|
|
||||||||
1 From the Schepens Eye Research Institute, Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts.
| Abstract |
|---|
|
|
|---|
METHODS. Pure cultured I/CB PE cells were obtained from eyes of normal and CD95
ligand (CD95L)-deficient mice and tested for their capacity to suppress
T-cell activation in three different T-cell receptor (Tcr) ligand
systems: mixed lymphocyte reactions, stimulation of Tcr transgenic T
cells (D011.10) by specific antigen (ovalbumin), and ligation of the
Tcr-associated CD3 molecule by anti-CD3 antibodies. Proliferation and
secretion of cytokines (interferon [IFN]-
, interleukin [IL]-2,
IL-4, and IL-10) were assessed as measures of T-cell activation.
Suppressive influences of I/CB PE cells were determined on the basis of
RT-PCRdetected cytokine genes expressed by I/CB PE cells,
immunosuppression mediated by supernatants of cultured I/CB PE cells,
direct contact between I/CB PE cells and T lymphocytes, and promotion
of apoptosis among responding T cells. Attempts to reverse I/CB
PEdependent suppression of T-cell activation included the use of
neutralizing antibodies to IL-10, tumor necrosis factor (TNF)-
and
transforming growth factor (TGF)-ß, and the addition of exogenous
IL-2 and IL-12.
RESULTS. Cultured mouse I/CB PE cells (including CD95L-deficient cells), which
were more than 95% keratin positive, suppressed T-cell proliferation
and secretion of IFN-
, IL-2, IL-4, and IL-10 in a dose-dependent
fashion in all three Tcr ligand systems. Supernatants of cultured I/CB
PE cells displayed little suppression activity, whereas cultures in
which I/CB PE cells contacted responding T cells directly were
profoundly immunosuppressive. Cultured I/CB PE cells expressed mRNA for
TGF-ß1, TGF-ß2, IL-6, IL-10, and TNF-
, but not IL-4, IFN-
,
proopiomelanocortin (POMC), and CD95L (Fas L). Antibodies to
TGF-ß, IL-10, and TNF-
failed to reverse suppression mediated by
I/CB PE cells. Moreover, neither exogenous IL-2 or IL-12 relieved the
suppression.
CONCLUSIONS. Cultured I/CB PE cells, through direct cell-to-cell contact, prevent T cells from proliferating and secreting cytokines when stimulated through the Tcr for antigen by a mechanism that does not involve CD95 or apoptosis.
| Introduction |
|---|
|
|
|---|
Several laboratories have studied the immunomodulatory properties of iris and ciliary body (I/CB),22 23 24 25 in part because these tissues line the anterior and posterior chambers of the eye and because they are involved in secretion of aqueous humor. Explants of I/CB placed in vitro have been found to be directly immunosuppressive to T cells. Specifically, when lymphoid cells are cultured with allogeneic stimulator cells in vitro in the presence of I/CB explants, lymphocyte proliferation is profoundly suppressed.26 Supernatants obtained from cultured I/CB tissue display similar immunoinhibitory properties, due in part to their content of transforming growth factor (TGF)-ß.8 9 27 However, the immunosuppressive properties of supernatants of cultured I/CB cannot be totally explained by the presence of TGF-ß, implying that other modulatory soluble factors must also be present.23 24 Moreover, cell lines derived from ciliary body epithelium, as well as retinal Müller cells, have been found to suppress T-cell activation by a direct, contact-dependent process.22 28 Some, but not all, of the inhibitory activity is due to the production of prostaglandins.23 26 29
In an effort to learn with more precision the manner in which the I/CB contributes to ocular immune privilege, we developed homogeneous populations of nontransformed pigment epithelial (PE) cells from normal I/CB of mouse eyes. In this communication, we report that these cells are potent inhibitors of T-cell activation, largely through a direct, cell-to-cell contactdependent mechanism, and that the mechanism of suppression is not dependent on CD95 or promotion of apoptosis among responding T cells.
| Materials and Methods |
|---|
|
|
|---|
Culture Media
RPMI 1640 complete medium was used for primary cultures of I/CB PE
cells, and mixed lymphocyte reactions (MLRs). It was composed of RPMI
1640, 10 mM HEPES, 0.1 mM nonessential amino acids, 1 mM sodium
pyruvate, 100 U/ml penicillin, 100 µg/ml streptomycin, 10% fetal
bovine serum (FBS; all from Biowhitaker, Walkersville, MD), and 1 x 10-5 M 2-ME (Sigma, St. Louis, MO). Cultures
containing D011.10 T cells, and cultures of T cells stimulated with
anti-CD3 antibodies were grown in serum-free medium, which contains
RPMI complete medium except for FBS, and which is supplemented with
0.1% bovine serum albumin (Sigma) and 0.2% insulin, transferrin,
selenium (ITS) + culture supplement (Collaborative Biochemical
Products, Bedford, MA).
Culture of I/CB PE Cells
PE cells of I/CB (I/CB PE) were cultivated as follows. Eyes were
enucleated from 6- to 8-week-old male BALB/c, C3H/HeJ wild-type, or
CD95L-deficient mice. The eyes were cut into two parts along a
circumferential line just posterior to the ciliary process. The lens
was removed from the anterior eyecup, and whole I/CB tissue was gently
peeled off and collected by fine forceps. I/CB tissue was incubated in
phosphate-buffered saline (PBS) containing 1 mg/ml Dispase and 0.05
mg/ml DNaseI (both from BoehringerMannheim, Mannheim, Germany) at
37°C for 1 hour. Thereafter, I/CB tissue was triturated several times
with 21-guage and 23-guage needles to make a single-cell suspension.
Monodispersed I/CB cells were washed twice with RPMI complete medium,
and then placed into 35-mm cell culture dishes and incubated at 37°C
in a 5% CO2 atmosphere.
Flow Cytometry with Anti-keratin Antibody Staining
I/CB cells were stained with fluorescein-isothiocyanatelabeled
anti-pan keratin antibody (Clone PCK-26, Sigma) on days 0, 1, 7, and 14
of in vitro culture. Cells were fixed with 5% buffered formalin for 30
minutes at room temperature, permeabilized with 0.1% Triton X100 and
0.1% sodium citrate for 2 minutes at 4oC, and
washed twice. Thereafter, the cells were blocked with PBS containing
2% FBS for 20 minutes on ice, incubated with anti-pan keratin antibody
for 30 minutes on ice, and washed twice, after which they were analyzed
by flow cytometry.
Immunohistochemistry
Frozen sections of BALB/c eyes were fixed and permeabilized with
acetone, blocked with blocking solution (PBS containing 2% FBS) for 1
hour and then incubated with anti-pan-keratin antibody at 37°C for 2
hours. Sections were washed with blocking solution and examined under
the fluorescence microscope.
MLR
Cultured I/CB cells (after 14 days culture) were seeded in
flat-bottomed 96-well culture plates and cultured overnight. Spleens
were removed from BALB/c or C57BL/6 mice and pressed through nylon mesh
to produce a single-cell suspension. Red blood cells were lysed with
Tris-NH4Cl. Responder BALB/c spleen cells
(2.5 x 105 cells/well) were cultured with
x-irradiated (2000R) C57BL/6 stimulator spleen cells (2.5 x
105 cells/well) in the presence or absence of
I/CB cells. Cultures were incubated with 200 µl culture medium at
37°C in a 5% CO2 atmosphere. Supernatants of
the cultures were collected on day 3 for cytokine enzyme-linked
immunosorbent assay (ELISA), and the cells were pulsed with
[3H] thymidine for the terminal 8 hours and
then harvested by automated cell harvester (Tomtec, Orange, CT).
Incorporated radioactivity was measured by liquid scintillation
counter, and the amount was expressed in counts per minute (cpm).
Activation of DO11.10 Tcr Transgenic T Cells
DO11.10 T-cell receptor (Tcr) transgenic T cells were prepared
from DO11.10 mouse spleens and lymph nodes, as previously
described,30
and purified with T-cell enrichment columns
(R&D, Minneapolis, MN). Purified DO11.10 T cells (2.5 x
104) were stimulated with peritoneal exudate
cells and 50 to 200 µg/ml OVA in 96-well plates. Supernatants were
collected at 48 hours, and the cells were harvested at 72 hours after
they were pulsed for 8 hours with
[3H]thymidine.
Activation of Purified Naive T Cells by Anti-CD3 Antibody
T cells were prepared from naive BALB/c or C3H/HeJ mouse spleens,
then purified through a T-cell enrichment column (R&D). Purified T
cells (1 x 105) were stimulated with 0 to
10 µg/ml anti-CD3 antibody (Clone 2C11; PharMingen, San Diego, CA). T
cells were harvested on day 3 after the exposure of
[3H]thymidine for the terminal 8 hours.
Cytokine Assays
To measure the cytokine (interleukin [IL]-2, interferon
[IFN]-
, IL-4, or IL-10) content in supernatants of MLR and DO11.10
T-cell cultures, a quantitative capture ELISA was used. Culture
supernatants were collected at 72 hours from MLR, and at 48 hours from
DO11.10 T-cell cultures, immediately frozen, and stored at -20°C
until used. ELISA was performed according to the manufacturers
instructions (PharMingen). Rat monoclonal antibodies to mouse cytokine
IFN-
(Clone:R4-6A2), IL-2 (JES6-1A12), IL-4 (11B11), or IL-10
(JES-2A5; all from PharMingen) were used as coating antibodies.
Biotinylated rat monoclonal antibodies to mouse IFN-
(XMG1.2), IL-2
(JES6-5H4), IL-4 (BVD6-24G2), or IL-10 (SXC-1; all from PharMingen)
were used as detecting antibodies. All recombinant cytokines used to
standardize the assays were purchased from PharMingen.
TUNEL Assay
To perform the TdT-dUTP terminal nick-end labeling (TUNEL) assay,
we cultured naive C3H/HeJ T cells for 24 and 48 hours with anti-CD3
antibodies in the presence of PE cells cultured from C3H/HeJ
(wild-type) or C3H/HeJ.gld/gld (CD95L-deficient) donors. T
cells were then collected by pipetting, washed twice with 2% FBS-PBS
and fixed with 5% formalin-PBS for 30 minutes at room temperature. The
cells were washed twice again and incubated for 1 hour at 37°C in a
humidified chamber with 50 µl of a reaction mixture containing 3 µl
of 0.1 mM rhodamine-6- UTP, 3 µl of 1 mM dATP, 2 µl of 25 mM
CoCl2, 0.5 µl of 25 U TdT, or water and 10 µl
1x TdT buffer. At completion of the induction, the reaction was
stopped with 2 µl of 0.5 M EDTA, and the cells were washed twice with
2% FCS-PBS. Stained cells were analyzed on a flow cytometer (Epics XL
analyzer; Coulter Inc., Hialeah, FL). Each experiment was
repeated at least three times with similar results. The figure
presented (Fig. 5)
displays results of a representative experiment.
|
PCR was performed by the method of Saiki et al.,33
with
slight modification. The primers used were as follows (from 5' to 3'):
Glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) sense,
GGTGAAGGTCGGTGTGAACGGA; GAPDH antisense, TGTTAGTGGGGTCTCGCTCCTG;
TGF-ß1 sense, CAAGGAGACGGGAATACAGGGCT; TGF-ß1 antisense,
CGCACACAGCAGTTCTTCTCTGT; TGF-ß2 sense, CACCACAAAGACAGGAACCTGG;
TGF-ß2 antisense, GCGAAGGCAGCAATTATCCTGCAC; IL-4 sense,
ACGGAGATGGATGTGCCAAACGTC; IL-4 antisense, CGAGTAATCCATTTGCATGATGC; IL-6
sense, GCTGGTGACAACCACGGCCTT; IL-6 antisense, ATGGTACTCCAGAAGACCAGAGG;
IL-10 sense, GGTTGCCAAGCCTTATCGGAAATG; IL-10 antisense,
TTGTAGACACCTTGGTCTTGGAGC; tumor necrosis factor (TNF)-
sense,
GAAAGCATGATCCGCGACGTGGA; TNF-
antisense,
TACGACGTGGGCTACAGGCTTG; IFN-
sense, CCTCATGGCTGTTTCTGGCTGTTA;
IFN-
antisense, CATTGAATGCTTGGCGCTGGACC; POMC sense,
AGAGAGCTGCCTTTCCGCGACA; POMC antisense, GTTCATCTCCGTTGCCAGGAAAC; CD95L
sense, CATCACAACCACTCCCACTG; and CD95L antisense, CCTCTTCTCCTCCATTAGCA.
The primers for CD95L were designed by us, and all other primers were designed by Pascale Alard (University of Virginia, Lexington). All primers had been confirmed by preliminary experiments. PCR was performed under the following conditions: denaturation: 94°C, 30 seconds; annealing: 55°C, 30 seconds; extension: 72°C, 60 seconds. After 20 to 40 cycles of amplification, PCR products were electrophoresed in 2% agarose gel and visualized by ethidium bromide staining.
Neutralizing Antibodies and Stimulatory Cytokines
Anti-pan TGF-ß antibody and anti-TNF-
antibody were purchased
from R&D and PharMingen, respectively. Neutralizing anti-IL-10 antibody
was purified from culture supernatant of hybridoma
JES5-2A5.34
Anti-pan TGF-ß Ab was added to MLRs with
I/CB PE cells from the beginning of culture, at a concentration of 0 to
10 µg/ml. Similarly, anti-IL-10 antibody (0100 ng/ml) and
anti-TNF-
antibody (01 µg/ml) were used for neutralization.
Exogenous IL-2 and IL-12 (2 ng/ml, PharMingen) were added to the MLR
cultures.
Statistical Evaluation of Results
All statistical analyses were conducted with Students
t-test. Values were considered statistically significant if
P < 0.05.
| Results |
|---|
|
|
|---|
Effect of I/CB PE Cells on T-Cell Proliferation
To assess the influence of I/CB PE cells on T-cell proliferation,
three different types of T-cell assays were performed: 1) typical MLR
in which BALB/c spleen cells (responders) were stimulated with
x-irradiated (2000R) C57BL/6 spleen cells (stimulators); 2) OVA
peptide-specific, Tcr transgenic T cells from DO11.10 mice were
stimulated with OVA-pulsed BALB/c spleen cells; and 3) anti-CD3
monoclonal antibody was added in mitogenic concentrations to naive
purified T cells from BALB/c spleen cells. Each of these cellular
reactant sets was added to wells containing 14-day cultured I/CB PE
cells, and, at appropriate intervals thereafter,
[3H]thymidine was added. The results of a
representative set of experiments are displayed in Figures 1a
1b
and 1c
and indicate the effects of I/CB PE cells on MLRs. As few
as 3000 cultured I/CB PE cells inhibited proliferation of alloreactive
T cells in these cultures, although even more profound inhibition was
observed when 24,000 I/CB PE cells were present (Fig. 1a)
. The extent
of inhibition was not dependent on the amount of allogeneic stimulators
added to the culture, because I/CB PE cells inhibited proliferation in
cultures containing 50 x 104 C57BL/6
stimulators as well as cultures containing only 1.6 x
104 stimulators (Fig. 1b)
. Moreover, inhibition
of T-cell proliferation was complete, whether the cultures were stopped
at 72, 96, or even 120 hours (Fig. 1c) . When DO11.10 T cells were
stimulated in vitro with OVA-pulsed BALB/c spleen cells in the presence
of I/CB PE cells, dose-dependent inhibition of T-cell proliferation was
observed (Fig. 1d)
. Suppression was partial when 2,000 I/CB PE cells
were present but complete when 20,000 I/CB PE cells were present.
Finally, T-cell proliferation resulting from ligation of the Tcr for
antigen with anti-CD3 antibodies was also inhibited by I/CB PE cells
(Fig. 1e) . Even at the highest dose of anti-CD3 added (10 µg/ml),
20,000 I/CB PE cells completely prevented
[3H]thymidine incorporation. Thus, irrespective
of the mechanism of T-cell activation studied, I/CB PE cells inhibited
T-cell proliferation in vitro.
|
, IL-4, and IL-10. Results of cytokine
measurements in supernatants of mixed lymphocyte cultures are presented
in Figures 2a
2b
2c
2d
. In a dose-dependent manner, I/CB PE cells suppressed
secretion of IFN-
, IL-2, IL-4, and IL-10 in these cultures. The
effect on IFN-
production was particularly strong. In the presence
of 20,000 I/CB PE cells, very small amounts of IFN-
and IL-4 were
detected. Similarly, I/CB PE cells inhibited IFN-
and IL-2
production by OVA-stimulated DO11.10 T cells (Figs. 2e
2f)
. Because
DO11.10 T cells failed to secrete either IL-4 or IL-10 in response to
OVA stimulation, no effect on I/CB PE cells could be discerned. These
results indicate that the inhibition of T-cell activation achieved by
exposure to I/CB PE cells includes both proliferation and cytokine
production.
|
|
|
, TNF-
,
POMC, and CD95L (Fas L). The PCR products were electrophoresed in 2%
agarose gel and visualized by staining with ethidium bromide. The
results are presented in Figure 6
. mRNA species from cultured I/CB PE cells were identified for TGF-ß1,
TGF-ß2, IL-6, IL-10, and TNF-
. No message was detected for
IFN-
, IL-4, proopiomelanocortin (POMC), or CD95L.
|
. Each of these
antibodies was added to mixed lymphocyte cultures grown in the presence
or absence of I/CB PE cells. The results of representative experiments
are presented in Figures 7a
and 7b
. As can be seen, anti-TGF-ß antibodies failed to relieve the
inhibition of T-cell proliferation imposed by I/CB PE cells. Similarly,
anti-IL-10 antibodies displayed no ability to permit T cells to
proliferate in these cultures (data not shown). Anti-TNF-
antibodies
tended to promote T-cell proliferation in mixed lymphocyte cultures not
containing I/CB PE cells (a result reported previously by others; see
Fig. 7b
). When this effect was taken into account, anti-TNF-
antibodies were ineffective at restoring T-cell proliferation in the
presence of I/CB PE cells. Thus, none of the immunomodulatory factors
that were detected by RT-PCR in cultured I/CB PE cells appeared to
account for the ability of the cells to inhibit T-cell activation.
|
| Discussion |
|---|
|
|
|---|
, IL-1, IL-4, and IL-10. A similar pattern
of failed proliferation and cytokine secretion was reported previously
when T-cell stimulation assays were conducted in the presence of
explants of I/CB.63 The similar outcome, however, does not
necessarily reflect a similarity of mechanism. Whereas cultured I/CB PE
cells effected their inhibition of T-cell activation largely through a
contact-dependent mechanism, explants of whole I/CB tissue secrete
immunosuppressive factors into the supernatant, and these soluble
factors act in an inhibitory manner on responding T cells. Thus, the
normal I/CB contains cells that inhibit T-cell activation by two
different mechanisms: soluble immunosuppressive factors and direct
cell-to-cell contact.
At present, several different parenchymal cell types within the eye
have been demonstrated to possess immunomodulatory properties that have
a direct or indirect effect on T-cell function. Corneal epithelium and
keratocytes secrete soluble factors, including TGF-ß2,36
that inhibit lymphocyte activation and suppress inflammation. In
addition to secreting soluble, but still undefined, immunosuppressive
factors,20
corneal endothelial cells also express CD95L,
which inhibits effector T cells from destroying orthotopic corneal
allografts,15
18
presumably by initiating programmed cell
death in the T cells. Müller cells, especially when treated with
IFN-
, acquire immunosuppressive properties that are mediated in part
by direct cell contact.25
Retinal pigment epithelial (RPE) cells bear ontogenetic similarity to the pigment epithelium of I/CB. During the past few years, several groups have investigated the capacity of RPE to function as antigen-presenting cells and also as modulators of T-cell activation. Regarding the latter, Liversedge and Forrester37 reported that RPE cells suppress lymphocyte proliferation even in the presence of exogenous antigen-presenting cells, implying an immunomodulatory role. These researchers have gone on to show that RPE cells suppress T-cell activation through soluble factors (prostaglandin E2 [PGE2]) and through membrane-bound mechanisms. Several soluble factors in addition to PGE2 have been found to be secreted by RPE, including TGF-ß.38 39 More recently, Jorgenson et al.21 have reported that human RPE cells induce apoptosis among activated T cells through a CD95-CD95L process. However, the precise mechanism of T-cell death was not defined by this study, and the veracity of CD95L expression on human RPE cells was even called into question. In fact, in a very recent publication, FarrokhSiar et al.40 reached the conclusion that human fetal RPE cells suppress proliferation of an autonomously proliferating T-cell line through apoptosis but that the apoptosis was not mediated through the CD95-CD95L pathway or through secretion of apoptosis-inducing cytokines.
Our analysis of the contact-dependent mechanism by which I/CB PE cells inhibit T-cell activation is relevant to this issue. We found that cultured I/CB PE cells from CD95L-deficient mice were comparable to wild-type PE cells in inhibiting T-cell activation. Moreover, we found no evidence that the CD95L gene was even transcribed in cultured I/CB PE cells from normal mice. Finally, I/CB PE cells appear to protect responding T cells from apoptosis, rather than to promote programmed cell death. We conclude that the capacity of I/CB PE cells to inhibit T-cell activation is independent of CD95/CD95L interactions and does not depend on triggering of apoptosis among responding T cells.
We are unable as yet to identify the molecular mechanism that accounts
for the ability of cultured I/CB PE cells to inhibit T cells by a
contact-dependent mechanism. Although we found mRNA evidence for the
activity of genes encoding TGF-ß, IL-6, TNF-
, and IL-10, we were
unable to neutralize the inhibitory effects of I/CP PE cells with
neutralizing antibodies to these cytokines. Taylor et
al.41
have recently reported that T cells that have been
activated in the presence of aqueous humor acquire novel properties,
including the capacity to suppress the activities of bystander T cells.
Experiments similar in design are now under way to determine whether T
cells that have come in contact with I/CB PE cells also acquire
regulatory functions.
The capacity of I/CB PE cells to suppress T-cell activation by a direct cell-to-cell contact mechanism resembles some of the properties ascribed to RPE cells. However, the I/CB PE cells do not form a physical barrier (through extensive tight junctions) similar to that created by RPE. Thus, they do not participate in the so-called bloodocular barrier. In fact, unlike RPE, the PE cells of the ciliary body are effectively outside the bloodocular barrier, because tight junctions between and among secretory ciliary epithelial cells create a barrier at the level of the ciliary processes between intraocular compartments and the extraocular environment. This unique anatomic location has caused us to wonder why ciliary body PE cells possess immunomodulatory properties. It is relevant that the PE cell layer of the ciliary body actually separates the secretory epithelium from the microvessels of the ciliary processes in the stroma. Thus, migratory T cells that escape from local vessels into the stroma must pass through the PE layer if they intend to penetrate into the posterior chamber. With this microanatomic arrangement, the opportunity exists for PE cells to influence the functional properties of T cells destined to enter the eye. Our data suggest that, given this opportunity, PE cells disarm the T cells by preventing them from inducing a differentiation program that could lead to immunogenic inflammation. A diagram describing this process is presented in Figure 8 . There are other examples of T-cell migration in which the cells escape the microvasculature and penetrate through an epithelial layer into another compartment. Populations of T cells regularly leave the microvessels of the intestinal villi and migrate through the absorptive epithelial layer (which is also linked by tight junctions) into the intestinal lumen.42
|
Our demonstration that cultured I/CB PE cells inhibit T-cell activation by a contact-dependent mechanism should be interpreted cautiously for several reasons. First, cells that have been explanted in culture often adopt functional phenotypes that are not representative of their native properties when present in intact tissues. Thus, the possibility exists that the properties we have discovered among cultured I/CB PE cells do not reflect in vivo properties of PE cells. Second, for technical reasons, we have worked with PE cells from both the iris and ciliary body. Although PE cells from these two tissues are closely linked ontogenetically, they may adopt different functions when they differentiate respectively into the PE layer of the iris and the PE layer of the ciliary body. Thus, the ability to inhibit T-cell activation through direct contact may be a property of only one or the other type of PE.
| Acknowledgements |
|---|
| Footnotes |
|---|
Submitted for publication September 25, 1998; revised April 4 and August 16, 1999; accepted October 7, 1999.
Commercial relationships policy: N.
Corresponding author: J. Wayne Streilein, Schepens Eye Research Institute, Department of Ophthalmology, Harvard Medical School, 20 Staniford Street, Boston, MA 02114. waynes{at}vision.eri.harvard.edu
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Sawada, T. Fukuchi, T. Tanaka, and H. Abe Tumor Necrosis Factor-{alpha} Concentrations in the Aqueous Humor of Patients with Glaucoma Invest. Ophthalmol. Vis. Sci., February 1, 2010; 51(2): 903 - 906. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Vega, H. Keino, and S. Masli Surgical Denervation of Ocular Sympathetic Afferents Decreases Local Transforming Growth Factor-{beta} and Abolishes Immune Privilege Am. J. Pathol., September 1, 2009; 175(3): 1218 - 1225. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sugita, H. Takase, C. Taguchi, and M. Mochizuki The Role of Soluble TNF Receptors for TNF-{alpha} in Uveitis Invest. Ophthalmol. Vis. Sci., July 1, 2007; 48(7): 3246 - 3252. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Stein-Streilein and A. W. Taylor An eye's view of T regulatory cells J. Leukoc. Biol., March 1, 2007; 81(3): 593 - 598. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Carrington, J. Albon, I. Anderson, C. Kamma, and M. Boulton Differential Regulation of Key Stages in Early Corneal Wound Healing by TGF-{beta} Isoforms and Their Inhibitors Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 1886 - 1894. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sugita, T. F. Ng, P. J. Lucas, R. E. Gress, and J. W. Streilein B7+ Iris Pigment Epithelium Induce CD8+ T Regulatory Cells; Both Suppress CTLA-4+ T Cells J. Immunol., January 1, 2006; 176(1): 118 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kitaichi, K. Namba, and A. W. Taylor Inducible immune regulation following autoimmune disease in the immune-privileged eye J. Leukoc. Biol., April 1, 2005; 77(4): 496 - 502. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Gregerson, T. N. Sam, and S. W. McPherson The Antigen-Presenting Activity of Fresh, Adult Parenchymal Microglia and Perivascular Cells from Retina J. Immunol., June 1, 2004; 172(11): 6587 - 6597. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sugita, T. F. Ng, J. Schwartzkopff, and J. W. Streilein CTLA-4+CD8+ T Cells That Encounter B7-2+ Iris Pigment Epithelial Cells Express Their Own B7-2 to Achieve Global Suppression of T Cell Activation J. Immunol., April 1, 2004; 172(7): 4184 - 4194. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Streilein Ocular immune privilege: the eye takes a dim but practical view of immunity and inflammation J. Leukoc. Biol., August 1, 2003; 74(2): 179 - 185. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sugita and J. W. Streilein Iris Pigment Epithelium Expressing CD86 (B7-2) Directly Suppresses T Cell Activation In Vitro via Binding to Cytotoxic T Lymphocyte-associated Antigen 4 J. Exp. Med., July 7, 2003; 198(1): 161 - 171. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |