(Investigative Ophthalmology and Visual Science. 2000;41:692-702.)
© 2000
by The Association for Research in Vision and Ophthalmology, Inc.
Neurotrophic Factors in the Human Cornea
Lingtao You1,
Friedrich E. Kruse1 and
Hans E. Völcker1
1 From the Department of Ophthalmology, University of Heidelberg Medical School, Heidelberg, Germany.
 |
Abstract
|
|---|
PURPOSE. To investigate neurotrophic growth factors and corresponding receptors
in human and rabbit corneal epithelium and stroma.
METHODS. Transcription of nerve growth factor (NGF), neurotrophin 3 (NT-3),
NT-4, brain-derived neurotrophic factor (BDNF), glial cell
linederived neurotrophic factor (GDNF), and receptors Trk
AE, was investigated by reverse transcriptionpolymerase chain
reaction. DNA dot blot analysis allowed to estimate transcription
levels. Single cell proliferation assays were performed using
recombinant NGF, BDNF, and GDNF. Mitogen-activated protein kinase
signal transduction was investigated with Western blot analysis using
antibodies against activated and total extracellular signal-regulated
kinase (ERK) 1/2 and the jun N-terminal protein kinase (JNK) 1/2.
RESULTS. Transcription of NGF, NT-3, BDNF, and Trk A, Trk B, Trk C, and Trk E
receptors was detected in both ex vivo and cultured epithelium and
stroma. Transcription of NT-4 was only detected in epithelium and
transcription of GDNF only in stroma. Levels of transcription were
higher for NT-3, NT-4, and the Trk receptors and lower for NGF, BDNF,
and GDNF. NGF and GDNF stimulated both epithelial colony formation and
proliferation, whereas BDNF only enhanced colony formation. Stromal
proliferation was enhanced in serum-free medium. In epithelium,
predominantly ERK 1 was activated by NGF, GDNF, and BDNF. In stromal
cells NGF and GDNF stimulated phosphorylation of ERK 1 and JNK 1.
CONCLUSIONS. Neurotrophic factors and tyrosine kinase receptors are transcribed in
the human cornea. GDNF and NGF stimulate corneal epithelial
proliferation, and the effect of the latter might be mediated by
activation of ERK 1. Neurotrophic factors have very specific effects on
phosphorylation of ERK and JNK in epithelial and stromal cells. The
differential expression of NT-4 and GDNF suggests a regulatory function
within the cytokine network of the cornea.
 |
Introduction
|
|---|
The integrity of the ocular surface depends on a delicate balance
between cellular proliferation and differentiation. Increasing evidence
suggests that one of the prerequisites for such processes is an
integrated interaction between the cells of the cornea. These cells are
confined to three distinct layers: the epithelium, the stroma, and the
endothelium. In general, several factors can modulate the interaction
between cells, for example, direct cell contact, extracellular matrix
components, and cytokines, and among them polypeptide growth
factors.1
Over the recent years a multitude of cytokines
have been identified in the human cornea and seem to be expressed in
the form of an organized network that mediates regulatory functions
between cells of the layers of the cornea.2
However, the
functional significance of these findings is only slowly unfolding, and
it remains unclear how the cytokine network can be manipulated for
therapeutic use. In this context, nerve growth factor (NGF) has
recently gained attention as the first growth factor with proven
efficacy for the treatment of human corneal ulcers due to neurotrophic
disease.3
NGF is a member of the neurotrophin gene family, which also includes
neurotrophin 3 (NT-3), neurotrophin 4/5 (NT-4), and brain-derived
neurotrophic factor (BDNF).4
5
Neurotrophins exert their
biological functions by binding to high affinity transmembranous
receptors belonging to the Trk family of tyrosine kinase receptors. At
least four Trk receptors have been cloned and express variable
capabilities to bind individual neurotrophins.6
7
Although
Trk A is the main receptor for NGF; Trk B binds BDNF, NT-3, and NT-4;
and Trk C binds NT-3. Trk E also binds NGF. In addition a low affinity
receptor, the glycoprotein p75 that belongs to the cytokine receptors,
has been described.8
Although a matter of controversy,
experimental data suggest that the presence of a high affinity Trk
receptor is sufficient for signal transduction.5
Binding
of a neurotrophin to its Trk receptor induces dimerization and
phosphorylation that initiates a signal transduction cascade and
ultimately leads to gene transcription. Neurotrophins are existing
mainly as homodimers with close structural homology to each other and
are related to other growth factor families such as transforming growth
factor-ß (TGF-ß).9
The TGF-ß superfamily also
contains a protein, glial cell linederived neurotrophic factor
(GDNF), that like neurotrophins acts as neurotrophic
factor.10
11
Neurotrophic factors are regulatory molecules that play important roles
in the development as well as maintenance and survival of a wide
variety of cells of neuronal origin.4
5
12
Several lines
of evidence suggest that neurotrophic factors such as NGF also exert
biological functions in cells of the ocular surface: In rabbits, NGF
promotes the proliferation of corneal epithelial cells in vitro and
accelerates the rate of epithelial wound healing in
vitro.13
14
Furthermore, increased levels of NGF have been
found in inflamed conjunctiva of patients with vernal
keratoconjunctivitis.15
Although these findings suggest that neurotrophins participate in the
regulation of physiological and pathologic processes of the ocular
surface, little is known about the mechanism by which neurotrophins
such as NGF modulate cells of the cornea. The two major prerequisites
for a physiological role of neurotrophins in the cornea are the
presence of neurotrophins and the presence of the corresponding
receptors. The latter was recently demonstrated by the presence of Trk
A receptors in corneal epithelium and endothelium and confirms that
these cells can respond to NGF.16
To further elucidate the
role and origin of neurotrophins in the human cornea, we investigated
the transcription of NGF, NT-3, NT-4, BDNF, and GDNF in corneal
epithelial and stromal cells. Furthermore, we have shown transcription
of four different Trk receptors in both ex vivo and cultured corneal
epithelial and stromal cells. In addition we have compared the effects
of BDNF and GDNF on epithelial and stromal proliferation to that of NGF
and obtained evidence that the latter cytokine induces the
mitogen-activated protein kinase (MAP kinase) signaling system by
activation of extracellular signal-regulated kinase (ERK) and the jun
N-terminal protein kinase (JNK).
 |
Methods
|
|---|
Ex Vivo Corneal Tissue
Fresh ex vivo corneal epithelium and stroma were obtained from 8
eyes undergoing enucleation for choroidal melanomas after informed
consent and in conformance with the tenets of the Declaration of
Helsinki. Immediately after enucleation all layers of the central and
mid-peripheral corneal epithelium within an area of approximately 8 mm
were removed by mechanical scraping. Within this area small samples of
the stroma were excised with a diamond blade. Tissue samples were
snap-frozen.
Cell Culture
Human corneas stored for less than 24 hours in Likorol
(ChauvinOpsia, Labege Cedex, France) at 4°C were obtained through
our eye bank. All corneas were of transplant quality but excluded from
clinical use for nonocular reasons according to international eye bank
criteria. Both epithelial and stromal cells were cultured on plastic
dishes as outgrowth cultures with slight modifications of a previously
described technique.17
For RNA extraction, explant
cultures were initiated and cultured in SHEM medium (1:1 mixture of
Dulbeccos modified Eagles medium, DMEM, and Hams nutrient mixture
F-10 with 10% fetal bovine serum, FBS; GIBCO, Grand Island, NY), 5
µg/ml insulin, and 10 ng/ml epidermal growth factor (EGF) without
antibiotics.18
19
The epithelial phenotype of cultures was
confirmed by staining with an antibody for cytokeratin K12. Because
this method only yielded a very limited amount of cells we also used an
SV 40adenovirustransformed corneal epithelial cell
line.18
Similar to normal corneal epithelium these cells
exhibit clonal growth characteristics and display a corneal epithelial
phenotype (including expression of keratin K12). The cell line was
cultured as previously described in SHEM medium.18
19
Stromal fibroblasts were cultured in DMEM + 10% FBS as described
previously.17
All experiments were performed in triplicate
and with cells obtained from different donors.
Isolation of Total RNA and mRNA Purification
Total RNA was isolated according to the guanidium
thiocyanatephenolchloroform extraction method20
by use
of an RNAgents total RNA isolation system kit (Promega, Madison, WI) as
previously described.17
For mRNA isolation a Promega
polyATtract system III was used as described previously.17
To minimize the risk of contamination by genomic DNA, mRNA samples were
digested by RNase-free DNase followed by phenol-chloroformisoamyl
alcohol extraction and isopropanol precipitation.
Polymerase Chain Reaction Primer Design and Reverse
TranscriptionPolymerase Chain Reaction
For polymerase chain reaction (PCR) primer design known
coding sequences were taken from GenBank (www.ncbi.nlm.nih.gov).
Because of the high structural similarity of the sequences of all the
known members of the neurotrophin gene families and the neurotrophin
tyrosine kinase receptor family, all sequences in open reading frames
were compared using the Clustal W multiple sequence alignment program
as described previously.17
Whenever possible, primers were
designed to span one or more introns in the genomic sequence: NGF,
sense, GAGGTGCATAGCGTAATGTCCA, and antisense, TCCACAGTAATGTTGCGGGTCT
(product of 233 bp; GenBank accession number: V01511, X52599); NT-3,
sense, TTACAGGTGAACAAGGTGATG, and antisense, GCAGCAGTTCGGTGTCCATTG
(product of 298 bp; GenBank accession number: M37763); NT-4, sense,
CTCTTTCTGTCTCCAGGTGCTCCG, and antisense, CGTTATCAGCCTTGCAGCGGGTTTC
(product of 464 bp; GenBank accession number: M86528); BDNF, sense,
GTGAGTTTGTGTGGACCCCGAG, and antisense, CAGCAGAAAGAGAAGAGGAGGC (product
of 373 bp; GenBank accession number: X60201, X91251); GDNF, sense,
GCCCTTCGCGTTGAGCAGTGAC, and antisense, GTCGTACGTTGTCTCAGCTGC (product
of 343 bp; GenBank accession number: NM000514); Trk A, sense,
GATGCTGCGAGGCGGACGGC, and antisense, CTGGCATTGGGCATGTGGGC (product of
570 bp; GenBank accession number: M23102); Trk B, sense,
TGCACCAACTATCACATTTCTCG, and antisense, CACAGACGCAATCACCACCACA (product
of 472 bp; GenBank accession number: S76473); Trk C, sense,
ACTTCGGAGCATTCAGCCCAGAG, and antisense, ACTCGTCACATTCACCAGCGTCAA
(product of 484 bp; GenBank accession number: S76475, U05012); and Trk
E, sense, AGGAGTACTTGCAGGTGGATC, and antisense, ACTGGAGAAGCTGTGGTTGCT
(product of 545 bp; GenBank accession number: X74979).
The first-strand cDNA was synthesized as previously
described.17
PCR was performed using 0.5 µl of
single-strand cDNA with 3 U Thermus aquaticus (Taq) DNA
Polymerase, a mixture of desoxyribonucleotides (in a final
concentration of 0.2 mM), 10x PCR buffer (5 µl), and 25 pmol of
upstream and downstream primers in a total volume of 50 µl (all
reagents from Takara Shuzo, Otsu, Shiga, Japan). The final
concentration of MgCl2 in the buffer was 1.5 mM. A PTC-100
programmable thermocycler (MJ Research, Watertown, MA) was used at
95°C for 3 minutes (predenaturation). Then 35 cycles were performed
including denaturation at 94°C for 1 minute, annealing at 55°C for
1 minute, and extension at 72°C for 1 minute.
The PCR products were size-fractionated by agarose gel electrophoresis
using 1.8% agarose 1x Tris-acetate-EDTA gels stained with 0.5
µg/ml ethidium bromide. All PCR fragments were cloned into pCR2.1
vector (Invitrogen, San Diego, CA), and sequences were confirmed by
standard methods.
DNA Dot Blot Analysis for Detection of the Level of Gene
Transcription in the Cultured Cornea
To get an estimation of the level of transcription in cultured
epithelial and stromal cells we performed a DNA dot blot analysis.
Because we could not culture sufficient quantities of human corneal
epithelial cells, we used a corneal epithelial cell line as a source of
corneal epithelium. Cloned PCR fragments corresponding to neurotrophic
factor family, and Trk receptors genes were amplified using the
above-mentioned primers and purified from agarose gels. A 0.1-µg
aliquot of PCR product was loaded onto nylon membranes as dot. To
generate the hybridization probe, 1 µg mRNA was isolated from
cultured epithelial and stromal cells and transcribed with a
digoxigenin probe synthesis mix (BoehringerMannheim, Mannheim,
Germany) to synthesize first-strand cDNA labeled with digoxigenin. DNA
blots were then prehybridized and hybridized with the
digoxigenin-labeled cDNA probe in DIG EasyHyb buffer
(BoehringerMannheim) at 40°C overnight. After posthybridization
washing, the blots were treated with the DIG washing kit from
BoehringerMannheim according to the manufacturers description and
exposed to ECL film (Amersham Life Science, Little Chalfont, UK). For
comparison, a cDNA fragment encoding for reduced
glyceraldehyde-phosphate dehydrogenase (GAPDH) was used as positive
control.
Investigation of Components of the MAP Kinase Signal Transduction
Pathways Induced by Neurotrophic Factors in the Cultured Cornea
To evaluate the effect of neurotrophic factors on the activation
of signal transduction pathways in cultured corneal epithelium and
stromal keratocytes, we performed Western blot analysis to investigate
the accumulation of phosphorylated MAP kinases ERK and JNK in the
presence of NGF, BDNF, and GDNF. Human stromal keratocytes were
cultured in RPMI 1640 medium containing L-glutamine
(glutaMAX) or DMEM with 10% FBS for 1 day and starved in serum-free
medium for another day. Cultures were then washed with
phosphate-buffered saline (PBS) and incubated in serum-free DMEM
without additives or with recombinant human NGF (200 ng/ml),
recombinant human BDNF (200 ng/ml), and recombinant human GDNF (200
ng/ml; all from R&D Systems, Minneapolis, MN) for 30 minutes. Some
cultures were incubated with an inhibitor of MAP kinase (PD 98059;
Torcris Cookson, Ballwin, MO) at 100 µM for 1 hour before exposure to
neurotrophins. After washing with PBS, cultured cells were solubilized
in lysis buffer containing 50 mM TrisCl (pH 8.0), 150 mM NaCl, 0.02%
sodium azide, 100 µg/ml phenylmethylsulfonyl fluoride, 1% Triton
X-100, and a mixture of several protease inhibitors (Complete, 1
tablet/50 ml buffer; BoehringerMannheim). Fifty micrograms total
protein per lane was fractionated by a 10% sodium dodecyl
sulfateMOPS NuPAGE Bis-tris gel (NOVEX, San Diego, CA) and
blotted onto nitrocellulose membrane. Membranes were stained with
diluted polyclonal antibodies against ERK 1, ERK 2, JNK 1, and JNK 2
(Santa Cruz Biotechnology, Santa Cruz, CA). We also used a polyclonal
antibody, which recognizes the activated form of either ERK 1 and ERK
2, that was raised against the catalytic core of the phosphorylated
threonine residue 183 and tyrosine residue 185 of the mammalian
ERK 2. Similarly, a polyclonal antibody recognizing the
phosphorylated form of JNK 1 and JNK 2 was used (both from Promega). As
the last step, the membranes were visualized with the ECL Western blot
analysis system (Amersham Life Science).
Investigation of the Effect of Neurotrophic Factors on
Proliferation of Corneal Epithelial and Stromal Cells
To evaluate the effect of neurotrophic factors on corneal
proliferation, recombinant human NGF, BDNF, and GDNF were used (R&D
Systems) and the effect compared with that of recombinant human EGF
(Sigma, St Louis, MO). To evaluate the effect on corneal
epithelial proliferation, a single cell clonal growth model was used
that allows one to determine the effects of a given growth factor on
both colony formation and clonal expansion.21
We were not
able to reproduce quantification of the proliferation of human
epithelial cells in this model due to a shortage of good donor
material. We therefore used rabbit cells which also allows one to
compare the data with previous reports in the literature. New Zealand
white rabbits were housed and treated according to the ARVO Resolution
for the Use of Animals in Ophthalmic and Vision Research and under
observation of German federal laws and the laws of the State of
BadenWürttemberg. Before they were killed with an intravenous
overdose of pentobarbital, the rabbits received an intramuscular
injection of xylazine hydrochloride and ketamine hydrochloride. The
details of the clonal growth assay have been described
previously.21
Five thousand viable cells were seeded in
each 60-mm dish in serum-free medium MCDB 151 with a supplement
of insulin (5 µg/ml), transferrin (5 µg/ml), selenium (5 ng/ml),
and hydrocortisone (5 µg/ml; all from Sigma). This seeding density
resulted in a single cell clonal growth that could be quantified under
the phase contrast microscope (on day 6) by determination of the number
of colonies per dish and the number of cells per colony. This
quantification was facilitated by use of dishes that contained a grid
on the bottom that was roughly 2-mm wide (Sarstedt, Newton, NC). For
data collection the entire surface areas of four randomly selected
dishes for each condition were screened. Furthermore, the number of
cells per colony was determined in 75 randomly selected colonies for
each condition. To stimulate cellular proliferation, NGF (50 or 200
ng/ml), BDNF (50 or 200 ng/ml), GDNF (50 or 200 ng/ml), or EGF (10
ng/ml) was added to the medium. To get an estimation about the rate of
proliferation after 12 days (a time when neighboring colonies started
to grow into each other and therefore prevented numerical
quantification) dishes were fixed in -20°C methanol and stained with
methylene blue.
To investigate the effect of neurotrophic factors on the proliferation
of cultured stroma, keratocytes were passaged from DMEM + 10% FBS into
DMEM + 1% FBS or in DMEM without FBS at a density of 5 x
104 cells/60-mm dish. Some cultures received recombinant
human NGF, BDNF, or GDNF in concentrations as shown above.
Proliferation was measured after 6 days by counting cells under the
phase contrast microscope (50 fields at 100x per condition) as well as
trypsinized cells. Also a CellTiter 96AQueous One Solution
proliferation assay was performed according to the manufacturers
description (Promega). For this colorimetric assay 500 or 1000 cells
were grown for 6 days in 96-well plates (Falcon). On addition to the
culture well a tetrazolium dye is bioreduced by cells into a colored
formazan product and the absorbance is quantified at 490 nm. The
quantity of the formazan product should be proportional to the number
of living cells in the well and can therefore serve to estimate
proliferation.
Statistical Analysis
All experiments examining the effect of neurotrophic factors on
corneal proliferation were performed in triplicate with cells from
different donors. The influence of growth factors on colony formation,
colony size, and cell number was studied using one-way ANOVA. The log
transformation was used as necessary to affect homogeneity of variance
and normality in these data. Students t-test was used to
determine which differences were significant after ANOVA.
 |
Results
|
|---|
Transcription of Neurotrophic Factors in the Human Cornea
The transcription of neurotrophic factors was detected in freshly
harvested cells from human corneal epithelium (Fig. 1A
) and stroma (Fig. 1B) by reverse transcriptionpolymerase chain
reaction (RTPCR). In Figure 1A
the result of a representative RTPCR
shows that the specific cDNA fragments of NGF (lane 1, 233 bp), NT-3
(lane 2, 298 bp), NT-4 (lane 3, 464 bp), and BDNF (lane 4, 373 bp)
could be amplified from ex vivo human corneal epithelium. However, we
could not detect transcription of GDNF (lane 5) using the primers shown
in the Methods section. This result has been confirmed by three
independent experiments using cDNA from primary cultured epithelial
cells and a human corneal epithelial cell line immortalized with SV
4018
(data not shown). In contrast, ex vivo corneal stroma
contained mRNA encoding for the above-mentioned proteins including GDNF
(lane 5, 343 bp) as shown in Figure 2
. However, we could not detect transcription of NT-4 (lane 3) using the
primers shown in the Methods section. The results of the RTPCR were
identical when cDNA from cultured corneal stromal keratocytes was used
(data not shown).

View larger version (32K):
[in this window]
[in a new window]
|
Figure 1. Shown are results of agarose gel electrophoresis (1.8%) of PCR
products amplified from the cDNA generated from mRNA extracted from ex
vivo corneal epithelium (A) and stroma (B)
stained with ethidium bromide. Both epithelium and stroma expressed NGF
(233 bp; lane 1), NT-3 (298 bp; lane 2)
and BDNF (373 bp; lane 4). NT-4 (464 bp; lane
3) was expressed only in corneal epithelium. GDNF (343 bp;
lane 5) was expressed only in corneal stroma. M, DNA
molecular weight marker (Phi x 174 DNA/HinfI
fragments).
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Figure 2. Shown are results of agarose gel electrophoresis (1.8%) of PCR
products amplified from the cDNA generated from mRNA extracted from ex
vivo corneal epithelium (A) and stroma (B)
stained with ethidium bromide. Both epithelium and stroma expressed Trk
A (570 bp; lane 1), Trk B (472 bp; lane
2), Trk C (484 bp; lane 3), and Trk E (545 bp;
lane 4). M, DNA molecular weight marker (Phi x 174
DNA/HinfI fragments).
|
|
All the above-mentioned PCR products were cloned into Escherichia
coli and sequenced. Comparison of the resulting DNA sequences with
known genes via the blast search program of GenBank revealed a 100%
sequence identity with the expected neurotrophic factors in all
experiments. Likewise, there were only very low scores of sequence
homology to other known genes (data not shown).
Transcription of Tyrosine Kinase Receptors Specific for
Neurotrophic Factors in the Human Cornea
The ex vivo corneal epithelium (Fig. 2A)
and stroma (Fig. 2B)
also
contained mRNA encoding for tyrosine kinase receptors that are
necessary for binding and signal transduction of neurotrophic factors.
Figure 2A
shows the RTPCR result after amplification of cDNA
fragments specific for Trk A (lane 1, 570 bp), Trk B (lane 2, 472 bp),
Trk C (lane 3, 484 bp), and Trk E (lane 4, 545 bp) from ex vivo corneal
epithelium. Figure 2B
indicates the same result using mRNA from ex vivo
corneal stroma. When cultured corneal epithelial cells (primary
cultures or corneal epithelial cell line) or cultured stromal
keratocytes were used, the spectrum of RTPCR was not changed (data
not shown). All these Trk gene fragments have also been cloned,
sequenced, and analyzed by the blast search program for further
confirmation.
Level of Transcription of Neurotrophic Factors and Corresponding
Tyrosine Kinase Receptors in Cultured Human Corneal Epithelium
and Stromal Keratocytes
To confirm the results of the initial PCR and to get an estimation
about the level of gene transcription, we performed a DNA dot blot
analysis (Fig. 3)
. Because the hybridization probe for the DNA dot blot was first-strand
cDNA generated from 1 µg mRNA of cultured epithelial cells or stromal
keratocytes, the result of the DNA dot blot allows one to estimate and
compare the transcription level of neurotrophic factors and
corresponding tyrosine kinase receptors in different cells. Figure 3A
shows the spectrum of the transcription levels of neurotrophic factors
and corresponding tyrosine kinase receptors in the human corneal
epithelial cell line. The transcriptions of NGF (lane 1), BDNF (lane
4), and Trk E (lane 9) were significantly weaker than those of the
other neurotrophic factors and tyrosine kinase receptors. The levels of
transcription of NT-3 (lane 2), NT-4 (lane 3), Trk A (lane 6), Trk B
(lane 7), and Trk C (lane 8) were lower than that of GAPDH, which was
used as a positive control (lane 10). No transcription of GDNF (lane 5)
was detected in the DNA dot blots from cultured corneal epithelial
cells. Furthermore, Figure 3B shows that transcription of NT-4 (lane
3), which was clearly present in corneal epithelial cells, could not be
detected in cultured stromal keratocytes. In contrast GDNF (lane 4)
that was not transcribed in epithelial cells showed a positive signal
in cultured stromal keratocytes. The level of transcription of the
remaining neurotrophic factors and tyrosine kinase receptors in stromal
cells was approximately the same as in corneal epithelial cells. This
result confirmed the data obtained from RTPCRs as shown in Figures 1
and 2
.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 3. Level of transcription of neurotrophic factors and corresponding
tyrosine kinase receptors in cultured human corneal epithelial cells
(A) and stromal keratocytes (B). Each DNA dot
shown in lanes 1 through 10 represents
0.1 µg PCR product specific for NGF (lane 1), NT-3
(lane 2), NT-4 (lane 3), BDNF
(lane 4), GDNF (lane 5), Trk A
(lane 6), Trk B (lane 7), Trk C
(lane 8), Trk E (lane 9), and GAPDH
(lane 10). In concordance with the results shown in
Figure 1
, the transcription of NT-4 was only detectable in cultured
human corneal epithelial cell line, and the transcription of GDNF was
only detectable in cultured human corneal stromal keratocytes. For
comparison, lane 10 represents GADPH as positive
control, which shows the strongest signal. NT-3, NT-4, Trk A, Trk B,
and Trk C showed a higher level of transcription than NGF, BDNF, GDNF,
and Trk E in corneal cells.
|
|
Effect of Neurotrophic Factors on the Phosphorylation of MAP Kinase
in Cultured Corneal Epithelium and Stromal Keratocytes
The activation of the MAP kinase signaling cascade is essential
for mediating the effect of various growth factors on cellular
proliferation and differentiation. Therefore, the intracellular
accumulation of phosphorylated MAP kinases ERK and JNK is an indication
for the activation of the MAP kinase pathway in response to
neurotrophic factors. To correlate the investigation of the signal
transduction with the results of the functional analysis, we studied
the induction of members of the MAP kinase cascade in human corneal
epithelium and stroma. To ensure that the signals corresponded to
phosphorylation we also used the inhibitor PD 98059, which inhibits MAP
kinase. Figure 4A
shows that the phosphorylated forms of ERK 1 and 2 can be induced in
cultured human epithelial cells. As compared with the serum-free
control medium (lane 7) 200 ng NGF induced phosphorylation of ERK 1,
and to a lesser extent of ERK 2 (lane 1). This induction was prevented
by addition of the inhibitor PD 98059. The levels of phosphorylated ERK
1and ERK 2 were also increased by BDNF (200 ng/ml; lane 3), but this
increase was not inhibited by PD 98059. Similar to NGF, GDNF (200
ng/ml) also induced phosphorylation of ERK 1 and ERK 2 (lane 5), and
this effect could also be prevented by PD 98059. Data presented in
Figures 4B 4C
and 4D
show the same expression level of total
(phosphorylated and nonphosphorylated) ERK 1 and ERK 2 (Fig. 4B)
,
activated JNK 1 and JNK 2 (Fig. 4C)
, and total (phosphorylated and
nonphosphorylated) JNK 1 and JNK 2 (Fig. 4D)
in human corneal
epithelial cells when incubated with or without the neurotrophic
factors under investigation. This result indicates that phosphorylation
of ERK1 and ERK 2 (but not JNK 1 or JNK 2) can be induced by NGF, GDNF,
and BDNF in cultured rabbit corneal epithelial cells.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 4. Effect of neurotrophic factors on phosphorylation of MAP kinase in
cultured rabbit human corneal epithelium. Western blot analysis with
antibodies against phosphorylated ERK 1 (44 kDa) and ERK 2 (42 kDa;
A), total ERK 1 and ERK 2 (phosphorylated and
nonphosphorylated; 44 and 42 kDa; B), phosphorylated JNK 1
(46 kDa), and JNK 2 (54 kDa; C) and against total JNK 1 and
JNK 2 (phosphorylated and nonphosphorylated; 46 and 54 kDa;
D) demonstrated that phosphorylated ERK 1, and to a lesser
extent ERK 2, was induced in human epithelial cells cultured in NGF
(lane 1), BDNF (lane 3), or GDNF
(lane 5) in comparison to cells cultured in serum-free
control medium (lane 7). Phosphorylation of ERK 1 by NGF
and GDNF but not by BDNF was inhibited by addition of the MEK inhibitor
PD 98059 (lanes 2, 6, and 4,
respectively). In contrast JNK 1/2 were not induced by NGF (lane
1), BDNF (lane 2), or GDNF (lane
3) compared with the control (lane 4).
|
|
Figure 5
shows that the effect of neurotrophic factors on phosphorylation of MAP
kinases is different in cultured human corneal stromal keratocytes.
Data presented in Figure 5A
indicate that in comparison to the control
in stromal keratocytes (lane 7) phosphorylation of ERK 1, and to a
lesser extent of ERK 2, was induced by 200 ng/ml NGF (lane 1), and this
increase was inhibited by PD 98059 (lane 2). In contrast 200 ng/ml BDNF
did not induce phosphorylation of ERK 1 or ERK 2 compared with the
control (lane 3) and remained unchanged with PD 98059 (lane 4). GDNF
(200 ng/ml) induced ERK 1 (lane 5), and this increase was inhibited by
PD 98059 (lane 6). Figure 5B
shows the same level of total ERK in
stromal keratocytes cultured either in serum-free medium or with the
neurotrophic factors under investigation. Compared with ERK 1, the
expression of both activated JNK 1 and JNK 2 in stromal keratocytes was
relatively weak. There were slight differences concerning the
expression of activated JNK 1, which was lower in cells cultured in
serum-free DMEM (lane 4) than in cells stimulated with NGF (lane 1),
BDNF (lane 2), or GDNF (lane 3). Among the neurotrophic factors, BDNF
seemed to have the strongest effect on the activation of JNK 1 (lane
2). Activated JNK 2 in stromal keratocytes was not induced by
neurotrophic factors (Fig. 5C)
. Figure 5D
shows that the expression of
total JNK 1 and JNK 2 was the same in stromal keratocytes
regardless of the culture conditions. This result indicates that NGF,
GDNF, and BDNF have different effects on the accumulation of
phosphorylated forms of ERK 1 and JNK 1 in cultured human corneal
stromal keratocytes.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 5. Effect of neurotrophic factors on phosphorylation of MAP kinase in
cultured human corneal stromal keratocytes. Western blot analysis with
antibodies against phosphorylated ERK 1 (44 kDa) and ERK 2 (42 kDa;
A), total ERK 1 and ERK 2 (phosphorylated and
nonphosphorylated; 44 and 42 kDa; B), phosphorylated JNK 1
(46 kDa) and JNK 2 (54 kDa; C), and total JNK 1 and JNK 2
(phosphorylated and nonphosphorylated; 46 and 54 kDa; D)
demonstrate that phosphorylation of ERK 1, and to a lesser extent of
ERK 2, was induced by NGF (lane 1) and GDNF (lane
5) in comparison to serum-free control medium (lane
7) or BDNF (lane 3). Phosphorylation of ERK 1 by
NGF and GDNF was inhibited by addition of the MEK inhibitor PD 98059
(lanes 2 and 6). Phosphorylation of JNK 1
(C) was weakly induced by NGF (lane 1), BDNF
(lane 2), and GDNF (lane 3) compared with
serum-free medium (lane 4).
|
|
Functional Role of Neurotrophic Factors in Cultured Corneal
Epithelia and Stroma
All the neurotrophic factors under investigation had a significant
effect on the proliferation of corneal epithelial cells: As shown in
Figure 6A the number of colonies per dish increased significantly on the
addition of recombinant human NGF (200 ng, P > 0.05),
BDNF (200 ng, P < 0.05), or GDNF (50 ng,
P < 0.05, and 200 ng, P < 0.0001).
This indicates that the ability of corneal epithelial cells to form
colonies was enhanced by NGFs. However, this effect was much smaller
than that of EGF, a growth factor that uses a signal transduction
pathway similar to that of NGF as shown in Figure 6B
. Perhaps more
important is the effect on the clonal proliferation, which is reflected
by the number cells within each colony (Fig. 7)
. As previously demonstrated, corneal epithelial cells were
continuously entering cellular proliferation, which on day 6 resulted
in a spectrum of colonies, ranging from very small colonies to very
large colonies. This observation explains the relatively large SD and
the requirement to count a large number of colonies (75) in each dish
to obtain statistically meaningful data. The clonal proliferation of
corneal epithelial cells was significantly stimulated by both
recombinant NGF (50 and 200 ng/ml, P < 0.001) and GDNF
(50 and 200 ng/ml, P < 0.001) as shown in Figure 7A
.
However, the addition of BDNF to the culture medium did not result in a
significant increase in the number of cells per colony compared with
the control (Fig. 7A)
. Again, the magnitude of the stimulatory effect
on corneal epithelial proliferation was much smaller than that of EGF
as shown in Figure 7B
. These findings were observed not only on day 6
but also on day 12, a time point when neighboring colonies became
confluent, thus precluding a numerical analysis. Figure 8
shows representative dishes stained with crystal violet. In
serum-free control medium (Fig. 8A) only very few and very small
colonies could be detected. In the presence of EGF, the number and size
of the colonies had significantly increased (Fig. 8B)
. Similarly, but
to a much weaker extent, the presence of NGF in a low concentration of
50 ng/ml led to an increase in number and size of colonies that became
more obvious at a concentration of 200 ng/ml (Fig. 8D) . In contrast
neither 50 ng/ml nor 200 ng/ml BDNF led to a detectable increase in
size or number of colonies in comparison to the serum-free control
(Figs. 8E
and 8F)
. Similar to NGF, GDNF in concentrations of 50 or 200
ng/ml also slightly enhanced the number and size of the colonies on day
12 (Figs. 8G
and 8H) . In summary, both NGF and GDNF stimulated the
clonal proliferation of corneal epithelial cells, whereas BDNF had no
effect.

View larger version (12K):
[in this window]
[in a new window]
|
Figure 6. Effect of recombinant human NGF, BDNF, and GDNF (A) and EGF
(B) on the colony formation of primary rabbit corneal
epithelial cells on day 6 (mean values and standard deviations). Cells
were cultured in a clonal density in supplemented serum-free MCDB.
Addition of 200 ng/ml NGF, 200 ng/ml BDNF, or 200 ng/ml GDNF resulted
in a statistically significant (P < 0.005,
asterisks) increase of the total number of colonies. The
effect of 10 ng/ml EGF on colony formation was significantly greater
than the effect of the neurotrophic factors.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Figure 7. Effect of recombinant human NGF, BDNF, and GDNF (A) and EGF
(B) on the clonal proliferation of primary rabbit corneal
epithelial cells on day 6 (mean values and standard deviations). Cells
were cultured in a clonal density in supplemented serum-free MCDB.
Addition of NGF (50 or 200 ng/ml) or of GDNF (50 or 200 ng/ml) but not
of BDNF (50 or 200 ng/ml) resulted in a statistically significant
(P < 0.005, asterisks) increase in
the number of cells per colony. The effect of 10 ng/ml EGF on clonal
proliferation was significantly greater than the effect of the
neurotrophic factors.
|
|

View larger version (66K):
[in this window]
[in a new window]
|
Figure 8. Effect of recombinant human NGF, BDNF, and GDNF and EGF on
proliferation of primary rabbit corneal epithelial cells on day 12.
Cells were cultured in a clonal density in serum-free MCDB medium, and
dishes were stained with crystal violet. In control medium
(A) colonies were small and barely visible. In the presence
of 10 ng/ml EGF (B) large colonies developed. NGF at a
concentration of 50 ng/ml (C) or 200 ng/ml (D)
dose-dependently increased the size of colonies over the control. In
contrast BDNF did not stimulate clonal proliferation at 50 ng/ml
(E) or 200 ng/ml (F). GDNF only slightly enhanced
colony size at 50 ng/ml (G) but led to a significant
increase in colony size at 200 ng/ml (H). Both NGF and GDNF
failed to enhance clonal proliferation as much as EGF.
|
|
In contrast to the stimulatory effect on corneal epithelial
proliferation, the neurotrophic factors under investigation slightly
inhibited the proliferation of human keratocytes when DMEM + 1% FBS
was used as control (data not shown). However, when serum-free DMEM was
used as control, the addition of either 20 or 100 ng/ml NGF, GDNF, or
BDNF significantly enhanced the proliferation of stromal keratocytes
(P < 0.005) as shown in Figure 9
. These data indicate that members of the neurotrophin family can
enhance the proliferation of human stromal keratocytes in serum-free
medium.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 9. Effect of recombinant human NGF, BDNF, and GDNF on proliferation of
primary human corneal stromal cells on day 6. After culture in DMEM +
10% FBS, cells were plated at a low density in DMEM without FBS as
processed (mean and SD). All neurotrophic factors led to a
statistically significant induction of absorbance, which reflects the
cell density compared with the control (P < 0.005,
asterisks).
|
|
 |
Discussion
|
|---|
Several lines of evidence suggest that corneal nerves are
important for corneal function: Dysfunction of the sensory innervation
for various reasons causes breakdown of the corneal epithelium and
ulceration.22
23
24
25
Such neurotrophic ulcers can be
experimentally induced, and the assumption has been made that corneal
nerves might release factors that are important for corneal
function.22
26
More specifically, NGF can
regulate corneal sensitivity in mice which lack high-affinity NGF
receptors display impaired corneal sensitivity.27
28
Because NGF can heal human neurotrophic ulcers it might be released
from corneal nerves to modulate proliferation of corneal epithelial
cells.16
However, transcription of neurotrophins in
sensory nerve endings within the cornea has not been proven.
Neurotrophins might also derive from other sources such as tears
because NGF can be transcribed in lacrimal glands.29
Data
from the present study indicate that four cytokines encoded by the
neurotrophin gene family (NGF, NT-3, NT-4, and BDNF) and corresponding
receptors (Trk AE) are present in the cornea. Furthermore, we found
that GDNF, a member of the TGF-ß gene family that is related to
neurotrophins,9
10
is also expressed. These
findings suggest that cytokines with pronounced effects on neuronal
cells are also members of the corneal cytokine network.
Corneal cytokines have been classified on the basis of their
expression.2
30
Although most growth factors are expressed
in both stroma and epithelium some are confined to only one cell type.
These cytokines might be of importance for the interaction between
epithelium and stroma.31
Hepatocyte and keratocyte growth
factors (HGF and KGF, respectfully), two paracrine mediators of
epithelial function are expressed exclusively in stromal
keratocytes.2
30
32
33
We have recently shown that growth
and differentiation factor-5 (GDF-5), a member of the TGF-ß family,
is also exclusively expressed in stromal keratocytes.17
In
contrast to HGF and KGF, which stimulate corneal epithelial
proliferation, GDF-5 was inhibitory. Our present data suggest that
another member of the TGF-ß family, GDNF is also exclusively
expressed in stromal keratocytes but stimulates proliferation of
corneal epithelial cells. As with GDF-5 the proliferation of stromal
keratocytes was not significantly affected by GDNF, which suggests a
role as epithelial modulator. In contrast, NT-4 was exclusively
expressed in epithelial cells. Therefore, this growth factor belongs to
the same group of cytokines as transforming growth factor-
(TGF-
), interleukin-1ß (IL-1ß), and platelet-derived growth
factor-B (PDGF-B), which are also exclusively expressed in the corneal
stroma.2
Interestingly, both TGF-
and IL-1ß can
upregulate the transcription of neurotrophins, such as NGF in 3T3 mouse
fibroblasts.34
Although we did not carry out a functional
characterization of either NT-3 or NT-4, the latter cytokine might be
important for the regulation of stromal keratocytes.
Our results suggest a functional role of neurotrophins in the cornea.
This is supported by the effects of neurotrophins on other tissues
outside the central nervous system like, for example, the skin. NGF is
produced in murine and human keratocytes, and mRNA and protein for NGF
were detected in the wound margin.35
36
37
In skin organ
cultures NGF increased proliferation.38
Furthermore, NGF
accelerates the rate of wound contraction and healing in normal and
diabetic mice.37
39
These findings indicate that NGF plays
an important role in cutaneous wound healing. NGF might also modulate
corneal wound healing, and its expression might be upregulated in the
context of wounding. This hypothesis is supported by recent
observations in rats that demonstrated a transient increase in corneal
NGF levels after wounding and by a rabbit model in which exogenous NGF
stimulated the rate of corneal wound healing.14
40
During
corneal wound healing several cytokines are released and modulate
epithelial and stromal cells. One of the most versatile modulatory
cytokines is IL-1,41
which has been shown to upregulate
the synthesis of NGF in cultured rat fibroblasts and keratinocytes and
therefore provides a possible link between wounding and NGF
expression.37
42
Also cutaneous wounding of mice leads to
an increase in the NGF production of the salivary gland, which results
in increased serum levels.37
Although NGF has not been
demonstrated in tears, corneal wounding might lead to an increase of
NGF and possibly other neurotrophins in the lacrimal gland.
In human keratinocytes the proliferative effect of NGF has shown to be
mediated by high affinity Trk receptor.35
Protein for the
Trk A receptor has been detected previously only on corneal epithelial
cells and not in the stroma.16
In contrast, our results
indicate that ex vivo and cultured stromal cells express mRNA encoding
for Trk A and that the expression level in both cell types is similar.
Furthermore, corneal epithelial and stromal cells possess high affinity
receptors for all members of the neurotrophin family. These receptors
mediate physiological functions such as the observed mitogenic effect
on corneal epithelial cells. A comparison of the mitogenic effect of
NGF with that of other growth factors (e.g., EGF) shows that NGF has
only a weak effect. In contrast, NGF seems to have a significant
(therapeutic) in vivo effect. This raises the question of its mode of
action, including the mechanism of signal transduction. NGF and other
neurotrophins may not only modulate transcription of cytokines but also
modulate apoptosis of corneal epithelial cells.37
43
The
latter hypothesis is based on the finding that the ERK and JNK signal
transduction pathways can have opposing effects on
apoptosis.44
Binding of members of the neurotrophin gene family to tyrosine kinase
receptors activates several distinct signaling pathways mediated by MAP
kinases45
46
: The Ras/ERK pathway involves activation of
MAP kinase and ERK 1, ERK 2, or both, which then leads to the
phosphorylation of a given transcription factor (such as Elk-1 or
SAP-1).47
The second pathway dependent on MAP kinase
involves phosphorylation of JNK 1, JNK 2, or both and is distinct from
the ERK pathway because it phosphorylates transcription factors (such
as Jun) at a different S/T-P motif.46
Each of the possible
ligands of the membranous tyrosine kinase receptor can induce a
different signaling cascade, and the exact composition of the cascade
also depends on the cell type. In PC 12 cells and oligodendrocytes NGF
has shown to bind to the Trk A receptor and to phosphorylate ERK 1 but
not ERK 2.48
49
Similarly, our results demonstrate that
NGF, BDNF, and GDNF predominantly phosphorylate ERK 1. The latter might
induce additional signaling pathways such as, for example, the
phosphatidylinositol-3 kinase pathway.50
Interestingly,
NGF, BDNF, and GDNF, which can phosphorylate JNK also in other
cells,51
have more effect on stromal than on epithelial
JNK.
Further analysis of the signal transduction pathways might define the
role of neurotrophic factors within the cytokine network of the cornea.
Both NGF and EGF induce the MAP kinase cascade but differ in their
effect on proliferation of the corneal epithelium. One possible
explanation might be that different components of the MAP kinase system
can lead to transcription of factors with opposing physiological
effects. One of the initial steps in the MAP kinase cascade is the
phosphorylation of the oncogenes Ras and Raf before activation of ERK
or JNK.52
53
Both Ras and Raf can induce transcription of,
for example, TGF-ß,54
and NGF can increase transcription
and secretion of TGF-ß1 in nonocular cells.55
TGF-ß
inhibits corneal epithelial cell proliferation.13
56
Furthermore, not only TGF-ß1 through TGF-ß3 but also bone
morphogenetic proteins, growth, and differentiation factors,
activins/inhibins, and receptors are transcribed in the
cornea.17
57
58
Although it has not been demonstrated that
NGF induces transcription of other cytokines in corneal epithelial
cells, neurotrophins might induce TGF-ß family members. This might
explain the difference in the effects of neurotrophins and EGF on
corneal epithelial proliferation. In addition, downstream components of
the MAP kinase cascade can interfere with other signaling
systems. Activation of ERK induced by EGF also results in
phosphorylation of signaling components induced by TGF-ß such as the
protein "similar to mothers against decapentaplegic-1"
(Smad-1).59
60
In response to members of the TGF-ß super
family, the carboxyl-terminal domain of Smads is essential for the
phosphorylation of Smad 1,5 or Smad 2 and 3, association with
Smad 4, translocation into the nucleus, and transcriptional
response.61
62
63
It has been suggested that the Smad and
JNK signaling pathways converge at AP1-binding promoter sites of
several genes.64
Further investigations are needed to
determine possible links between the NGF signaling and TGF-ß
signaling pathways in cells of the cornea.
 |
Acknowledgements
|
|---|
The authors thank Brigitte Sinn for experienced help with cell
culture and proliferations assays; Kaoru Sasaki from Toyonaka Municipal
Hospital, Osaka, Japan, and Kazuo Tsubota and Shigeto Simmura from the
Department of Ophthalmology, Tokyo Dental College, Chiba, Japan, for
the generous gift of the SV 40transformed human corneal cell line;
Scheffer Tseng and DeQuan Li, Bascom Palmer Eye Institute, Miami,
Florida, for the GAPDH-cDNA probe; and Klaus Rohrschnieder for
statistical analysis and helpful discussion.
 |
Footnotes
|
|---|
Supported by Deutsche Forschungsgemeinschaft Kr 993/12-1, Gertrud Kusen Stiftung, Hamburg and the State of BadenWürttemberg, Germany (118/96).
Submitted for publication April 29, 1999; revised August 2, 1999; accepted September 8, 1999.
Commercial relationships policy: N.
Corresponding author: Friedrich E. Kruse, Augenklinik der Universität Heidelberg, INF 400, 69120 Heidelberg, Germany. friedrich_kruse{at}med.uni-heidelberg.de
 |
References
|
|---|
-
Rosenbaum, J. (1993) Cytokines: the good, the bad, and the unknown Invest Ophthalmol Vis Sci 34,2389-2391[Free Full Text]
-
Li, DQ, Tseng, SCG (1995) Three patterns of cytokine expression potentially involved in epithelial-fibroblast interaction of human ocular surface J Cell Physiol 163,61-79[Medline][Order article via Infotrieve]
-
Lambiase, A, Rama, P, Bonnini, S, Capriogglio, G, Aloe, L. (1998) Topical treatment with nerve growth factor for corneal neurotrophic ulcers N Engl J Med 33,1174-1180
-
Ebendal, T. (1992) Function and evolution in the NGF family and its receptors J Neurosci Res 32,461-470[Medline][Order article via Infotrieve]
-
Barbacid, M. (1995) Neurotrophic factors and their receptors Curr Opin Cell Biol 7,148-155[Medline][Order article via Infotrieve]
-
Barbacid, M. (1994) The Trk family of neurotrophin receptors J Neurobiol 25,1386-1403[Medline][Order article via Infotrieve]
-
DiMarco, E, Cutuli, N, Guerra, L, Cancedda, R, DeLuca, M. (1993) Molecular cloning of a novel trk-related putative tyrosine kinase receptor isolated from normal human keratinocytes and widely expressed by normal human tissues J Biol Chem 268,24290-24295[Abstract/Free Full Text]
-
Chao, MV (1994) The p75 neurotrophin receptor J Neurobiol 25,1373-1385[Medline][Order article via Infotrieve]
-
McDonald, NQ, Hendrickson, WA (1993) A structural superfamily of growth factors containing a cysteine knot motif Cell 73,421-424[Medline][Order article via Infotrieve]
-
Lin, LF, Doherty, DH, Lile, JD, Bektesh, S, Collins, F. (1993) GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons Science 260,1130-1132[Abstract/Free Full Text]
-
Massague, J, Attisano, L, Wrana, L. (1997) The TGF-ß family and its composite receptors Trends Cell Biol 4,172-178
-
Lindsay, RM, Wiegand, SJ, Altar, CA, DiStefano, PS (1994) Neurotrophic factors: from molecule to man Trends Neurosci 17,182-190[Medline][Order article via Infotrieve]
-
Kruse, FE, Tseng, SCG (1993) Growth factors modulate clonal growth and differentiation of cultured rabbit limbal and corneal epithelium Invest Ophthalmol Vis Sci 34,1963-1976[Abstract/Free Full Text]
-
GenerGalbis, C, MartinezSoriano, F, Hernandez Gil de Tejada, T (1993) The effect of NGF on corneal wound healing in rabbit [ARVO Abstract] Invest Ophthalmol Vis Sci 34(4),S1315Abstract nr 3013
-
Lambiase, A, Bonini, S, Bonini, S, et al (1995) Increased plasma levels of nerve growth factor in vernal keratoconjunctivitis and relationship to conjunctival mast cells Invest Ophthalmol Vis Sci 36,2127-2132[Abstract/Free Full Text]
-
Lambiase, A, Bonini, S, Micera, A, Rama, P, Bonini, S, Aloe, L. (1998) Expression of nerve growth factor receptors on the ocular surface in healthy subjects and during manifestation of inflammatory diseases Invest Ophthalmol Vis Sci 39,1272-1275[Abstract/Free Full Text]
-
You, L, Kruse, FE, Pohl, J, Völcker, HE (1999) Bone morphogenetic proteins and growth and differentiation factors in the human cornea Invest Ophthalmol Vis Sci 40,296-311[Abstract/Free Full Text]
-
ArakiSasaki, K, Ohashi, Y, Sasabe, T, et al (1995) An SV 40-immortilized human corneal epithelial cell line and its characterization Invest Ophthalmol Vis Sci 36,614-621[Abstract/Free Full Text]
-
Shimmura, S, Tsubota, K. (1997) Ultraviolet B-induced mitochondrial dysfunction is associated with decreased cell detachment of corneal epithelial cells in vitro Invest Ophthalmol Vis Sci 38,620-626[Abstract/Free Full Text]
-
Chomczynski, P, Sacchi, N. (1987) Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal Biochem 162,156-159[Medline][Order article via Infotrieve]
-
Kruse, FE, Tseng, SCG (1991) A serum-free clonal growth assay for limbal, peripheral and central corneal epithelium Invest Ophthalmol Vis Sci 32,2086-2095[Abstract/Free Full Text]
-
Verhoef, FH (1925) The cause of keratitis after gasserian ganglion operations Am J Ophthalmol 8,273-275
-
Paton, L. (1926) The trigeminal and its ocular lesions Br J Ophthalmol 10,305-342[Free Full Text]
-
Epstein, DL, Paton, D. (1968) Keratitis from misuse of corneal anesthetics N Engl J Med 278,396-399
-
Holland, EJ, Schwartz, GS (1999) Classification of herpes simplex virus keratitis Cornea 18,144-154[Medline][Order article via Infotrieve]
-
Beuerman, RW, Schimmelpfennig, B. (1980) Sensory denervation of the rabbit cornea affects epithelial properties Exp Neurol 69,196-201[Medline][Order article via Infotrieve]
-
De Castro, F, SilosSantiago, I, Lopez de Armentia, M, Barbacid, M, Belmonte, C. (1995) Corneal innervation in mice lacking nerve growth factor (NGF) receptor (trkA knockouts) [ARVO Abstract] Invest Ophthalmol Vis Sci 36(4),S574Abstract nr 2668
-
Crouch, DS, Davis, BM, Albers, KM, Rickman, DW (1995) Nerve growth factor regulation of corneal sensory innervation [ARVO abstract] Invest Ophthalmol Vis Sci 36(4),S574Abstract nr 2669
-
Nguyen, DH, Beuerman, RW, Thompson, HW, DiLoreto, A. (1997) Growth factor and neurotrophic factor mRNA in human lacrimal gland Cornea 16,192-199[Medline][Order article via Infotrieve]
-
Li, DQ, Tseng, SCG (1996) Differential regulation of cytokine and receptor transcript expression in human corneal and limbal fibroblasts by epidermal growth factor, transforming growth factor-
, platelet-derived growth factor B, and interleukin-1ß Invest Ophthalmol Vis Sci 37,2068-2080[Abstract/Free Full Text]
-
Wison, SE, Liu, JJ, Mohan, RR (1999) Stromal-epithelial interactions in the cornea Prog Retin Eye Res 18,293-309[Medline][Order article via Infotrieve]
-
Sotozono, C, Kinoshita, S, Kita, M, Imanishi, J. (1994) Paracrine role of keratinocyte growth factor in rabbit and corneal epithelial cell growth Exp Eye Res 59,385-392[Medline][Order article via Infotrieve]
-
Li, Q, Weng, J, Mohan, RR, et al (1996) Hepatocyte growth factor and hepatocyte growth factor receptor in the lacrimal glands, tears and cornea Invest Ophthalmol Vis Sci 37,727-739[Abstract/Free Full Text]
-
Hattori, A, Iwasaki, S, Murase, K, et al (1994) Tumor necrosis factor is markedly synergistic with interleukin 1 and interferon-gamma in stimulating the production of nerve growth factor in fibroblasts FEBS Lett 340,177-180[Medline][Order article via Infotrieve]
-
Di Marco, E, Mathor, M, Bondanza, N, et al (1993) Nerve growth factor binds to normal human keratinocytes through high and low affinity receptors and stimulates their growth by a novel autocrine loop J Biol Chem 268,22838-22846[Abstract/Free Full Text]
-
Tron, VA, Coughlin, MD, Jang, DE, Stanisz, J, Sauder, DN (1990) Expression and modulation of nerve growth factor in murine keratinocytes (PAM 212) J Clin Invest 85,1085-1089
-
Matsuda, H, Koyama, H, Sato, H, et al (1998) Role of nerve growth factor in cutaneous wound healing: accelerating effects in normal and healing-impaired diabetic mice J Exp Med 187,297-306[Abstract/Free Full Text]
-
Paus, R, Luftle, M, Czarnetzki, BM (1994) Nerve growth factor modulates keratinocyte proliferation in murine skin organ culture Br J Dermatol 130,174-180[Medline][Order article via Infotrieve]
-
Li, AKC, Koroly, MJ, Schattenkerk, ME, Malt, RA, Young, M. (1980) Nerve growth factor: acceleration of the rate of wound healing in mice Proc Natl Acad Sci USA 77,4379-4381[Abstract/Free Full Text]
-
Lambiase, A, Rama, P, Ghinelli, E, Pasqualetti, R, Aloe, L, Bonini, S (1999) Nerve growth factor promotes corneal healing: structural, biochemical, and molecular analysis [ARVO abstract] Invest Ophthalmol Vis Sci 40(4),S92Abstract nr 492
-
Wilson, SE, He, YG, Weng, J, et al (1996) Epithelial injury induces keratocyte apoptosis: hypothesized role for the interleukin-1 system in the modulation of corneal tissue organization and wound healing Exp Eye Res 62,325-338[Medline][Order article via Infotrieve]
-
Lindholm, D, Heumann, R, Hengerer, B, Thoenen, H. (1988) Interleukin 1 increases stability and transcription of mRNA encoding nerve growth factor in cultured rat fibroblasts J Biol Chem 263,16348-16351[Abstract/Free Full Text]
-
Smith, RE, Sadun, AA (1998) Clearing the cornea with nerve growth factor N Engl J Med 338,1222-1223[Free Full Text]
-
Xia, Z, Dickens, M, Raingeaud, J, Davis, RJ, Greenberg, ME (1995) Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis Science 270,1326-1331[Abstract/Free Full Text]
-
Campbell, JS, Seger, R, Graves, JD, Graves, LM, Jensen, A, Krebs, EG (1995) The MAP kinase cascade Recent Prog Horm Res 50,131-159
-
Hill, CS, Teisman, R. (1995) Transcriptional regulation by extracellular signals mechanisms and specificity Cell 80,199-211[Medline][Order article via Infotrieve]
-
Boulton, TG, Nye, SH, Robbins, DJ, et al (1991) ERKs: a family of protein-serine/threonine kinases that are activated and tyrosine phosphorylated in response to insulin and NGF Cell 65,663-675[Medline][Order article via Infotrieve]
-
Loeb, DM, Tsao, H, Cobb, MH, Greene, LA (1992) NGF and other growth factors induce an association between ERK1 and NGF receptor, pg140protottrk Neuron 6,1053-1065
-
Althaus, HH, Hempel, R, Klopper, S, et al (1997) Nerve growth factor signal transduction in mature pig oligodendrocytes J Neurosci Res 50,729-742[Medline][Order article via Infotrieve]
-
van Weering, DH, Bos, JL (1998) Signal transduction by the receptor tyrosine kinase Ret Recent Results Cancer Res 154,271-281[Medline][Order article via Infotrieve]
-
Chiariello, M, Visconti, R, Carlomagno, F, et al (1998) Signalling of the Ret receptor tyrosine kinase through the c-Jun NH2-terminal protein kinases (JNKs): evidence for a divergence of the ERK and JNK pathways induced by Ret Oncogene 16,2435-2445[Medline][Order article via Infotrieve]
-
LangeCarter, CA, Johnson, GL (1994) Ras-dependent growth factor regulation of MEK kinase in PC12 cells Science 265,1458-1461[Abstract/Free Full Text]
-
Minden, A, Lin, A, McMahon, M, et al (1994) Differential activation of ERK and JNK mitogen-activated protein kinases by Raf-1 and MEKK Science 266,1719-1723[Abstract/Free Full Text]
-
Cosgaya, JM, Aranda, A. (1996) Ras and Raf-mediated regulation of transforming growth factorß 1 gene expression by ligands of tyrosine kinase receptors in PC12 cells Oncogene 12,2651-2660[Medline][Order article via Infotrieve]
-
Kim, SJ, Park, K, Rudkin, BB, Dey, BR, Sporn, MB, Roberts, AB (1994) Nerve growth factor induces transcription of transforming growth factor-ß1 through a specific promotor element in PC12 cells J Biol Chem 269,3739-3744[Abstract/Free Full Text]
-
Honma, Y, Nishida, K, Sotozono, C, Kinoshita, S. (1997) Effect of transforming growth factor-ß1 and -ß2 on in vitro rabbit corneal epithelial proliferation promoted by epidermal growth factor, keratinocyte growth factor, or hepatocyte growth factor Exp Eye Res 65,391-396[Medline][Order article via Infotrieve]
-
Mohan, RR, Kim, WJ, Mohan, RR, Chen, L, Wilson, SE (1998) Bone morphogenetic proteins 2 and 4 and their receptors in the adult human cornea Invest Ophthalmol Vis Sci 39,2626-2636[Abstract/Free Full Text]
-
Kruse, FE, You, L. (1998) Significance of activin A in human corneal epithelium and stroma [ARVO Abstract] Invest Ophthalmol Vis Sci 39(4),S231Abstract nr 1053
-
Kretschmar, M, Doody, J, Massague, J. (1997) Opposing BMP and EGF signalling pathways converge on the TGF-ß family mediator Smad 1 Nature 389,618-622[Medline][Order article via Infotrieve]
-
Kretzschmar, M, Massague, J. (1998) SMADs: mediators and regulators of TGF-ß signaling Curr Opin Genet Dev 8,103-111[Medline][Order article via Infotrieve]
-
Bapat, B, Gallinger, S, Andrulis, IL (1996) Madr2 maps to 18q21 and encodes a TGF-ß-regulated Mad-related protein that is functionally mutated in colorectal carcinoma Cell 86,543-552[Medline][Order article via Infotrieve]
-
Yingling, JM, Das, P, Savage, C, Xhang, C, Padgett, RW (1996) Mammalian dwarfins are phosphorylated in response to TGF-ß and are implicated in control of cell growth Proc Natl Acad Sci USA 93,8940-8944[Abstract/Free Full Text]
-
MaciasSilva, M, Abdollah, S, Hoodless, PA, Pirone, R, Attisano, L, Wrana, JL (1996) MADR2 is a substrate of the TGF-ß receptor and its phosphorylation is required for nuclear accumulation and signaling Cell 87,1215-1224[Medline][Order article via Infotrieve]
-
Zhang, Y, Feng, XH, Derynck, R. (1998) Smad3 and Smad4 cooperate with c-Jun/c-Fos to mediate TGF-ß-induced transcription Nature 394,909-913[Medline][Order article via Infotrieve]
This article has been cited by other articles:

|
 |

|
 |
 
H Qi, D-Q Li, F Bian, E Y Chuang, D B Jones, and S C Pflugfelder
Expression of glial cell-derived neurotrophic factor and its receptor in the stem-cell-containing human limbal epithelium
Br. J. Ophthalmol.,
September 1, 2008;
92(9):
1269 - 1274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Rios, E. Ghinelli, J. Gu, R. R. Hodges, and D. A. Dartt
Role of Neurotrophins and Neurotrophin Receptors in Rat Conjunctival Goblet Cell Secretion and Proliferation
Invest. Ophthalmol. Vis. Sci.,
April 1, 2007;
48(4):
1543 - 1551.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Gong, U. Pleyer, K. Vogt, I. Anegon, A. Flugel, H.-D. Volk, and T. Ritter
Local Overexpression of Nerve Growth Factor in Rat Corneal Transplants Improves Allograft Survival
Invest. Ophthalmol. Vis. Sci.,
March 1, 2007;
48(3):
1043 - 1052.
[Abstract]
|