(Investigative Ophthalmology and Visual Science. 2000;41:668-670.)
© 2000
by The Association for Research in Vision and Ophthalmology, Inc.
Expression of Estrogen Receptor 
and ß in the Mouse Cornea
Masayoshi Tachibana1,
Takashi Kasukabe1,
Yasuhito Kobayashi2,
Tomo Suzuki3,
Shigeru Kinoshita3 and
Yoshibumi Matsushima1
1 From the Research Institute and the
2 Laboratory of Clinical Pathology, Saitama Cancer Center, Saitama, Japan; and the
3 Department of Ophthalmology, Kyoto Prefectural University of Medicine, Kyoto, Japan.
 |
Abstract
|
|---|
PURPOSE. To test the possibility that estrogen has a direct effect on corneal
cells, the possible occurrence of estrogen receptor alpha
(ER
) and beta (ERß) in the cornea of mice was examined.
METHODS. To test for the occurrence of ER proteins in the cornea of mice, an
immunocytochemical method was used. To test for the occurrence of ER
mRNAs in the cornea of mice, reverse transcription–polymerase chain
reaction (RT–PCR) was used.
RESULTS. Immunocytochemical examination revealed that both ER and ERß exist
in the cell nuclei of corneal epithelial, stromal, and endothelial
cells of both male and female mice. RT–PCR revealed that RNAs of ERs
occur in the cornea of both male and female mice.
CONCLUSIONS. Because ER and ERß occur in corneal cells of mice, estrogen may
exert biological functions in corneal cells through direct interaction
with these ERs.
|
Introduction
|
|---|
Some studies have revealed a cyclic variation in women’s cornea
across the menstrual cycle. For example, a steeping of horizontal and
vertical curvature at the beginning of the cycle and a cyclic variation
of corneal thickness through the menstrual cycle (for review see Ref. 1)
. Moreover, it has been shown that hormone replacement therapy for
postmenopausal symptoms with estrogen and progesterone derivatives
causes corneal thickening.2
These findings suggest that
estrogen and progesterone have some effect, direct or indirect, on the
corneal anatomy. To test the possibility that estrogen has a direct
effect on corneal cells, we examined the possible occurrence of
estrogen receptor alpha (ER) and beta (ERß) in the cornea of mice.
Studies by two independent methods revealed that both ER and ERß
do occur in these cells of male and female mice.
|
Methods
|
|---|
Animals
BALB/c NCrj mice of both sexes were purchased from a local vender
(CLEA Japan, Tokyo, Japan) and used at approximately 4 months of age.
All animals were treated according to the ARVO Statement for the Use of
Animals in Ophthalmic and Vision Research.
Immunocytochemical Detection of ERs
Immediately after the death of mice by cervical dislocation under
ether anesthesia, eyeballs of three male and three female mice
approximately 4 months of age were isolated. Tissues were immersed in
10% buffered formalin overnight, dehydrated in a graded series of
ethanol, and embedded in paraffin. Sections of approximately 4 µm
were cut, mounted onto glass slides, and deparaffinized with xylene and
graded concentrations of ethanol. Alternatively, fresh tissues were
frozen with dry ice ejected from a tank with liquid
CO2, after which frozen sections of approximately
7 µm were cut and mounted onto glass slides. To enhance antigenicity,
the sections were immersed in 10 mM citrate buffer (pH 7.4) and treated
in an 800 W microwave at boiling temperature for 8 minutes. Next, to
inhibit endogenous peroxide activity, sections were treated with 0.3%
hydrogen peroxide in methanol. After incubation with rabbit polyclonal
anti-ER antibody (4 µg/ml, Santa Cruz Biotechnology, Santa Cruz,
CA) or anti-ERß antibody (50 µg/ml, Affinity Bioreagents,
Golden, CO) at 4°C overnight, sections were immunostained by
streptavidin–biotin complex method using Histofine SAB-PO(R) kit
(Nichirei, Tokyo, Japan) according to the manufacturer’s
recommendation. Reaction complex was visualized by treatment with
0.05% 3,3'-diaminobenzidine tetrahydrochloride and 0.03% hydrogen
peroxide in 50 mM Tris–HCl buffer (pH 7.6). Sections were then
dehydrated by concentrations of ethanol, mounted, and observed under a
microscope. In control slides, normal rabbit serum was used in place of
antibody.
RT–PCR
Immediately after the death of mice by cervical dislocation under
ether anesthesia, eyeballs of male and female mice approximately 4
months of age were isolated. Corneas were further dissected under the
stereomicroscope. Testes, which have been shown to be enriched with
ER,3
were obtained from male mice and used for positive
control. RNAs were extracted from these tissues using 4 M guanidium
isothiocyanate (pH. 4.0) and Catrimox-14 RNA isolation kit (Takara
Biomedicals, Kyoto, Japan), according to the manufacturer’s
instruction. Approximately 1 µg of total RNAs was
reverse–transcribed with AMV reverse transcriptase, random primers,
and RNA PCR kit (Takara), according to the manufacturer’s instruction.
One tenth of resulting cDNA was used for further PCR amplification. PCR
was performed for 45 cycles at 95°C for 30 seconds, 65°C for 1
minute, and 72°C for 25 seconds, and finally for 1 cycle at 72°C
for 5 minutes in 20 µl of reaction mixture containing the cDNA
template, 0.25 µM sense and antisense primers, 1 mM
deoxyribonucleotide triphosphate (dATP, dTTP, dGTP and dCTP), 0.5 U of
Pyrobest DNA polymerase (Takara). Primers used for
amplification of mouse ER and ERß cDNAs were designed from a
previously reported cDNA sequences.4
5
Sequence of sense
primer for ER was GACCAGATGGTCAGTGCCTT (position 1139–1158), and
that of antisense primer was ACTCGAGAAGGTGGACCTGA (position
1343–1324). Sequence of sense primer for ERß was
CAGTAACAAGGGCATGGAAC (position 1280–1299), and that of antisense
primer was GTACATGTCCCACTTCTGAC (position 1522–1503). Primers used for
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) cDNA amplification
were designed from a reported GAPDH cDNA sequence6
;
sequence of sense primer was ATGGTGAAGGTCGGTGTGAAC, whereas that of
antisense primer was GCCTTGACTGTGCCGTTGAAT. PCR products were analyzed
on 1% agarose gel stained with ethidium bromide. Specific-sized PCR
products were recovered from the gel using QIAEX II gel extraction kit
(Qiagen, Hilden, Germany) and used for templates of nucleotide
sequencing. The sequencing was carried out using ABI PRISM cycle
sequencing kit (Perkin–Elmer, Norwalk, CT) and ABI PRISM 310 gene
analyzer.
|
Results
|
|---|
In immunocytochemical studies of paraffin sections of
formalin-fixed corneas, we observed the expression of ER protein
(Figs. 1A
1B
1C)
but not that of ERß protein. However, the latter was found in
unfixed cryosections (Figs. 1B
1C)
. Both ER and ERß were
localized in nuclei of epithelial, stromal, and endothelial cells of
the cornea of both male and female mice, with no apparent gender
difference observed in their expression.
View larger version (53K):
[in this window]
[in a new window]
|
Figure 1. Demonstration of ER in mouse corneas by immunocytochemistry on
paraffin sections (A, B, C) and
RT–PCR (D). (A, B) Immunoreactivity
for ER was observed in nuclei of corneal cells (i.e., epithelial,
stromal, and endothelial cells of male [A] and female
[B] mice). (C) Control section in which normal
rabbit serum was used in place of antibody. No specific staining was
observed. (D) Lane 1, Cornea of male mice;
lane 2, cornea of female mice; lane 3,
testes; and lane 4, non-RT control. Upper
panel demonstrates amplicons for ER, and lower
panel demonstrates those for GAPDH. Specific amplicons for
ER are observed in lanes 1 through 3
(arrowhead) but not in lane 4.
Nonspecific bands are observed in all lanes.
|
|
RT–PCR studies revealed that transcripts of both ER and ERß were
expressed in the corneas of female and male mice. The amplified
transcripts were detected as a single band on an agarose gel in the
cornea and testes (Figs. 1D
2D
, arrowheads). The sizes of the amplicons were identical among these
tissues and were identical with the expected sizes (i.e., 205 bp for
ER and 243 bp for ERß). Nucleotide sequences of amplicons were
identical with those of reported mouse ER and ERß
cDNAs.3
4
View larger version (50K):
[in this window]
[in a new window]
|
Figure 2. Demonstration of ERß in mouse corneas by immunocytochemistry on
cryosections (A, B, C) and RT–PCR
(D). (A, B) Immunoreactivity for ERß
was observed in nuclei of corneal cells (i.e., epithelial, stromal, and
endothelial cells of male [A] and female [B]
mice). (C) Control section in which normal rabbit serum was
used in place of antibody. No specific staining was observed.
(D) Lane 1, Cornea of male mice; lane
2, cornea of female mice; lane 3, testes; and
lane 4, non-RT control. Upper panel
demonstrates amplicons for ERß, and lower panel
demonstrates those for GAPDH. Specific amplicons for ERß are observed
in lanes 1 through 3
(arrowhead) but not in lane 4.
|
|
|
Discussion
|
|---|
Occurrence of mRNA for ER was previously demonstrated in rat,
rabbit, and human corneas.6
In the present study we
demonstrated the expression of ER and ERß in corneal cells of both
male and female mice at the protein and transcript levels.
Although previous immunocytochemical studies
showeddifferential expression of ER and ERß in some
tissues including ovary and uterus,7
we did not observe an
apparent difference in the expression pattern in the cornea. These data
are consistent with the notion that estrogen, which is probably
supplied through tears and aqueous humor, interacts with ER and
ERß in corneal cells and exerts the biological effects that include,
as is well known, retention of water and sodium.8
Cyclic variation of corneas across the menstrual cycle in human females
was first noticed some three decades ago. In 1970,
Manchester9
reported a change in corneal hydration across
the menstrual cycles in ovulating women. Since then many studies have
found cyclical variation in corneal thickness across the menstrual
cycle: most found the thickening of the cornea at ovulation (for review
see Ref. 1)
. And because it has also been reported that corneal
thickness increases during pregnancy,10
there is a strong
indication of an association between corneal thickness and estrogen
level.
Variations of thickness across the menstrual cycle have been observed
in the skin as well: Eissenbeiss et al.11
reported that
skin thickness increases from days 2 to 4 through days 12 to 14 of the
menstrual cycle. This phenomenon may be attributed to systemic water
retention due to factors such as estrogen-induced upregulation of
renin-aldosterone system.12
However, the mechanism for
cyclic variation may also involve the local effect of estrogen through
interaction with ER, which has been shown to occur in the
skin.13
Topical application of estrogen to the rodent skin
is reported to increase hyaluronic acid and water content and
accelerate cutaneous wound healing.14
15
Despite substantial evidence for physiological/pathophysiological
function of estrogen and its receptors in the skin, their function in
the cornea remains to be studied. Moreover, others’ studies did not
find the occurrence of ER in the human cornea.16
The
discrepancy between their finding and our present finding may be due to
differences of species or methods used. As a first step to address
these points, we are now examining the occurrence of ERs in the human
cornea by the methods used in this study.
|
Acknowledgements
|
|---|
The authors thank Kaname Kawajiri and Hidetaka Eguchi for
their valuable discussion and Eiju Tsuchiya for continuous
encouragement.
|
Footnotes
|
|---|
Submitted for publication July 22, 1999; revised September 24, 1999; accepted October 26, 1999.
Commercial relationships policy: N.
Corresponding author: Masayoshi Tachibana, Research Institute, Saitama Cancer Center, 818 Komuro, Ina, Saitama 362-0806, Japan. mtachiba{at}cancer-c.pref.saitama.jp
|
References
|
|---|
-
Guttridge, NM (1994) Changes in ocular and visual variables during the menstrual cycle Ophthalmic Physiol Opt 14,38-46[Medline][Order article via Infotrieve]
-
Sorrentino, C, Affinito, P, Mattace, RF, et al (1998) Effect of hormone replacement therapy on postmenopausal ocular function Minerva Ginecol 50,19-24[Medline][Order article via Infotrieve]
-
Hess, RA, Bunick, D, Lee, KH, et al (1997) A role for oestrogens in the male reproductive system Nature 390,19-24
-
White, R, Lees, JA, Needham, M, Ham, J, Parker, M. (1987) Structural organization and expression of the mouse estrogen receptor Mol Endocrinol 1,735-744[Abstract/Free Full Text]
-
Sabath, DE, Broome, HE, Prystowsky, MB (1990) Glyceroaldehyde-3-phoshate dehydrogenase is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte Gene 91,185-191[Medline][Order article via Infotrieve]
-
Wickham, LA, Rocha, EM, Gao, J, et al (1998) Identification and hormonal control of sex steroid receptors in the eye Sullivan, DA/FNM>et al eds. Lacrimal Gland, Tear Film, and Dry Eye Syndromes 2 ,95-100 Plenum New York.
-
Hiroi, H, Ion, S, Watanabe, T, et al (1999) Differential immunolocalization of estrogen receptor alpha and beta in rat ovary and uterus J Mol Endocrinol 22,37-44[Abstract]
-
Schreiner, WE (1997) The ovary Labhart, A eds. Clinical Endocrinology ,511-665 Springer New York.
-
Manchester, PT (1970) Hydration of the cornea Trans Am Ophthalmol Soc 68,425-461
-
Wenreb, RN, Lu, A, Beeson, C. (1988) Maternal corneal thickness during pregnancy Am J Ophthalmol 105,258-260[Medline][Order article via Infotrieve]
-
Eissenbeiss, C, Welzel, J, Schmeller, W. (1998) The influence of female sex hormones on skin thickness: elevation using 20 MHz sonography Br J Dermatol 139,462-467[Medline][Order article via Infotrieve]
-
Sealey, JE, Itskovitz–Eldor, J, Rubattu, S, et al (1994) Estradiol- and progestrone-related increases in the renin-aldosterone system: studies during ovarian stimulation and early pregnancy J Clin Endocrinol Metab. 79,258-264[Abstract]
-
Uzuka, M, Nakajima, K, Mori, Y. (1978) Estrogen receptor in the mouse skin Biochim Biophys Acta 544,329-337[Medline][Order article via Infotrieve]
-
Ashcroff, GS, Dodsworth, J, van Boxtel, E, et al (1997) Estrogen accelerates cutaneous wound healing associated with an increase in TGF-ß levels Nat Med 3,1195-1196[Medline][Order article via Infotrieve]
-
Gans, LA, Lee, SF, Lemp, MA, et al (1990) Estrogen and progestrone receptors and human conjunctiva Am J Ophthalmol 109,474-477[Medline][Order article via Infotrieve]
-
Ogueta, SB, Schwartz, SD, Yamashita, CK, et al (1999) Estrogen receptor in the human eye: influence of gender and age on gene expression Invest Ophthalmol Vis Sci 40,1906-1911[Abstract/Free Full Text]
This article has been cited by other articles:
|
|
|
|
 
G. Fuchsjager-Mayrl, J. Nepp, C. Schneeberger, M. Sator, W. Dietrich, A. Wedrich, J. Huber, and W. Tschugguel
Identification of Estrogen and Progesterone Receptor mRNA Expression in the Conjunctiva of Premenopausal Women
Invest. Ophthalmol. Vis. Sci.,
September 1, 2002;
43(9):
2841 - 2844.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Igarashi, T. Kouro, T. Yokota, P. C. Comp, and P. W. Kincade
Age and stage dependency of estrogen receptor expression by lymphocyte precursors
PNAS,
December 18, 2001;
98(26):
15131 - 15136.
[Abstract]
[Full Text]
[PDF]
|
|
|
Top
Abstract
Introduction
