|
|
||||||||
1 From the Department of Ophthalmology, University of Heidelberg Medical School, Heidelberg, Germany.
| Abstract |
|---|
|
|
|---|
METHODS. Transcription of nerve growth factor (NGF), neurotrophin 3 (NT-3), NT-4, brain-derived neurotrophic factor (BDNF), glial cell linederived neurotrophic factor (GDNF), and receptors Trk AE, was investigated by reverse transcriptionpolymerase chain reaction. DNA dot blot analysis allowed to estimate transcription levels. Single cell proliferation assays were performed using recombinant NGF, BDNF, and GDNF. Mitogen-activated protein kinase signal transduction was investigated with Western blot analysis using antibodies against activated and total extracellular signal-regulated kinase (ERK) 1/2 and the jun N-terminal protein kinase (JNK) 1/2.
RESULTS. Transcription of NGF, NT-3, BDNF, and Trk A, Trk B, Trk C, and Trk E receptors was detected in both ex vivo and cultured epithelium and stroma. Transcription of NT-4 was only detected in epithelium and transcription of GDNF only in stroma. Levels of transcription were higher for NT-3, NT-4, and the Trk receptors and lower for NGF, BDNF, and GDNF. NGF and GDNF stimulated both epithelial colony formation and proliferation, whereas BDNF only enhanced colony formation. Stromal proliferation was enhanced in serum-free medium. In epithelium, predominantly ERK 1 was activated by NGF, GDNF, and BDNF. In stromal cells NGF and GDNF stimulated phosphorylation of ERK 1 and JNK 1.
CONCLUSIONS. Neurotrophic factors and tyrosine kinase receptors are transcribed in the human cornea. GDNF and NGF stimulate corneal epithelial proliferation, and the effect of the latter might be mediated by activation of ERK 1. Neurotrophic factors have very specific effects on phosphorylation of ERK and JNK in epithelial and stromal cells. The differential expression of NT-4 and GDNF suggests a regulatory function within the cytokine network of the cornea.
| Introduction |
|---|
|
|
|---|
NGF is a member of the neurotrophin gene family, which also includes neurotrophin 3 (NT-3), neurotrophin 4/5 (NT-4), and brain-derived neurotrophic factor (BDNF).4 5 Neurotrophins exert their biological functions by binding to high affinity transmembranous receptors belonging to the Trk family of tyrosine kinase receptors. At least four Trk receptors have been cloned and express variable capabilities to bind individual neurotrophins.6 7 Although Trk A is the main receptor for NGF; Trk B binds BDNF, NT-3, and NT-4; and Trk C binds NT-3. Trk E also binds NGF. In addition a low affinity receptor, the glycoprotein p75 that belongs to the cytokine receptors, has been described.8 Although a matter of controversy, experimental data suggest that the presence of a high affinity Trk receptor is sufficient for signal transduction.5 Binding of a neurotrophin to its Trk receptor induces dimerization and phosphorylation that initiates a signal transduction cascade and ultimately leads to gene transcription. Neurotrophins are existing mainly as homodimers with close structural homology to each other and are related to other growth factor families such as transforming growth factor-ß (TGF-ß).9 The TGF-ß superfamily also contains a protein, glial cell linederived neurotrophic factor (GDNF), that like neurotrophins acts as neurotrophic factor.10 11
Neurotrophic factors are regulatory molecules that play important roles in the development as well as maintenance and survival of a wide variety of cells of neuronal origin.4 5 12 Several lines of evidence suggest that neurotrophic factors such as NGF also exert biological functions in cells of the ocular surface: In rabbits, NGF promotes the proliferation of corneal epithelial cells in vitro and accelerates the rate of epithelial wound healing in vitro.13 14 Furthermore, increased levels of NGF have been found in inflamed conjunctiva of patients with vernal keratoconjunctivitis.15
Although these findings suggest that neurotrophins participate in the regulation of physiological and pathologic processes of the ocular surface, little is known about the mechanism by which neurotrophins such as NGF modulate cells of the cornea. The two major prerequisites for a physiological role of neurotrophins in the cornea are the presence of neurotrophins and the presence of the corresponding receptors. The latter was recently demonstrated by the presence of Trk A receptors in corneal epithelium and endothelium and confirms that these cells can respond to NGF.16 To further elucidate the role and origin of neurotrophins in the human cornea, we investigated the transcription of NGF, NT-3, NT-4, BDNF, and GDNF in corneal epithelial and stromal cells. Furthermore, we have shown transcription of four different Trk receptors in both ex vivo and cultured corneal epithelial and stromal cells. In addition we have compared the effects of BDNF and GDNF on epithelial and stromal proliferation to that of NGF and obtained evidence that the latter cytokine induces the mitogen-activated protein kinase (MAP kinase) signaling system by activation of extracellular signal-regulated kinase (ERK) and the jun N-terminal protein kinase (JNK).
| Methods |
|---|
|
|
|---|
Cell Culture
Human corneas stored for less than 24 hours in Likorol
(ChauvinOpsia, Labege Cedex, France) at 4°C were obtained through
our eye bank. All corneas were of transplant quality but excluded from
clinical use for nonocular reasons according to international eye bank
criteria. Both epithelial and stromal cells were cultured on plastic
dishes as outgrowth cultures with slight modifications of a previously
described technique.17
For RNA extraction, explant
cultures were initiated and cultured in SHEM medium (1:1 mixture of
Dulbeccos modified Eagles medium, DMEM, and Hams nutrient mixture
F-10 with 10% fetal bovine serum, FBS; GIBCO, Grand Island, NY), 5
µg/ml insulin, and 10 ng/ml epidermal growth factor (EGF) without
antibiotics.18
19
The epithelial phenotype of cultures was
confirmed by staining with an antibody for cytokeratin K12. Because
this method only yielded a very limited amount of cells we also used an
SV 40adenovirustransformed corneal epithelial cell
line.18
Similar to normal corneal epithelium these cells
exhibit clonal growth characteristics and display a corneal epithelial
phenotype (including expression of keratin K12). The cell line was
cultured as previously described in SHEM medium.18
19
Stromal fibroblasts were cultured in DMEM + 10% FBS as described
previously.17
All experiments were performed in triplicate
and with cells obtained from different donors.
Isolation of Total RNA and mRNA Purification
Total RNA was isolated according to the guanidium
thiocyanatephenolchloroform extraction method20
by use
of an RNAgents total RNA isolation system kit (Promega, Madison, WI) as
previously described.17
For mRNA isolation a Promega
polyATtract system III was used as described previously.17
To minimize the risk of contamination by genomic DNA, mRNA samples were
digested by RNase-free DNase followed by phenol-chloroformisoamyl
alcohol extraction and isopropanol precipitation.
Polymerase Chain Reaction Primer Design and Reverse
TranscriptionPolymerase Chain Reaction
For polymerase chain reaction (PCR) primer design known
coding sequences were taken from GenBank (www.ncbi.nlm.nih.gov).
Because of the high structural similarity of the sequences of all the
known members of the neurotrophin gene families and the neurotrophin
tyrosine kinase receptor family, all sequences in open reading frames
were compared using the Clustal W multiple sequence alignment program
as described previously.17
Whenever possible, primers were
designed to span one or more introns in the genomic sequence: NGF,
sense, GAGGTGCATAGCGTAATGTCCA, and antisense, TCCACAGTAATGTTGCGGGTCT
(product of 233 bp; GenBank accession number: V01511, X52599); NT-3,
sense, TTACAGGTGAACAAGGTGATG, and antisense, GCAGCAGTTCGGTGTCCATTG
(product of 298 bp; GenBank accession number: M37763); NT-4, sense,
CTCTTTCTGTCTCCAGGTGCTCCG, and antisense, CGTTATCAGCCTTGCAGCGGGTTTC
(product of 464 bp; GenBank accession number: M86528); BDNF, sense,
GTGAGTTTGTGTGGACCCCGAG, and antisense, CAGCAGAAAGAGAAGAGGAGGC (product
of 373 bp; GenBank accession number: X60201, X91251); GDNF, sense,
GCCCTTCGCGTTGAGCAGTGAC, and antisense, GTCGTACGTTGTCTCAGCTGC (product
of 343 bp; GenBank accession number: NM000514); Trk A, sense,
GATGCTGCGAGGCGGACGGC, and antisense, CTGGCATTGGGCATGTGGGC (product of
570 bp; GenBank accession number: M23102); Trk B, sense,
TGCACCAACTATCACATTTCTCG, and antisense, CACAGACGCAATCACCACCACA (product
of 472 bp; GenBank accession number: S76473); Trk C, sense,
ACTTCGGAGCATTCAGCCCAGAG, and antisense, ACTCGTCACATTCACCAGCGTCAA
(product of 484 bp; GenBank accession number: S76475, U05012); and Trk
E, sense, AGGAGTACTTGCAGGTGGATC, and antisense, ACTGGAGAAGCTGTGGTTGCT
(product of 545 bp; GenBank accession number: X74979).
The first-strand cDNA was synthesized as previously described.17 PCR was performed using 0.5 µl of single-strand cDNA with 3 U Thermus aquaticus (Taq) DNA Polymerase, a mixture of desoxyribonucleotides (in a final concentration of 0.2 mM), 10x PCR buffer (5 µl), and 25 pmol of upstream and downstream primers in a total volume of 50 µl (all reagents from Takara Shuzo, Otsu, Shiga, Japan). The final concentration of MgCl2 in the buffer was 1.5 mM. A PTC-100 programmable thermocycler (MJ Research, Watertown, MA) was used at 95°C for 3 minutes (predenaturation). Then 35 cycles were performed including denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute, and extension at 72°C for 1 minute.
The PCR products were size-fractionated by agarose gel electrophoresis using 1.8% agarose 1x Tris-acetate-EDTA gels stained with 0.5 µg/ml ethidium bromide. All PCR fragments were cloned into pCR2.1 vector (Invitrogen, San Diego, CA), and sequences were confirmed by standard methods.
DNA Dot Blot Analysis for Detection of the Level of Gene
Transcription in the Cultured Cornea
To get an estimation of the level of transcription in cultured
epithelial and stromal cells we performed a DNA dot blot analysis.
Because we could not culture sufficient quantities of human corneal
epithelial cells, we used a corneal epithelial cell line as a source of
corneal epithelium. Cloned PCR fragments corresponding to neurotrophic
factor family, and Trk receptors genes were amplified using the
above-mentioned primers and purified from agarose gels. A 0.1-µg
aliquot of PCR product was loaded onto nylon membranes as dot. To
generate the hybridization probe, 1 µg mRNA was isolated from
cultured epithelial and stromal cells and transcribed with a
digoxigenin probe synthesis mix (BoehringerMannheim, Mannheim,
Germany) to synthesize first-strand cDNA labeled with digoxigenin. DNA
blots were then prehybridized and hybridized with the
digoxigenin-labeled cDNA probe in DIG EasyHyb buffer
(BoehringerMannheim) at 40°C overnight. After posthybridization
washing, the blots were treated with the DIG washing kit from
BoehringerMannheim according to the manufacturers description and
exposed to ECL film (Amersham Life Science, Little Chalfont, UK). For
comparison, a cDNA fragment encoding for reduced
glyceraldehyde-phosphate dehydrogenase (GAPDH) was used as positive
control.
Investigation of Components of the MAP Kinase Signal Transduction
Pathways Induced by Neurotrophic Factors in the Cultured Cornea
To evaluate the effect of neurotrophic factors on the activation
of signal transduction pathways in cultured corneal epithelium and
stromal keratocytes, we performed Western blot analysis to investigate
the accumulation of phosphorylated MAP kinases ERK and JNK in the
presence of NGF, BDNF, and GDNF. Human stromal keratocytes were
cultured in RPMI 1640 medium containing L-glutamine
(glutaMAX) or DMEM with 10% FBS for 1 day and starved in serum-free
medium for another day. Cultures were then washed with
phosphate-buffered saline (PBS) and incubated in serum-free DMEM
without additives or with recombinant human NGF (200 ng/ml),
recombinant human BDNF (200 ng/ml), and recombinant human GDNF (200
ng/ml; all from R&D Systems, Minneapolis, MN) for 30 minutes. Some
cultures were incubated with an inhibitor of MAP kinase (PD 98059;
Torcris Cookson, Ballwin, MO) at 100 µM for 1 hour before exposure to
neurotrophins. After washing with PBS, cultured cells were solubilized
in lysis buffer containing 50 mM TrisCl (pH 8.0), 150 mM NaCl, 0.02%
sodium azide, 100 µg/ml phenylmethylsulfonyl fluoride, 1% Triton
X-100, and a mixture of several protease inhibitors (Complete, 1
tablet/50 ml buffer; BoehringerMannheim). Fifty micrograms total
protein per lane was fractionated by a 10% sodium dodecyl
sulfateMOPS NuPAGE Bis-tris gel (NOVEX, San Diego, CA) and
blotted onto nitrocellulose membrane. Membranes were stained with
diluted polyclonal antibodies against ERK 1, ERK 2, JNK 1, and JNK 2
(Santa Cruz Biotechnology, Santa Cruz, CA). We also used a polyclonal
antibody, which recognizes the activated form of either ERK 1 and ERK
2, that was raised against the catalytic core of the phosphorylated
threonine residue 183 and tyrosine residue 185 of the mammalian
ERK 2. Similarly, a polyclonal antibody recognizing the
phosphorylated form of JNK 1 and JNK 2 was used (both from Promega). As
the last step, the membranes were visualized with the ECL Western blot
analysis system (Amersham Life Science).
Investigation of the Effect of Neurotrophic Factors on
Proliferation of Corneal Epithelial and Stromal Cells
To evaluate the effect of neurotrophic factors on corneal
proliferation, recombinant human NGF, BDNF, and GDNF were used (R&D
Systems) and the effect compared with that of recombinant human EGF
(Sigma, St Louis, MO). To evaluate the effect on corneal
epithelial proliferation, a single cell clonal growth model was used
that allows one to determine the effects of a given growth factor on
both colony formation and clonal expansion.21
We were not
able to reproduce quantification of the proliferation of human
epithelial cells in this model due to a shortage of good donor
material. We therefore used rabbit cells which also allows one to
compare the data with previous reports in the literature. New Zealand
white rabbits were housed and treated according to the ARVO Resolution
for the Use of Animals in Ophthalmic and Vision Research and under
observation of German federal laws and the laws of the State of
BadenWürttemberg. Before they were killed with an intravenous
overdose of pentobarbital, the rabbits received an intramuscular
injection of xylazine hydrochloride and ketamine hydrochloride. The
details of the clonal growth assay have been described
previously.21
Five thousand viable cells were seeded in
each 60-mm dish in serum-free medium MCDB 151 with a supplement
of insulin (5 µg/ml), transferrin (5 µg/ml), selenium (5 ng/ml),
and hydrocortisone (5 µg/ml; all from Sigma). This seeding density
resulted in a single cell clonal growth that could be quantified under
the phase contrast microscope (on day 6) by determination of the number
of colonies per dish and the number of cells per colony. This
quantification was facilitated by use of dishes that contained a grid
on the bottom that was roughly 2-mm wide (Sarstedt, Newton, NC). For
data collection the entire surface areas of four randomly selected
dishes for each condition were screened. Furthermore, the number of
cells per colony was determined in 75 randomly selected colonies for
each condition. To stimulate cellular proliferation, NGF (50 or 200
ng/ml), BDNF (50 or 200 ng/ml), GDNF (50 or 200 ng/ml), or EGF (10
ng/ml) was added to the medium. To get an estimation about the rate of
proliferation after 12 days (a time when neighboring colonies started
to grow into each other and therefore prevented numerical
quantification) dishes were fixed in -20°C methanol and stained with
methylene blue.
To investigate the effect of neurotrophic factors on the proliferation of cultured stroma, keratocytes were passaged from DMEM + 10% FBS into DMEM + 1% FBS or in DMEM without FBS at a density of 5 x 104 cells/60-mm dish. Some cultures received recombinant human NGF, BDNF, or GDNF in concentrations as shown above. Proliferation was measured after 6 days by counting cells under the phase contrast microscope (50 fields at 100x per condition) as well as trypsinized cells. Also a CellTiter 96AQueous One Solution proliferation assay was performed according to the manufacturers description (Promega). For this colorimetric assay 500 or 1000 cells were grown for 6 days in 96-well plates (Falcon). On addition to the culture well a tetrazolium dye is bioreduced by cells into a colored formazan product and the absorbance is quantified at 490 nm. The quantity of the formazan product should be proportional to the number of living cells in the well and can therefore serve to estimate proliferation.
Statistical Analysis
All experiments examining the effect of neurotrophic factors on
corneal proliferation were performed in triplicate with cells from
different donors. The influence of growth factors on colony formation,
colony size, and cell number was studied using one-way ANOVA. The log
transformation was used as necessary to affect homogeneity of variance
and normality in these data. Students t-test was used to
determine which differences were significant after ANOVA.
| Results |
|---|
|
|
|---|
|
|
Transcription of Tyrosine Kinase Receptors Specific for
Neurotrophic Factors in the Human Cornea
The ex vivo corneal epithelium (Fig. 2A)
and stroma (Fig. 2B)
also
contained mRNA encoding for tyrosine kinase receptors that are
necessary for binding and signal transduction of neurotrophic factors.
Figure 2A
shows the RTPCR result after amplification of cDNA
fragments specific for Trk A (lane 1, 570 bp), Trk B (lane 2, 472 bp),
Trk C (lane 3, 484 bp), and Trk E (lane 4, 545 bp) from ex vivo corneal
epithelium. Figure 2B
indicates the same result using mRNA from ex vivo
corneal stroma. When cultured corneal epithelial cells (primary
cultures or corneal epithelial cell line) or cultured stromal
keratocytes were used, the spectrum of RTPCR was not changed (data
not shown). All these Trk gene fragments have also been cloned,
sequenced, and analyzed by the blast search program for further
confirmation.
Level of Transcription of Neurotrophic Factors and Corresponding
Tyrosine Kinase Receptors in Cultured Human Corneal Epithelium
and Stromal Keratocytes
To confirm the results of the initial PCR and to get an estimation
about the level of gene transcription, we performed a DNA dot blot
analysis (Fig. 3)
. Because the hybridization probe for the DNA dot blot was first-strand
cDNA generated from 1 µg mRNA of cultured epithelial cells or stromal
keratocytes, the result of the DNA dot blot allows one to estimate and
compare the transcription level of neurotrophic factors and
corresponding tyrosine kinase receptors in different cells. Figure 3A
shows the spectrum of the transcription levels of neurotrophic factors
and corresponding tyrosine kinase receptors in the human corneal
epithelial cell line. The transcriptions of NGF (lane 1), BDNF (lane
4), and Trk E (lane 9) were significantly weaker than those of the
other neurotrophic factors and tyrosine kinase receptors. The levels of
transcription of NT-3 (lane 2), NT-4 (lane 3), Trk A (lane 6), Trk B
(lane 7), and Trk C (lane 8) were lower than that of GAPDH, which was
used as a positive control (lane 10). No transcription of GDNF (lane 5)
was detected in the DNA dot blots from cultured corneal epithelial
cells. Furthermore, Figure 3B shows that transcription of NT-4 (lane
3), which was clearly present in corneal epithelial cells, could not be
detected in cultured stromal keratocytes. In contrast GDNF (lane 4)
that was not transcribed in epithelial cells showed a positive signal
in cultured stromal keratocytes. The level of transcription of the
remaining neurotrophic factors and tyrosine kinase receptors in stromal
cells was approximately the same as in corneal epithelial cells. This
result confirmed the data obtained from RTPCRs as shown in Figures 1
and 2
.
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Corneal cytokines have been classified on the basis of their
expression.2
30
Although most growth factors are expressed
in both stroma and epithelium some are confined to only one cell type.
These cytokines might be of importance for the interaction between
epithelium and stroma.31
Hepatocyte and keratocyte growth
factors (HGF and KGF, respectfully), two paracrine mediators of
epithelial function are expressed exclusively in stromal
keratocytes.2
30
32
33
We have recently shown that growth
and differentiation factor-5 (GDF-5), a member of the TGF-ß family,
is also exclusively expressed in stromal keratocytes.17
In
contrast to HGF and KGF, which stimulate corneal epithelial
proliferation, GDF-5 was inhibitory. Our present data suggest that
another member of the TGF-ß family, GDNF is also exclusively
expressed in stromal keratocytes but stimulates proliferation of
corneal epithelial cells. As with GDF-5 the proliferation of stromal
keratocytes was not significantly affected by GDNF, which suggests a
role as epithelial modulator. In contrast, NT-4 was exclusively
expressed in epithelial cells. Therefore, this growth factor belongs to
the same group of cytokines as transforming growth factor-
(TGF-
), interleukin-1ß (IL-1ß), and platelet-derived growth
factor-B (PDGF-B), which are also exclusively expressed in the corneal
stroma.2
Interestingly, both TGF-
and IL-1ß can
upregulate the transcription of neurotrophins, such as NGF in 3T3 mouse
fibroblasts.34
Although we did not carry out a functional
characterization of either NT-3 or NT-4, the latter cytokine might be
important for the regulation of stromal keratocytes.
Our results suggest a functional role of neurotrophins in the cornea. This is supported by the effects of neurotrophins on other tissues outside the central nervous system like, for example, the skin. NGF is produced in murine and human keratocytes, and mRNA and protein for NGF were detected in the wound margin.35 36 37 In skin organ cultures NGF increased proliferation.38 Furthermore, NGF accelerates the rate of wound contraction and healing in normal and diabetic mice.37 39 These findings indicate that NGF plays an important role in cutaneous wound healing. NGF might also modulate corneal wound healing, and its expression might be upregulated in the context of wounding. This hypothesis is supported by recent observations in rats that demonstrated a transient increase in corneal NGF levels after wounding and by a rabbit model in which exogenous NGF stimulated the rate of corneal wound healing.14 40 During corneal wound healing several cytokines are released and modulate epithelial and stromal cells. One of the most versatile modulatory cytokines is IL-1,41 which has been shown to upregulate the synthesis of NGF in cultured rat fibroblasts and keratinocytes and therefore provides a possible link between wounding and NGF expression.37 42 Also cutaneous wounding of mice leads to an increase in the NGF production of the salivary gland, which results in increased serum levels.37 Although NGF has not been demonstrated in tears, corneal wounding might lead to an increase of NGF and possibly other neurotrophins in the lacrimal gland.
In human keratinocytes the proliferative effect of NGF has shown to be mediated by high affinity Trk receptor.35 Protein for the Trk A receptor has been detected previously only on corneal epithelial cells and not in the stroma.16 In contrast, our results indicate that ex vivo and cultured stromal cells express mRNA encoding for Trk A and that the expression level in both cell types is similar. Furthermore, corneal epithelial and stromal cells possess high affinity receptors for all members of the neurotrophin family. These receptors mediate physiological functions such as the observed mitogenic effect on corneal epithelial cells. A comparison of the mitogenic effect of NGF with that of other growth factors (e.g., EGF) shows that NGF has only a weak effect. In contrast, NGF seems to have a significant (therapeutic) in vivo effect. This raises the question of its mode of action, including the mechanism of signal transduction. NGF and other neurotrophins may not only modulate transcription of cytokines but also modulate apoptosis of corneal epithelial cells.37 43 The latter hypothesis is based on the finding that the ERK and JNK signal transduction pathways can have opposing effects on apoptosis.44
Binding of members of the neurotrophin gene family to tyrosine kinase receptors activates several distinct signaling pathways mediated by MAP kinases45 46 : The Ras/ERK pathway involves activation of MAP kinase and ERK 1, ERK 2, or both, which then leads to the phosphorylation of a given transcription factor (such as Elk-1 or SAP-1).47 The second pathway dependent on MAP kinase involves phosphorylation of JNK 1, JNK 2, or both and is distinct from the ERK pathway because it phosphorylates transcription factors (such as Jun) at a different S/T-P motif.46 Each of the possible ligands of the membranous tyrosine kinase receptor can induce a different signaling cascade, and the exact composition of the cascade also depends on the cell type. In PC 12 cells and oligodendrocytes NGF has shown to bind to the Trk A receptor and to phosphorylate ERK 1 but not ERK 2.48 49 Similarly, our results demonstrate that NGF, BDNF, and GDNF predominantly phosphorylate ERK 1. The latter might induce additional signaling pathways such as, for example, the phosphatidylinositol-3 kinase pathway.50 Interestingly, NGF, BDNF, and GDNF, which can phosphorylate JNK also in other cells,51 have more effect on stromal than on epithelial JNK.
Further analysis of the signal transduction pathways might define the role of neurotrophic factors within the cytokine network of the cornea. Both NGF and EGF induce the MAP kinase cascade but differ in their effect on proliferation of the corneal epithelium. One possible explanation might be that different components of the MAP kinase system can lead to transcription of factors with opposing physiological effects. One of the initial steps in the MAP kinase cascade is the phosphorylation of the oncogenes Ras and Raf before activation of ERK or JNK.52 53 Both Ras and Raf can induce transcription of, for example, TGF-ß,54 and NGF can increase transcription and secretion of TGF-ß1 in nonocular cells.55 TGF-ß inhibits corneal epithelial cell proliferation.13 56 Furthermore, not only TGF-ß1 through TGF-ß3 but also bone morphogenetic proteins, growth, and differentiation factors, activins/inhibins, and receptors are transcribed in the cornea.17 57 58 Although it has not been demonstrated that NGF induces transcription of other cytokines in corneal epithelial cells, neurotrophins might induce TGF-ß family members. This might explain the difference in the effects of neurotrophins and EGF on corneal epithelial proliferation. In addition, downstream components of the MAP kinase cascade can interfere with other signaling systems. Activation of ERK induced by EGF also results in phosphorylation of signaling components induced by TGF-ß such as the protein "similar to mothers against decapentaplegic-1" (Smad-1).59 60 In response to members of the TGF-ß super family, the carboxyl-terminal domain of Smads is essential for the phosphorylation of Smad 1,5 or Smad 2 and 3, association with Smad 4, translocation into the nucleus, and transcriptional response.61 62 63 It has been suggested that the Smad and JNK signaling pathways converge at AP1-binding promoter sites of several genes.64 Further investigations are needed to determine possible links between the NGF signaling and TGF-ß signaling pathways in cells of the cornea.
| Acknowledgements |
|---|
| Footnotes |
|---|
Submitted for publication April 29, 1999; revised August 2, 1999; accepted September 8, 1999.
Commercial relationships policy: N.
Corresponding author: Friedrich E. Kruse, Augenklinik der Universität Heidelberg, INF 400, 69120 Heidelberg, Germany. friedrich_kruse{at}med.uni-heidelberg.de
| References |
|---|
|
|
|---|
, platelet-derived growth factor B, and interleukin-1ß Invest Ophthalmol Vis Sci 37,2068-2080This article has been cited by other articles:
![]() |
S.-Y. Kim, J.-S. Choi, and C.-K. Joo Effects of Nicergoline on Corneal Epithelial Wound Healing in Rat Eyes Invest. Ophthalmol. Vis. Sci., February 1, 2009; 50(2): 621 - 625. [Abstract] [Full Text] [PDF] |
||||
![]() |
H Qi, D-Q Li, F Bian, E Y Chuang, D B Jones, and S C Pflugfelder Expression of glial cell-derived neurotrophic factor and its receptor in the stem-cell-containing human limbal epithelium Br. J. Ophthalmol., September 1, 2008; 92(9): 1269 - 1274. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Rios, E. Ghinelli, J. Gu, R. R. Hodges, and D. A. Dartt Role of Neurotrophins and Neurotrophin Receptors in Rat Conjunctival Goblet Cell Secretion and Proliferation Invest. Ophthalmol. Vis. Sci., April 1, 2007; 48(4): 1543 - 1551. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gong, U. Pleyer, K. Vogt, I. Anegon, A. Flugel, H.-D. Volk, and T. Ritter Local Overexpression of Nerve Growth Factor in Rat Corneal Transplants Improves Allograft Survival Invest. Ophthalmol. Vis. Sci., March 1, 2007; 48(3): 1043 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lambiase, D. Merlo, C. Mollinari, P. Bonini, A. M. Rinaldi, M. D Amato, A. Micera, M. Coassin, P. Rama, S. Bonini, et al. Molecular basis for keratoconus: Lack of TrkA expression and its transcriptional repression by Sp3 PNAS, November 15, 2005; 102(46): 16795 - 16800. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Esquenazi, H. E. P. Bazan, V. Bui, J. He, D. B. Kim, and N. G. Bazan Topical Combination of NGF and DHA Increases Rabbit Corneal Nerve Regeneration after Photorefractive Keratectomy Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3121 - 3127. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Sack, L. Conradi, D. Krumholz, A. Beaton, S. Sathe, and C. Morris Membrane Array Characterization of 80 Chemokines, Cytokines, and Growth Factors in Open- and Closed-Eye Tears: Angiogenin and Other Defense System Constituents Invest. Ophthalmol. Vis. Sci., April 1, 2005; 46(4): 1228 - 1238. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. S. J. Tuominen, Y. T. Konttinen, M. H. Vesaluoma, J. A. O. Moilanen, M. Helinto, and T. M. T. Tervo Corneal Innervation and Morphology in Primary Sjogren's Syndrome Invest. Ophthalmol. Vis. Sci., June 1, 2003; 44(6): 2545 - 2549. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yanai, N. Yamada, N. Kugimiya, M. Inui, and T. Nishida Mitogenic and Antiapoptotic Effects of Various Growth Factors on Human Corneal Fibroblasts Invest. Ophthalmol. Vis. Sci., July 1, 2002; 43(7): 2122 - 2126. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Simpson, I. Miller, C. Moon, A. L. Hanlon, D. J. Liebl, and G. V. Ronnett Atrial Natriuretic Peptide Type C Induces a Cell-Cycle Switch from Proliferation to Differentiation in Brain-Derived Neurotrophic Factor- or Nerve Growth Factor-Primed Olfactory Receptor Neurons J. Neurosci., July 1, 2002; 22(13): 5536 - 5551. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Touhami, M. Grueterich, and S. C. G. Tseng The Role of NGF Signaling in Human Limbal Epithelium Expanded by Amniotic Membrane Culture Invest. Ophthalmol. Vis. Sci., April 1, 2002; 43(4): 987 - 994. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Japon, A. G. Urbano, C. Saez, D. I. Segura, A. L. Cerro, C. Dieguez, and C. V. Alvarez Glial-Derived Neurotropic Factor and RET Gene Expression in Normal Human Anterior Pituitary Cell Types and in Pituitary Tumors J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1879 - 1884. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. You, S. Ebner, and F. E. Kruse Glial Cell-Derived Neurotrophic Factor (GDNF)-Induced Migration and Signal Transduction in Corneal Epithelial Cells Invest. Ophthalmol. Vis. Sci., October 1, 2001; 42(11): 2496 - 2504. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Calzà, L. Giardino, A. Giuliani, L. Aloe, and R. Levi-Montalcini Nerve growth factor control of neuronal expression of angiogenetic and vasoactive factors PNAS, March 16, 2001; (2001) 51626998. [Abstract] [Full Text] |
||||
![]() |
L. Calza, L. Giardino, A. Giuliani, L. Aloe, and R. Levi-Montalcini Nerve growth factor control of neuronal expression of angiogenetic and vasoactive factors PNAS, March 27, 2001; 98(7): 4160 - 4165. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |