (ESTs).26 The 15.77-cM interval between these markers contains no well-characterized candidate genes; however, 4 ESTs identified from the human genome transcript map (http://www.ncbi.nlm.nih.gov/SCIENCE96/) that are expressed in the retina, 6 in epithelial or keratinocyte cells, and 19 in nervous tissue. These represent the best candidates available at this time. Further analysis of these cDNA clones will be needed before mutation screening in this family can be undertaken.
| Footnotes |
|---|
Submitted for publication May 14, 1999; revised August 16 and October 20, 1999; accepted October 21, 1999.
Commercial relationships policy: N.
Corresponding author: Shomi S. Bhattacharya, Department of Molecular Genetics, Institute of Ophthalmology, University College London, 11-43 Bath Street, London EC1V 9EL, UK. smbcssb{at}ucl.ac.uk
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. T. McMahon, L. S. Kim, G. A. Fishman, E. M. Stone, X. C. Zhao, R. W. Yee, and J. Malicki CRB1 Gene Mutations Are Associated with Keratoconus in Patients with Leber Congenital Amaurosis Invest. Ophthalmol. Vis. Sci., July 1, 2009; 50(7): 3185 - 3187. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gajecka, U. Radhakrishna, D. Winters, S. K. Nath, M. Rydzanicz, U. Ratnamala, K. Ewing, A. Molinari, J. A. Pitarque, K. Lee, et al. Localization of a Gene for Keratoconus to a 5.6-Mb Interval on 13q32 Invest. Ophthalmol. Vis. Sci., April 1, 2009; 50(4): 1531 - 1539. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Udar, S. R. Atilano, D. J. Brown, B. Holguin, K. Small, A. B. Nesburn, and M. C. Kenney SOD1: A Candidate Gene for Keratoconus. Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3345 - 3351. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Heegaard, T Rosenberg, M Preising, J U Prause, and T Bek An unusual retinal vascular morphology in connection with a novel AIPL1 mutation in Leber's congenital amaurosis Br J Ophthalmol, August 1, 2003; 87(8): 980 - 983. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. van der Spuy, J. P. Chapple, B. J. Clark, P. J. Luthert, C. S. Sethi, and M. E. Cheetham The Leber congenital amaurosis gene product AIPL1 is localized exclusively in rod photoreceptors of the adult human retina Hum. Mol. Genet., April 1, 2002; 11(7): 823 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Tzekov, Y. Liu, M. M. Sohocki, D. J. Zack, S. P. Daiger, J. R. Heckenlively, and D. G. Birch Autosomal Dominant Retinal Degeneration and Bone Loss in Patients with a 12-bp Deletion in the CRX Gene Invest. Ophthalmol. Vis. Sci., May 1, 2001; 42(6): 1319 - 1327. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |