IOVS The FASEB Journal
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pflugfelder, S. C.
Right arrow Articles by Carraway, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pflugfelder, S. C.
Right arrow Articles by Carraway, K. L.
(Investigative Ophthalmology and Visual Science. 2000;41:1316-1326.)
© 2000 by The Association for Research in Vision and Ophthalmology, Inc.

Detection of Sialomucin Complex (MUC4) in Human Ocular Surface Epithelium and Tear Fluid

Stephen C. Pflugfelder1, Zuguo Liu1, Dagoberto Monroy1, De–Quan Li1, Maria E. Carvajal2, Shari A. Price–Schiavi2, Nebila Idris2, Abraham Solomon1, Amyee Perez2 and Kermit L. Carraway2

1 From the Ocular Surface and Tear Center, Bascom Palmer Eye Institute, and the 2 Department of Cell Biology and Anatomy, University of Miami School of Medicine, Florida.


   Abstract
Top
 Abstract
Introduction
 Methods
 Results
 Discussion
 References
 
PURPOSE. To evaluate human ocular surface epithelium and tear fluid for the presence of sialomucin complex (MUC4), a high-molecular-weight heterodimeric glycoprotein composed of mucin (ASGP-1) and transmembrane (ASGP-2) subunits.

METHODS. Reverse transcription–polymerase chain reaction (RT–PCR) and Northern blot analysis assays were used to identify sialomucin complex RNA in ocular surface epithelia. Immunoprecipitation and immunoblot analysis were used to identify immunoreactive species in human tears and in the corneal and conjunctival epithelia using antibodies specific for carbohydrate and peptide epitopes on the sialomucin complex subunits. Immunofluorescence staining was used to detect sialomucin complex in frozen sections and impression cytology specimens of human cornea and conjunctival epithelia.

RESULTS. ASGP-1– and ASGP-2–specific sequences were amplified from RNA extracted from both conjunctival and corneal epithelial biopsies by RT–PCR. Sialomucin complex transcripts were also detected in these tissues by Northern blot analysis, with a greater level of RNA detected in the peripheral than the central corneal epithelium. Sialomucin complex was immunoprecipitated from tear fluid samples and both corneal and conjunctival epithelia and detected by immunoblot analysis with specific anti–ASGP-1 and anti–ASGP-2 antibodies. The ASGP-1 peptide antibody HA-1 stained the full thickness of the corneal and conjunctival epithelia. In contrast, antibody 15H10, which reacts against a carbohydrate epitope on ASGP-1, stained only the superficial epithelial layers of these tissues. No staining was observed in the conjunctival goblet cells.

CONCLUSIONS. Sialomucin complex was originally identified in rat mammary adenocarcinoma cells and has recently been shown to be produced by the ocular surface epithelia of rats. Furthermore, it has been identified as the rat homologue of human MUC4 mucin. The present studies show that it is expressed in the stratified epithelium covering the surface of the human eye and is present in human tear fluid. Expression of a carbohydrate-dependent epitope on the mucin subunit (ASGP-1) of sialomucin complex occurs in a differentiation-dependent fashion. Sialomucin complex joins MUC1 as another membrane mucin produced by the human ocular surface epithelia but is also found in the tear fluid, presumably in a soluble form, as found on the rat ocular surface.


   Introduction
Top
 Abstract
 Introduction
Methods
 Results
 Discussion
 References
 
Ultrastructural and histochemical studies indicate that the ocular surface epithelium is covered and protected by a mucus layer,1 2 3 4 the origin and composition of which is not fully understood. Mucins are large glycoconjugates with molecular masses ranging from 3 x 105 to over 4 x 107 kDa.2 5 6 An important characteristic of these molecules is that they contain domains rich in serine and threonine residues with attached O-linked oligosaccharide side chains.6 7 These carbohydrate chains account for approximately 70% to 80% of the dry weight of mucins.6 Mucins are subdivided into secretory, soluble, and membrane-bound forms. Secretory gel–forming mucins, such as MUC2 and MUC5AC, make up the viscous mucus of the tracheobronchial, gastrointestinal, and reproductive tracts and form large oligomers through cross-linking of protein monomers via disulfide bonds at their N- and C termini.8 Soluble mucins, such as MUC7, which is found in the salivary gland, have smaller polypeptide backbones and do not form gels by disulfide cross-linking.9 Membrane-bound mucins, such as MUC1, have hydrophobic membrane-spanning domains and also do not form disulfide-linked oligomers.5 MUC1 is also produced by some cells as a soluble form that is missing its transmembrane and C-terminal domains.10 11

Several different mucin molecules have been reported to be produced by the human ocular surface epithelium. Specifically, the membrane mucin MUC1 is produced by the stratified epithelium covering the cornea and conjunctiva.12 RNAs encoding the secretory mucins MUC4 and MUC5AC have been identified in the conjunctiva by Northern blot analysis.13 MUC4 RNA was localized to the stratified conjunctival epithelium, whereas MUC5 RNA expression was limited to the conjunctival goblet cells by in situ hybridization.13 It is currently unknown whether these mucin molecules produced by the ocular surface epithelium are also present in the preocular tear film.

Sialomucin complex (SMC) is another well-studied membrane mucin.14 This mucin was originally isolated from highly metastatic 13762 rat mammary adenocarcinoma ascites cells, and it was characterized as a heterodimeric glycoprotein complex, in which the mucin subunit ASGP-1 (ascites sialoglycoprotein-1) is the major detectable glycoprotein.15 ASGP-1 is tightly but noncovalently bound to an N-glycosylated integral membrane glycoprotein, termed ASGP-2.15 16 The heterodimeric SMC has been shown to be expressed in a number of secretory epithelial tissues in the adult rat, including the small and large intestines, trachea, uterus, lactating mammary gland, and cornea and conjunctiva.16 17 18 Sialomucin complex is transcribed from a single gene as a 9-kb transcript19 20 and is translated into a polypeptide precursor that is proteolytically cleaved into the ASGP-1 and ASGP-2 subunits early in its transit to the cell surface.21 Mature glycosylated ASGP-1 has a molecular mass greater than 500 kDa and contains three domains: an N-terminal unique sequence, 12 tandem repeat regions that are rich in O-glycosylated serine and threonine residues similar to other mucins, and a C-terminal unique sequence.20 The transmembrane ASGP-2 subunit contains two epidermal growth factor (EGF)–like domains that contain all the consensus residues found in other proteins with EGF-like regions that possess growth factor activity.19 ASGP-2 has been shown to act as a ligand for the receptor tyrosine kinase ErbB-2, a member of the EGF receptor family.17 22 23 Thus, SMC may be bifunctional, serving as a protective, lubricating mucin as well as an active growth factor.

Recent molecular studies have helped to define the place of SMC among the hierarchy of mucins whose gene sequences have been determined. The full-length sequence of the human MUC4 gene shows substantial homology with the rat SMC sequence at the N- and C-terminal unique portions of the molecule.24 The MUC4 gene has been found to have a similar organization to the SMC gene with both mucin and transmembrane subunits that have been designated MUC4{alpha} and MUC4ß, respectively.25 The repeat domains of SMC and MUC4 appear to be different. Specifically, SMC does not have the 16 amino acid repeat in the originally reported MUC4 cDNA sequence.25 26 This may explain why the similarity between the molecules was not previously observed. However, the 70% identity between the human MUC4 analog of ASGP-2 and rat ASGP-2 provides compelling evidence that they are homologous proteins.

The purpose of this study was to determine whether human ocular surface epithelia produce SMC (MUC4) and whether this mucin is present in the preocular tear film.


   Methods
Top
 Abstract
 Introduction
 Methods
Results
 Discussion
 References
 
The Institutional Review Board of the University of Miami School of Medicine approved this study protocol in accordance with the tenets of the Declaration of Helsinki. Tear fluid and impression cytology (conjunctiva and cornea) specimens were collected from three normal human subjects with no symptoms of ocular irritation, a Schirmer 1 test > 20 mm, and no corneal fluorescein staining. Unstimulated tear fluid was carefully collected from the inferior tear meniscus to avoid reflex tearing using a previously reported technique.27 Impression cytology was performed by applying nitrocellulose (4 mm2) or Biopore (Millipore, Bedford, MA) membranes against the inferior bulbar conjunctiva or inferior cornea by previously reported techniques.28 Human conjunctiva was obtained during surgery from the normal superior bulbar conjunctiva of patients with pterygia. Human whole eyes and corneoscleral buttons were obtained from the Florida Lions Eye Bank. Human corneal limbal epithelium was cultured from explants of human donor corneoscleral rims. Each corneoscleral rim was trimmed, the endothelial layer and iris remnants were removed, and the tissue was treated with dispase (Life Technologies, Gaithersburg, MD) for 15 minutes. Each rim was dissected into 12 equal parts, which were applied in 6-well plastic dishes, and covered with a drop of fetal bovine serum (FBS) overnight. The explants were cultured in Dulbecco’s modified Eagle’s medium (DMEM)-F12 medium, enriched with 5% FBS, 1% insulin, transferrin, selenium (ITS), hydrocortisone, EGF, and cholera toxin. Epithelial cells were removed from the dishes by gentle trypsinization when they reached 70% confluence. Corneal epithelium was cultured in a similar manner from explants taken from the central 6 mm of the donor corneal tissue.

To culture stromal fibroblasts, the cornea, limbus, and conjunctiva were separated after mechanically removing the epithelium. The endothelium on the cornea and limbus was removed with a scalpel. Explant cultures were prepared in the same manner as described above for epithelial cell cultures except that DMEM containing 10% FBS was used. Fibroblasts were subcultured at 80% to 90% confluence after treatment with 0.1% trypsin and 0.02% EDTA.

The Department of Pathology at the University of Miami School of Medicine provided normal human tongue and tongue carcinoma tissues.

Reverse Transcription–Polymerase Chain Reaction Analysis of Human Corneal and Conjunctival Tissues
Reverse transcription–polymerase chain reaction (RT–PCR) was performed using the SuperScript One-Step RT–PCR System (GIBCO–BRL/Life Technologies, Gaithersburg, MD) on 1 µg samples of total RNA isolated from normal human corneal epithelium obtained by scraping and conjunctival epithelium obtained by impression debridement. Before RT, the RNA samples were treated with DNase I for 15 minutes at 37°C, then the DNase I was inactivated at 75°C for 5 minutes.

The RT–PCR was performed in a 50 µl volume using the following conditions: 0.2 µM of 5' primer, 0.2 µM of 3' primer, 0.2 µM of each dNTP, 1.2 mM of MgSO4, and 2 U of reverse transcriptase/Taq polymerase mixture. The absence of genomic DNA in RNA preparations was verified by omitting the reverse transcriptase/Taq Mix and substituting 2 U Taq DNA polymerase (Promega, Madison, WI) in the reaction. Plasmids carrying full-length human ASGP-1 or ASGP-2 cDNA sequences were used as positive controls for the PCRs. RNA was reverse-transcribed into cDNA by 1 cycle of 55°C for 30 minutes followed by 1 cycle of 94°C for 2 minutes. The cDNA was amplified for 42 cycles, with each cycle consisting of 94°C for 15 seconds, 55°C for 30 seconds, and 1 minute at 72°C (last cycle at 72°C for 5 minutes). The sequences of PCR primers for ASGP-1 were as follows: 5' CTTACTCTGGCCAACTCTGTAGTG 3' and 5'GAGAAGTTGGGCTTGACTGTC 3'. This 442 bp sequence was taken from a region upstream of the repeat sequence of MUC4 that is homologous to the sequence encoding the ASGP-1 mucin subunit of sialomucin.24 The sequences of the human ASGP-2 PCR primers were as follows: 5' GCTCTCCAACATCCTCCACT 3' and 5' TCACACGACCACCATTGATG 3'. These were synthesized from the 5' end of the human ASGP-2 sequence. The expected length of this amplified segment is 468 bp. After amplification, 15 µl of PCR product was electrophoresed on a 1.5% agarose gel in 1x TAE and was photographed.

Northern Blot Analysis Assay
A 2-kb fragment of the human MUC4ß (ASGP-2 region) cDNA probe was used to probe for SMC (MUC4) RNA. A 498-bp segment of the human GAPDH cDNA was used to probe for GAPDH. This probe was purified from RT–PCR products by electrophoresis through a 1.2% low-melting agarose gel using a Promega Wizard PCR Prep DNA purification kit (Promega) according to the manufacturer’s protocol. The sequences of GAPDH primers used for PCR were 541 to 561 (sense) and 1018 to 1038 (antisense; GenBank Accession No. M33197). The 32P-labeled cDNA probes (1 to 2 x 109 cpm/µg DNA) were prepared with [{alpha}-32P]–dCTP (3000 Ci/mmol) using a random primer DNA labeling system (Life Technologies).

Total RNA isolation and Northern hybridization were performed using a previously described method.29 Briefly, total RNA was isolated from primary epithelial cell cultures and third passage human corneal, limbal, and conjunctival fibroblast cultures by acid guanidium thiocyanate–phenol–chloroform extraction. Total RNA (20 µg/lane) was electrophoresed through 1.2% agarose containing formaldehyde, transferred to nitrocellulose membranes, and hybridized with 32P-labeled cDNA probes at 1 to 2 x 106 cpm/1.5 to 3 ng/ml in the hybridization solution. After visualization of the hybridization product on the X-ray film, the membrane was washed twice at 65°C for 1 hour in 5 mM Tris–HCl (pH 8.0), 0.2 mM EDTA, 0.05% sodium pyrophosphate, and 0.1x Denhardt’s solution to strip off the 32P-label before rehybridization with another probe. The relative amount of SMC RNA was determined by scanning the autoradiogram with a laser scanning densitometer (model FB910; Fisher Scientific, Pittsburgh, PA) and normalized as a ratio to that of the GAPDH RNA band.

Immunoprecipitation and Immunoblot Analysis
Samples (tear fluid, 1.5–2 µl; human corneal and conjunctival epithelial biopsies; cultured human corneal epithelial cells; MV-MATC1 rat ascites mammary carcinoma cells, and A375 human melanoma cells) were mixed with 300 µl of RIPA buffer (150 mM NaCl, 50 mM Tris buffer, 1% NP-40, 5% deoxycholate, 0.1% sodium dodecyl sulfate [SDS], pH 8.0). Sialomucin complex was immunoprecipitated by the addition of 15 µl of ASGP-1–specific antibody (15H10),30 ASGP-2 specific antibody (HA2-3), or rabbit preimmune sera (negative control) followed by rotation at 4°C overnight. Subsequently, 15 µl of Protein A agarose (Sigma, St. Louis, MO) and 100 µl of ImmunoPure IgG binding buffer (Pierce, Rockford, Il) were added with further incubation for 1 hour at 4°C. The immunoprecipitants were collected by centrifugation at 3000g, washed 3 times in RIPA buffer, and solubilized for SDS–polyacrylamide gel electrophoresis (SDS—PAGE) and immunoblot analysis.30 Immunoblots were probed with ASGP-1–, ASGP-2–, or human ErbB-2–specific antibodies (Table 1) and developed with a Renaissance chemiluminescence kit (New England Nuclear, Boston, MA). Western blot analysis of ocular surface epithelium and human control tissues was performed as previously described.18 The specificity of polyclonal antibody HA2-3 that was generated against the human ASGP-2–specific peptide LDNQTVTFQPDHEDGG was evaluated by adding this peptide (0.25–2 mg/ml) to the immunoprecipitation mixture as a competitive substrate. The specificity of polyclonal antibody HA-1 that was generated against the rat ASGP-1–specific peptide AGYRPPRPAWTFGD was evaluated in immunoblots where 2 mg/ml of this competitive substrate was incubated with antibody HA-1.


View this table:
[in this window]
[in a new window]
  		Table 1. Antibodies for Immunofluorescence Staining and Western Blot Analysis

 
Immunofluorescence Staining
Corneal and conjunctival biopsies were embedded in OCT compound (Tissue Tek, Elkhart, IN), rapidly frozen in liquid nitrogen, and stored at -70°C. Within 72 hours, serial 4- to 5-µm-thick sections were cut. Single or dual label indirect immunofluorescence staining on tissue sections and cytology specimens was performed by a previously reported technique31 using SMC antibodies (Table 1) as well as positive (cytokeratin) and negative (fluorescein isothiocyanate [FITC]– or Texas red–labeled secondary antibodies, preimmune sera, or irrelevant monoclonal antibodies plus secondary antibody) control antibodies. The specificity of polyclonal antibody HA-1 that was generated against the rat ASGP-1–specific peptide AGYRPPRPAWTFGD in staining human ocular surface epithelial was evaluated by incubating this peptide alone (1 mg/ml) or a mixture of HA-1 or anti–ErbB-2 Ab-8 (Table 1) and peptide (1 mg/ml) overnight before adding the secondary antibody. Staining was evaluated and photographed with a Nikon Axiophot epifluorescence microscope.


   Results
Top
 Abstract
 Introduction
 Methods
 Results
Discussion
 References
 
Detection of SMC RNA by RT–PCR and Northern Blot Analysis Assay
PCR products of appropriate size were obtained from human corneal and conjunctival epithelial biopsies using primers specific for the ASGP-1 and for the ASGP-2 regions of SMC cDNA (Fig. 1A ). To confirm the RT–PCR results, Northern blot analysis was also performed on RNA isolated from primary human central corneal and limbal epithelial cultures, a human conjunctival biopsy, and fibroblasts cultured from human conjunctiva, limbus, and cornea. A 2-kb fragment of MUC4ß (ASGP-2) cDNA was used to probe a Northern blot specimen containing total RNA of human ocular surface epithelial cells and fibroblasts cultured from cornea, limbus, and conjunctiva. Only epithelial cells (Fig. 1B) , not fibroblasts, expressed SMC mRNA. A strong hybridization signal was observed in conjunctival epithelial cells (Fig. 1CJ ), a slightly less intense signal was observed in limbal epithelial cells (Fig. 1L1 and L2) , and a faint signal was observed in corneal epithelial cells (Fig. 1CO ). There were at least three SMC transcripts expressed by these cultured ocular surface epithelial cells. The major band was approximately 22 kb, characteristic of high-molecular-weight mucin mRNAs, and the other two bands were approximately 5 and 2 kb, respectively. In contrast, a 1.4-kb GAPDH mRNA was similarly expressed by all samples (Fig. 1B) .



View larger version (50K):
[in this window]
[in a new window]
  		Figure 1. (A) Ethidium bromide–stained agarose gel of RT–PCR products amplifying SMC RNA sequences in human colon (+control), cornea, and conjunctiva. Plus (+) and minus (-) signs indicate whether cDNA synthesis reactions were performed with reverse transcriptase. Upper: 468-bp product specific for ASGP-2; Lower: 442-bp product specific for ASGP-1 (MUC4). (B) Northern blot analysis of MUC4 mRNA in primary cultured epithelial cells and third-passage fibroblasts of human ocular surface tissues. Total RNA blots were probed with a 32P-labeled 2-kb fragment of ASGP-2 cDNA and then reprobed with a 32P-GAPDH as a loading control after the first probe was stripped. CO, cornea; L, limbus (L1 and L2 are two different limbal epithelial cultures); CJ, conjunctiva. See Methods section for details.

 
Antibody Specificity
The SMC antibodies used in this work (Table 1) , 13C4, 4F12, HA-1, HA2-3, and 15H10, have been extensively characterized in studies of both rat and human samples. Antibodies 13C4 and 4F12 were prepared in mice; their epitopes map by deletion analyses to the central region and N-terminal 53 amino acids of ASGP-2, respectively.30 Their specificity has been demonstrated by immunoblots of purified rat ASGP-2 and of immunoprecipitants of rat18 32 33 or human (Carvajal ME, Carraway KL, unpublished data, February 1999) SMC, staining a band of 120 to 140 kDa. HA-1 is a rabbit polyclonal antibody made against a peptide from the C-terminal of rat ASGP-1, which is highly conserved (rat sequence, AGYRPPRPAWTFGD; human sequence, ATYRPPQPAWMFGD). This antibody was previously used in the characterization of the expression of SMC of the rat ocular surface and tear film.18 To confirm that HA-1 specifically reacts with the SMC peptide sequence in human tissues, SMC was immunoprecipitated from human corneal epithelial lysates then immunoblotted with HA-1 or HA-1 plus the HA-1 peptide (2 mg/ml). A strong band of staining was observed with HA-1 antibody, but not with preimmune sera (Fig. 2A , upper panel). This staining was blocked when HA-1 was coincubated with the HA-1 peptide (Fig. 2A , bottom panel). In contrast, HA-1 peptide did not block the immunoreactivity of an ErbB-2–specific antibody with ErbB-2 that was coimmunoprecipitated with SMC from human corneal epithelial cells (Fig. 2B) .



View larger version (26K):
[in this window]
[in a new window]
  		Figure 2. (A) Immunoprecipitation of primary human corneal epithelial cultures with anti–ASGP-1 antibody 15H10 or preimmune sera (negative control). Immunoblots were probed with rat ASGP-1 peptide–specific polyclonal antibody HA-1 (upper panel) or HA-1 plus HA-1 peptide 2 mg/ml (lower panel). (B) Immunoprecipitation of primary human corneal epithelial cultures with anti–ASGP-1 antibody 15H10 or preimmune sera (negative control). Immunoblots were probed with a human Erb-B2–specific monoclonal antibody (Ab-8) or Ab-8 plus HA-1 peptide (2 mg/ml).

 
HA2-3 is a rabbit polyclonal antibody made against a relatively nonconserved peptide (LDNQTVTFQPDHEDGG) from human ASGP-2. Its reactivity to human ASGP-2 has been shown by immunoprecipitation analyses from human milk or salivary gland, followed by immunoblotting with 4F12 or HA-1. To confirm that HA2-3 specifically reacts with the SMC peptide sequence in human tissues, SMC was immunoprecipitated from human corneal epithelial cell lysates with HA2-3 or HA2-3 plus the HA2-3 peptide (0.25–2mg/ml), then blotted with an ASGP-2 antibody 4F12. A strong band of staining was observed with HA2-3 alone, but this staining decreased as the concentration of HA2-3 peptide in the immunoprecipitation reaction was increased (Fig. 3A ). HA2-3 peptide did not block the immunoreactivity of an ErbB-2–specific antibody with ErbB-2 that was coimmunoprecipitated with SMC from MV-MATC1 cells or A375 human melanoma cells (Fig. 3B) .



View larger version (34K):
[in this window]
[in a new window]
  		Figure 3. (A) Immunoprecipitation of MV-MAT C1 rat ascites mammary adenocarcinoma cells or primary human corneal epithelial cultures with anti-human ASGP-2 peptide antibody HA2-3, antibody HA2-3 plus HA2-3 peptide (0.25–2.0 mg/ml), or preimmune sera (negative control). Immunoblots were probed with ASGP-2–specific monoclonal antibody 4F12. (B) Immunoprecipitation of A375 human melanoma cells or MV-MAT C1 rat ascites mammary adenocarcinoma cells with anti-human ASGP-2 peptide antibody HA2-3 or preimmune sera (negative control). Immunoblots were probed with a human Erb-B2–specific monoclonal antibody (Ab-8) or Ab-8 plus HA2-3 peptide (2 mg/ml).

 
15H10 is a mouse monoclonal antibody made against purified rat SMC and has been used in the characterization of ASGP-1 in rat uterus33 and airway.33 Extensive studies have shown that this antibody is carbohydrate-dependent.34 Antibody 15H10 immunoprecipitated a high Mr band from cultured human corneal epithelial cells (Fig. 2A) that has a similar motility to rat SMC (MUC4). HA-1 and 15H10 both stain a similar high Mr band in immunoprecipitants of SMC from human milk but do not react with immunoprecipitants of MUC1 from that source (data not shown).

Immunodetection of SMC in the Ocular Surface Epithelia and Tear Fluid
Sialomucin complex was immunoprecipitated from the corneal and conjunctival epithelial specimens and from the tear fluid using ASGP-1–specific antibodies. After SDS–PAGE and immunoblotting, the ASGP-1 and ASGP-2 subunits of SMC were detected in tear fluid samples (Fig. 4) . Sialomucin complex was detected in both corneal and conjunctival epithelia by two methods. The first was by immunoprecipitation of tissue lysates with monoclonal antibody 15H10, followed by immunoblotting with anti–ASGP-1 HA-1 (Fig. 5) . In the second, tissue lysates were immunoprecipitated with HA2-3, followed by immunoblotting with monoclonal antibody 4F12, both of which recognize human ASGP-2 (Fig. 6) . The sequential immunoprecipitation and immunoblot analysis provides a higher degree of specificity than straight immunoblot analysis. Furthermore, in each case the immunoblotted bands from the human tissues migrated similarly to the corresponding bands observed in rat ocular surface epithelia (data not shown).



View larger version (29K):
[in this window]
[in a new window]
  		Figure 4. Immunoprecipitation of two human tear samples and positive control (TPK SUP) with anti–ASGP-1 antibody HA-1. Immunoblots were probed with monoclonal antibodies 13C4 (ASGP-2–specific) and 15H10 (ASGP-1–specific). TPK SUP, microvilli extracted from MV-MAT C1 rat ascites mammary adenocarcinoma cells.

 


View larger version (31K):
[in this window]
[in a new window]
  		Figure 5. Immunoprecipitation of cornea and conjunctival epithelia and positive control (TPK sup, microvilli extracted from MV-MAT C1 rat ascites mammary adenocarcinoma cells) with antibody 15H10. Immunoblot was probed with antibody HA-1 (ASGP-1–specific).

 


View larger version (47K):
[in this window]
[in a new window]
  		Figure 6. Immunoprecipitation of primary corneal epithelial cultures, carcinoma of human tongue, normal human tongue, and positive control (MV-MAT C1 rat ascites mammary adenocarcinoma cells) with antibody HA2-3 (ASGP-2–specific) or preimmune sera. Immunoblot was probed with antibody 4F12 (ASGP-2–specific).

 
Immunolocalization of SMC in the Ocular Surface Epithelia and Preocular Tear Layer
The results of immunofluorescence antibody staining of corneal and conjunctival tissue sections are summarized in Table 2 . The ASGP-1 peptide–specific antibody HA-1 stained the full thickness of the stratified corneal and conjunctival epithelia (Figs. 7B 7E ). In contrast, antibody 15H10, which reacts against a carbohydrate epitope on ASGP-1, stained only the superficial layers of these epithelia (Figs. 7A 7D) . No staining was observed in conjunctival goblet cells, in agreement with results in the rat reported previously.18 The secondary antibodies alone stained occasional cells in the conjunctival and limbal stroma, but no staining was observed in the corneal or conjunctival epithelium (Figs. 7G 7H) .


View this table:
[in this window]
[in a new window]
  		Table 2. Results of Immunofluorescence Staining on Tissue Sections

 


View larger version (30K):
[in this window]
[in a new window]
  		Figure 7. Immunofluorescence photomicrographs of corneal and conjunctival frozen tissue sections stained with antibodies 15H10 (A, D), HA-1 (B, E), and both HA-1 (red) and 15H10 (green; C, F). Negative controls consisted of sections stained with FITC– (G) or Texas red– (H) conjungated secondary antibodies. The epithelial layer is labeled with an E in the sections, and the junction between the epithelium and stroma is delineated with a dotted line.

 
To confirm the specificity of polyclonal antibody HA-1 staining of human ocular surface epithelia for the HA-1 peptide sequence, an additional experiment was performed in which HA-1 was preincubated with HA-1 peptide (1 mg/ml) overnight before tissue sections were stained. Figure 8 demonstrates a marked (>50%) decrease in the intensity of HA-1 staining of the corneal and conjunctival epithelia when this antibody was preincubated with HA-1 peptide. No staining was observed with HA-1 peptide plus secondary antibody, preimmune sera plus secondary antibody, or secondary antibody alone. Preincubation of an Erb-B–specific antibody with HA-1 peptide did not reduce the intensity of staining with this antibody.



View larger version (106K):
[in this window]
[in a new window]
  		Figure 8. Immunofluorescence photomicrographs of human corneal frozen tissue sections stained with ASGP-1 polyclonal antibody HA-1 (A) or HA-1 preincubated with HA-1 peptide, 1 mg/ml (B). Human conjunctival frozen tissue sections were stained with ASGP-1 polyclonal antibody HA-1 (C) or HA-1 preincubated with HA-1 peptide, 1 mg/ml (D), preimmune sera plus secondary antibody (E), secondary antibody alone (F), HA-1 peptide plus secondary antibody (G), ErbB-2 monoclonal antibody, Ab-8 (H), or ErbB-2 monoclonal antibody Ab-8 preincubated with HA-1 peptide, 1 mg/ml (I).

 
The results of immunofluorescence antibody staining of corneal and conjunctival impression cytology specimens are summarized in Table 3 . Impression cytology specimens from the cornea and conjunctiva were evaluated for ASGP-1 expression to determine whether the mucin subunit was present in the preocular tear layer. The ASGP-1 peptide antibody HA-1 stained the conjunctival and corneal epithelial cells on the cytology membranes and weakly stained cell-free areas on the cornea (Figs. 9B 9E ). In contrast, antibody 15H10 stained the corneal and conjunctival epithelial cells as well as the cell-free areas on cytology membranes, indicating that the specifically glycosylated form of this mucin is abundant in the preocular tear layer (Figs. 9A 9E) . No staining was observed in corneal and conjunctival cytology specimens stained with the secondary antibody alone (Figs. 9G 9H) .


View this table:
[in this window]
[in a new window]
  		Table 3. Results of Immunofluorescence Staining on Cytology Specimens

 


View larger version (56K):
[in this window]
[in a new window]
  		Figure 9. Immunofluorescence photomicrographs of impression cytology specimens of cornea and conjunctiva (Conj) stained with antibodies 15H10 (A, D), HA-1 (B, E), and both HA-1 (red) and 15H10 (green; C, F). Negative controls consisted of conjunctival cytology specimens stained with FITC– (G) or Texas red– (H) conjugated secondary antibodies.

 
The immunofluorescence staining patterns for the membrane mucin MUC1 and goblet cell mucin in the corneal and conjunctival epithelium were different from those observed for SMC. The MUC1 antibody CT-1 strongly stained the basal epithelium in the conjunctiva and limbus and weakly stained the superficial epithelium in the cornea (data not shown). No staining was noted on cell-free areas on conjunctival cytology specimens and only weak staining was noted on cell-free areas on corneal cytology specimens (not shown). The goblet cell mucin antibody AM-3 stained only the goblet cells located in the conjunctiva and conjunctival side of the limbus, but not the corneal epithelium or precorneal tear layer (data not shown).


   Discussion
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
References
 
Our study indicates that SMC (MUC4) is produced by the human ocular surface epithelium. A peptide epitope of the mucin subunit was immunodetected throughout the entire thickness of the stratified epithelium in the conjunctiva, limbus, and cornea. In contrast, a carbohydrate-dependent epitope of ASGP-1 was expressed in a differentiation-dependent fashion, such that the greatest staining was observed primarily in the superficial differentiated epithelial cells. The glycosylated form of ASGP-1 was also detected in the preocular tear layer removed by impression cytology. The mature glycosylated form of this mucin in the cell membrane and surface of the superficial ocular surface epithelium could function to hold aqueous tear fluid produced by the lacrimal glands in the preocular tear layer and serve as a lubricative barrier to frictional stresses exerted by the eyelids.

The pattern of multiple SMC RNA transcripts with an unusually large size that was observed in the ocular surface epithelium is consistent with previously reported studies that evaluated MUC4 mRNA expression in nonocular tissues.35 36 37 38 39 A high degree of polydispersity is a typical feature of the mucin mRNAs. Moreover, allelic variations in the length of these mucin transcripts have been observed.36

In addition to the preocular tear layer, SMC was also detected in tear fluid collected from the inferior tear meniscus. It still remains to be determined whether SMC in the tear fluid is derived from the underlying epithelium or from other sources, such as the lacrimal gland. Mucins have been histochemically detected in subsurface cytoplasmic vesicles located within the superficial layers of the conjunctival epithelium in studies reported previously by Greiner and associates40 and Dilly.3 These vesicles have been observed to fuse with the cell membrane in a manner in which the inner lamella of these vesicles becomes the outer layer of the cell surface membrane.6 This process transfers the mucus within the cytoplasmic vesicles to the cell surface membrane and to the preocular tear layer. Future ultrastructural studies may determine whether SMC is one of the mucin species processed and transported to the epithelial cell surface in this manner.

The fact that a number of different mucin molecules are produced by the ocular surface epithelium suggests that each may have a unique role. The detection of SMC in the preocular tear layer removed by impression cytology, as well as in the tear fluid, suggests that this mucin may play an important role in ocular surface barrier function and in maintenance of tear film stability. In a separate series of experiments, we have shown that there is a transient increase in fluorescein permeability associated with tear film instability and decreased reflecting quality of the corneal surface in the focal area where SMC is removed from the corneal surface. Based on these findings, we propose that ASGP-1 may serve as the glycocalyx coating the microvilli and microplicae of the superficial layer of the ocular surface epithelium. Chemical attractions between this adherent mucus layer and the soluble mucin in the overlying aqueous layer may be integrally important for maintaining tear film structure and to stability, as presented in Figure 10 .



View larger version (24K):
[in this window]
[in a new window]
  		Figure 10. Proposed interaction of membrane and soluble SMC in the precorneal tear layer. Membrane bound SMC may serve as the glycocalyx coating the microvilli and microplicae of the superficial layer of the ocular surface epithelium. Chemical attractions between this adherent mucus layer and soluble sialomucin in the overlying aqueous layer may help to maintain tear film structure and stability.

 
Unlike SMC, goblet cell mucin (detected by antibody AM-3) could not be immunodetected in corneal tissue sections or impression cytology membranes. This finding is consistent with previous observations of Dilly3 that mucin produced by the stratified epithelial cells, but not the goblet cells, can be histochemically detected in the preocular mucus layer. Further experiments will be required to determine whether goblet cell mucin is indeed absent from the precorneal mucin layer, and if it is present, how it interacts with SMC and the other membrane mucins that are produced by the ocular surface epithelium, such as MUC1. MUC1 expression in the conjunctival and limbal epithelia was limited to the basal epithelium, and only minimal staining was observed in the superficial corneal epithelium. These findings suggest that MUC1 may have a different functional role than SMC.

The ASGP-2 subunit of SMC contains two functional EGF-like domains. Our group has detected the presence of ErbB-2 receptors in the cell membranes of the ocular surface epithelium.41 We demonstrated (Fig. 2B) that ErbB-2 is coimmunoprecipitated with SMC. Thus, it is possible that proper processing of SMC places its EGF domains in a position in which they may interact with these ErbB-2 receptors. If this proves to be the case, ASGP-2 could potentially have an autocrine signaling function that may be important for promoting normal growth and differentiation of the ocular surface epithelium. Binding of ASGP-2 to the ErbB family receptor ErbB-2 has been noted to potentiate tyrosine phosphorylation of this receptor.23

Gene sequencing studies indicate that there is a significant homology between SMC and MUC4 mucin.24 25 Inatomi reported that MUC4 RNA was expressed in the stratified epithelium of the conjunctiva by in situ hybridization but not in corneal sections.13 They also failed to detect MUC4 RNA in cultured human corneal epithelium by Northern blot analysis. We detected SMC RNA transcripts in both human corneal and conjunctival biopsies by the sensitive RT–PCR technique. One of the segments amplified by PCR has been reported to be conserved between MUC4 and SMC.24 25 Our Northern blot analysis also demonstrated expression of SMC/MUC4 RNA in primary human corneal and limbal epithelial cultures, although the observed level of expression was greater in the limbal than central epithelium. This observation might explain the difference between our study and the study reported by Inatomi, if the cultured epithelium they used was obtained from the central cornea. It is also possible that the level of MUC4 RNA in the human corneal epithelium was below the level of detection by in situ hybridization. Our study also used several methods to immunodetect SMC in the corneal epithelium. These studies certainly indicate that SMC/MUC4 protein is expressed in the cornea.


   Footnotes
 
Supported by NIH grants CA52498, EY12343, and EY11915–01; Grant-in-Aid No. GA 97097 from Fight-for-Sight Research Division of Prevent Blindness America; an unrestricted Grant for Research to Prevent Blindness; and the Drs. David and Maureen Smith Ocular Surface and Tear Research Fund.

Submitted for publication February 5, 1999; revised August 16 and December 2, 1999; accepted December 28, 1999.

Commercial relationships policy: N.

Corresponding author: Stephen C. Pflugfelder, Bascom Palmer Eye Institute, University of Miami School of Medicine, 900 NW 17th Street, Miami, FL 33136. spflugfelder{at}bpei.med.miami.edu


   References
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Chen, HB (1998) Histochemical study on rat tear film and ocular surface epithelial cells Curr Eye Res 17,642-649[Medline][Order article via Infotrieve]
  2. Corfield, AP, Carrington, SD, Hicks, SJ, Berry, M, Ellingham, R. (1997) Ocular mucins: purification, metabolism and functions Prog Retin Eye Res 16,627-656
  3. Dilly, PN (1985) Contribution of the epithelium to the stability of the tear film Trans Ophthalmol Soc UK 104,381-389
  4. Nichols, BA (1985) Demonstration of the mucous layer of the tear film by electron microscopy Invest Ophthalmol Vis Sci 26,464-473[Abstract/Free Full Text]
  5. Gendler, SJ (1995) Epithelial mucin genes Annu Rev Physiol 57,607-634[Medline][Order article via Infotrieve]
  6. Strous, GJ, Dekker, J. (1992) Mucin-type glycoproteins Crit Rev Biochem Mol Biol 27,57-92[Medline][Order article via Infotrieve]
  7. Carraway, KL, Hull, SR (1991) Cell surface mucin-type glycoproteins and mucin-like domains Glycobiology 1,131-138[Abstract/Free Full Text]
  8. Gum, JRJ (1995) Human mucin glycoproteins: varied structures predict diverse properties and specific functions Biochem Soc Trans 23,795-799[Medline][Order article via Infotrieve]
  9. Bobek, LA (1993) Molecular cloning, sequence, and specificity of expression of the gene encoding the low molecular weight human salivary mucin (MUC7) J Biol Chem 268,20563-20569[Abstract/Free Full Text]
  10. Boshell, M. (1992) The product of the human MUC1 gene when secreted by mouse cells transfected with the full-length cDNA lacks the cytoplasmic tail Biochem Biophys Res Commun 185,1-8[Medline][Order article via Infotrieve]
  11. Williams, CJ (1990) Multiple protein forms of the human breast tumor-associated epithelial membrane antigen (EMA) are generated by alternative splicing and induced by hormonal stimulation Biochem Biophys Res Commun 170,1331-1338[Medline][Order article via Infotrieve]
  12. Inatomi, T. (1995) Human corneal and conjunctival epithelia express MUC1 mucin Invest Ophthalmol Vis Sci 36,1818-1827[Abstract/Free Full Text]
  13. Inatomi, T. (1996) Expression of secretory mucin genes by human conjunctival epithelia Invest Ophthalmol Vis Sci 37,1684-1692[Abstract/Free Full Text]
  14. McNeer, RR (1997) Sialomucin complex in tumors and tissues Front Biosci 2,d449-d459
  15. Sherblom, AP, Carraway, KL (1980) A complex of two cell surface glycoproteins from ascites mammary adenocarcinoma cells J Biol Chem 255,12051-12059[Free Full Text]
  16. Hull, SR, Sheng, Z, Vanderpuye, OA, David, C, Carraway, KL (1990) Isolation and partial characterization of ascites sialoglycoprotein-2 of the cell surface sialomucin complex of 13762 rat mammary adenocarcinoma cells Biochem J 265,121-129[Medline][Order article via Infotrieve]
  17. McNeer, RR, Price–Schiavi, S, Komatsu, M, Fregein, N, Carothers Carraway, CA, Carrraway, K (1997) Sialomucin complex in tumors and tissues Front Biosci 2,449-459
  18. Price–Schiavi, SA, Meller, D, Jing, X, et al (1998) Sialomucin complex at the rat ocular surface: a new model for ocular surface protection Biochem J 335,457-463
  19. Sheng, Z, Wu, K, Carraway, KL, Fregein, N. (1992) Molecular cloning of the transmembrane component of the 13762 mammary adenocarcinoma sialomucin complex: a new member of the epidermal growth factor superfamily J Biol Chem 267,16341-16346[Abstract/Free Full Text]
  20. Wu, K, Fregein, N, Carraway, KL (1994) Molecular cloning and sequencing of the mucin subunit of a heterodimeric, bifunctional cell surface glycoprotein complex of ascites rat mammary adenocarcinoma cells J Biol Chem 269,11950-11955[Abstract/Free Full Text]
  21. Sheng, ZQ, Hull, SR, Carraway, KL (1990) Biosynthesis of the cell surface sialomucin complex of ascites 13762 rat mammary adenocarcinoma cells from a high molecular weight precursor J Biol Chem 265,8505-8510[Abstract/Free Full Text]
  22. Carraway, KL, Carothers Carraway, CA, Carraway, KLI. (1997) Roles of ErbB-3 and ErbB-4 in the physiology and pathology of the mammary gland J Mammary Gland Biol Neoplasia 2,187-197[Medline][Order article via Infotrieve]
  23. Carraway, KLI, Rossi, EA, Komatsu, M, et al (1999) An intramembrane modulator of the ErbB2 receptor tyrosine kinase that potentiates neuregulin signaling J Biol Chem 274,5263-5266[Abstract/Free Full Text]
  24. Nollett, S, Moniaux, N, Maury, J, et al (1998) Human mucin gene MUC4: organization of its 5'-region and polymorphism of its central tandem repeat array Biochem J 332,739-748
  25. Moniaux, N, Nollet, S, Porchet, N, Degand, P, Laine, A, Aubert, JP (1999) Complete sequence of human MUC4: putative cell membrane-associated mucin Biochem J 338,325-333
  26. Porchet, N, Nguyen, VC, Dufosse, J, et al (1991) Molecular cloning and chromosomal localization of a novel human tracheo-bronchial mucin cDNA containing tandemly repeated sequences of 48 base pairs Biochem Biophys Res Commun 175,414-422[Medline][Order article via Infotrieve]
  27. Jones, DT, Monroy, D, Pflugfelder, SC (1997) A novel method of tear collection: comparison of glass capillary tubes with porous polyester rods Cornea 16,450-458[Medline][Order article via Infotrieve]
  28. Pflugfelder, SC, Tseng, SCG, Yoshino, K, Monroy, D, Felix, C, Reis, B. (1997) Correlation of goblet cell density and mucosal epithelial membrane mucin expression with rose bengal staining in patients with ocular irritation Ophthalmology 104,223-235[Medline][Order article via Infotrieve]
  29. Tseng, SC, Li, DQ, Ma, X. (1999) Suppression of transforming growth factor beta isoforms, TGF-beta receptor type II, and myofibroblast differentiation ion cultured human corneal and limbal fibroblasts by amniotic membrane matrix J Cell Physiol 179,325-335[Medline][Order article via Infotrieve]
  30. Rossi, EA, McNeer, RR, Price–Schiavi, S, et al (1996) Sialomucin complex, a heterodimeric glycoprotein complex: expression as a soluble, secretable form in lactating mammary gland and colon J Biol Chem 271,33476-33485[Abstract/Free Full Text]
  31. Jones, DT, Monroy, D, Ji, Z, Atherton, SS, Pflugfelder, SC (1994) Sjogren’s syndrome: cytokine and Epstein-Barr virus gene expression within the conjunctival epithelium Invest Ophthalmol Vis Sci 35,3493-3504[Abstract/Free Full Text]
  32. McNeer, RR, Huang, D, Fregien, NL, Carraway, KL (1998) Sialomucin complex in the rat respiratory tract: a model for its role in epithelial protection Biochem J 330,737-744
  33. McNeer, RR, Carraway, CAC, Fregien, NL, Carraway, KL (1998) Characterization of the expression and steroid hormone control of sialomucin complex in the rat uterus: Implications for uterine receptivity J Cell Physiol 176,110-119[Medline][Order article via Infotrieve]
  34. Rossi, EA. (1996) Characterization of the Tissue and Cell Specific Expression of Ascites Sialoglycoprotein-2 and Its Association with p185neu University of Miami Miami, FL. Thesis
  35. Liu, B, Offner, GD, Nunes, DP, Oppenheim, FG, Troxler, RF (1998) MUC4 is a major component of salivary mucin MG1 secreted by the human submandibular gland Biochem Biophys Res Commun 250,757-761[Medline][Order article via Infotrieve]
  36. Debailleul, V, Laine, A, Huet, G, et al (1998) Human mucin genes MUC2, MUC3, MUC4, MUC5AC, MUC5B, and MUC6 express stable and extremely large mRNAs and exhibit a variable length polymorphism: an improved method to analyze large mRNAs J Biol Chem 273,881-890[Abstract/Free Full Text]
  37. Baeckstrom, D, Hansson, GC (1996) The transcripts of the apomucin genes MUC2, MUC4, and MUC5AC are large and appear as distinct bands Glycoconj J 13,833-837[Medline][Order article via Infotrieve]
  38. Balague, C, Gambus, G, Carrato, C, et al (1994) Altered expression of MUC2, MUC4, and MUC5 mucin genes in pancreas tissues and cancer cell lines Gastroenterology 106,1054-1061[Medline][Order article via Infotrieve]
  39. Bernacki, SH, Nelson, AL, Abdullah, L, et al (1999) Mucin gene expression during differentiation of human airway epithelia in vitro: muc4 and muc5b are strongly induced Am J Respir Cell Mol Biol 20,595-604[Abstract/Free Full Text]
  40. Greiner, JV, Kenyon, KR, Henriquez, AS, et al (1980) Mucus secretory vesicles in conjunctival epithelial cells of wearers of contact lenses Arch Ophthalmol 98,1843-1846[Abstract]
  41. Liu Z, Carvajal M, Carraway CAC, Carraway KL, Pflugfelder SC. Increased expression of the type 1 growth factor receptor family in the conjunctival epithelium of patients with keratoconjunctivitis sicca. Am J Ophthalmol. In press.
  42. Huang, AJ (1987) Development of monoclonal antibodies to rabbit ocular mucin Invest Ophthalmol Vis Sci 28,1483-1491[Abstract/Free Full Text]
  43. Pemberton, L, Taylor–Papadimitriou, J, Gendler, SJ (1992) Antibodies to the cytoplasmic domain of MUC1 mucin show conservation throughout mammals Biochem Biophys Res Commun 185,167-175[Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
 IOVSHome page
T. D. Blalock, S. J. Spurr-Michaud, A. S. Tisdale, and I. K. Gipson
Release of Membrane-Associated Mucins from Ocular Surface Epithelia
Invest. Ophthalmol. Vis. Sci., May 1, 2008; 49(5): 1864 - 1871.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
A. E. Rodriguez, J. L. Rodriguez-Prats, I. M. Hamdi, A. Galal, M. Awadalla, and J. L. Alio
Comparison of Goblet Cell Density after Femtosecond Laser and Mechanical Microkeratome in LASIK
Invest. Ophthalmol. Vis. Sci., June 1, 2007; 48(6): 2570 - 2575.
[Abstract] [Full Text] [PDF]

Home page
 GlycobiologyHome page
A. N. Round, T. J. McMaster, M. J. Miles, A. P. Corfield, and M. Berry
The isolated MUC5AC gene product from human ocular mucin displays intramolecular conformational heterogeneity
Glycobiology, June 1, 2007; 17(6): 578 - 585.
[Abstract] [Full Text] [PDF]

Home page
 Hum ReprodHome page
C. L. Russo, S. Spurr-Michaud, A. Tisdale, J. Pudney, D. Anderson, and I. K. Gipson
Mucin gene expression in human male urogenital tract epithelia
Hum. Reprod., November 1, 2006; 21(11): 2783 - 2793.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Y. Hori, S. J. Spurr-Michaud, C. L. Russo, P. Argueso, and I. K. Gipson
Effect of Retinoic Acid on Gene Expression in Human Conjunctival Epithelium: Secretory Phospholipase A2 Mediates Retinoic Acid Induction of MUC16
Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4050 - 4061.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Y. Hayashi, W. W.-Y. Kao, N. Kohno, M. Nishihara-Hayashi, A. Shiraishi, T. Uno, M. Yamaguchi, S. Okamoto, M. Maeda, T. Ikeda, et al.
Expression Patterns of Sialylated Epitope Recognized by KL-6 Monoclonal Antibody in Ocular Surface Epithelium of Normals and Dry Eye Patients
Invest. Ophthalmol. Vis. Sci., July 1, 2004; 45(7): 2212 - 2217.
[Abstract] [Full Text] [PDF]

Home page
 Br. J. Ophthalmol.Home page
M Berry, R B Ellingham, and A P Corfield
Human preocular mucins reflect changes in surface physiology
Br. J. Ophthalmol., March 1, 2004; 88(3): 377 - 383.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Y. Hori, S. Spurr-Michaud, C. L. Russo, P. Argueso, and I. K. Gipson
Differential Regulation of Membrane-Associated Mucins in the Human Ocular Surface Epithelium
Invest. Ophthalmol. Vis. Sci., January 1, 2004; 45(1): 114 - 122.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
L. P. Aristoteli and M. D. P. Willcox
Mucin Degradation Mechanisms by Distinct Pseudomonas aeruginosa Isolates In Vitro
Infect. Immun., October 1, 2003; 71(10): 5565 - 5575.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
C. H. Tran, C. Routledge, J. Miller, F. Miller, and S. A. Hodson
Examination of Murine Tear Film
Invest. Ophthalmol. Vis. Sci., August 1, 2003; 44(8): 3520 - 3525.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
P. Argueso, S. Spurr-Michaud, C. L. Russo, A. Tisdale, and I. K. Gipson
MUC16 Mucin Is Expressed by the Human Ocular Surface Epithelia and Carries the H185 Carbohydrate Epitope
Invest. Ophthalmol. Vis. Sci., June 1, 2003; 44(6): 2487 - 2495.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. M. Fischer, J. G. Cuellar, M. L. Diehl, A. M. deFreytas, J. Zhang, K. L. Carraway, and J. A. Voynow
Neutrophil elastase increases MUC4 expression in normal human bronchial epithelial cells
Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L671 - L679.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
M. Berry, A. Harris, and A. P. Corfield
Patterns of Mucin Adherence to Contact Lenses
Invest. Ophthalmol. Vis. Sci., February 1, 2003; 44(2): 567 - 572.
[Abstract] [Full Text] [PDF]

Home page