| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 From the Division of Biology, California Institute of Technology, Pasadena; the 2 Mary D. Allen Laboratory for Vision Research, Doheny Eye Institute, Department of Ophthalmology and Department of Cell and Neurobiology, University of Southern California, School of Medicine, Los Angeles; and 3 The Burnham Institute, La Jolla, California.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
METHODS. An expression vector using the 5' regulatory region of the murine opsin gene was used to target the expression of BAG-1 specifically to photoreceptor cells of mice. The BAG-1 transgenic mice were crossed to Bcl-2 transgenics to obtain animals that coexpress the two transgenes in photoreceptor cells. BAG-1/Bcl-2 animals were then crossed to an RP mouse model (a transgenic line overexpressing the S334ter rhodopsin mutant) to assess the effect of coexpression of BAG-1 and Bcl-2 on retinal degeneration. Morphologic analysis was performed on retinas isolated at various times after birth to monitor disease progression.
RESULTS. High levels of BAG-1 expression resulted in retinal degeneration that was not prevented by Bcl-2 expression. However, coexpression of appropriate levels of BAG-1 and Bcl-2 was found to have a profound inhibitory effect on retinal degeneration caused by overexpression of a mutant rhodopsin transgene. Whereas expression of Bcl-2 alone was previously found to delay degeneration of the retina from 2 weeks to approximately 4 weeks of age, coexpression of BAG-1 and Bcl-2 inhibited photoreceptor cell death for as long as 7 to 9 weeks.
CONCLUSIONS. The synergistic effect against photoreceptor cell death produced by the coexpression of Bcl-2 and BAG-1 indicates that these proteins can function in concert to prevent cell death. At the correct dosage, coexpression of Bcl-2 and BAG-1 may serve as a potential means to treat retinal degenerative diseases.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Several components of the visual transduction pathway may be involved
in the origin of RP. Many mutations within genes whose products are
involved in phototransduction have been linked to the various forms of
RP.3
4
Numerous mutations have been identified within the
rhodopsin gene that are associated with the autosomal dominant form of
RP.5
In addition, defects in the genes encoding the 
and ß subunits of rod cyclic guanosine monophosphate (cGMP)
phosphodiesterase, as well as in the subunit of cGMP-gated cation
channel, have also been associated with the occurrence of
RP.6
7
8
Mutations within the genes encoding peripherin and
rom-1, which encode structural components of the outer disc membrane,
also lead to degeneration of the retina.9
10
11
Retinal
degeneration may also result from cellular insults such as constant
light exposure.12
13
14
Many of the genetic defects and
damaging effects of light act by initiating a programmed cell death
pathway in photoreceptor cells.15
16
17
Programmed cell death (apoptosis) is a physiological process that occurs during normal development and in certain pathologic states.18 Morphologic changes including cell shrinkage, chromatin condensation, and nuclear DNA fragmentation characterize the process. Resultant cellular debris is immediately phagocytosed by adjacent cells to avoid an inflammatory response. Many of the physical manifestations of apoptosis can easily be seen in a degenerating retina. Although, retinal degeneration results from a variety of mutations in genes involved in photoreception, as well as from certain environmental insults, the cellular response ultimately converges on a programmed cell death pathway. The initiating event that precipitates the decision to activate a programmed cell death pathway in photoreceptor cells remains to be determined.
A programmed cell death pathway that is regulated by several cellular genes such as Bcl-2 and BAG-1 has been described.19 Bcl-2 is a membrane-associated protein shown to inhibit cell death induced by a variety of stimuli.20 Overexpression of Bcl-2 in photoreceptors of mice with retinal degeneration temporarily delays disease progression.21 BAG-1 is a novel Bcl-2–binding protein that interacts both physically and functionally with Bcl-2 and has been shown to augment the anti-cell death activity of Bcl-2 in vitro.22 The temporary effect produced by the overexpression of Bcl-2 in slowing the onset of programmed cell death associated with retinal degeneration may result from low levels or the absence of proteins, such as BAG-1, which form a functional complex with Bcl-2. Therefore, Bcl-2 and BAG-1 were ectopically expressed in the photoreceptors of mice with retinal degenerative disease to determine whether their functional complex would enhance the protective effect afforded by Bcl-2 alone.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Generation of Transgenic Mouse Lines
Transgenic mice were generated by microinjection of the
purified expression construct into the pronuclei of fertilized eggs.
Injected embryos were allowed to develop to the two-cell stage by
incubating overnight at 37°C in 5% CO2 in
M16 medium (Cell & Molecular Technologies, Inc., Lavallette,
NJ). Two-cell embryos were then implanted into the oviducts of
pseudopregnant foster mothers. Genotype analysis of offspring was
accomplished by performing polymerase chain reaction (PCR) on genomic
DNA isolated from tail biopsy samples of offspring. Founder mice,
designated RhBAG-1A through D, were identified and mated to wild-type
animals to expand the colonies for further analysis. All animals were
treated in accordance with the ARVO Statement for the Use of Animals in
Ophthalmic and Vision Research.
Genotype Analysis
PCR was performed on genomic DNA isolated from tail biopsy samples
to screen for the presence of the various transgenes in the offspring
as follows: BAG-1: initial denaturation at 95°C for 3.5 minutes,
followed by 30 cycles of 94°C for 1 minute, 63°C for 1.5 minutes,
and 72°C for 1.5 minutes. DNA oligos Rh1.1 and BAG OP1 were used to
amplify the BAG-1 sequence; Bcl-2: initial denaturation at 94°C for 5
minutes, followed by 35 cycles of 94°C for 1 minute, 63°C for 2
minutes, and 72°C for 2 minutes. PCR samples were then cooled to
4°C. DNA oligos Rh1.1 and Bcl2 were used for Bcl-2 amplification;
S334ter rhodopsin mutant (Rho
CT): the same PCR conditions used for
amplification of Bcl-2 sequences were used, except the annealing
temperature was 54°C instead of 63°C. PCR was performed using DNA
oligos Rh2 and Rh3. Oligos were Rh1.1 5' GTGCCTGGAGTTGCGCTGTGGG 3', BAG
OP1 5' GTCACACTCTGCTAAGAACACCTGA 3', Bcl2 5' CCCTGTTCTCCCAGCGTGCGGC 3',
Rh2 5' TGGGAGATGACGACGCCTAA 3', and Rh3 5' TGAGGGAGGGGTACAGATCC 3'.
Western Blot Analysis
Protein immunoblot analysis was performed using retinal extract
preparations to assess expression levels of the transgenes. Extracts
were prepared by homogenizing a single retina in 100 µl of
phosphate-buffered saline (PBS). An equal volume of 2x sample-loading
dye was added to each sample, and aliquots were subjected to sodium
dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) using
12% Tris-HCl acrylamide gels. Proteins were transferred to nylon
membranes, which were blocked overnight at 4°C in a solution
containing 5% dry milk in 1x TBST (20 mM Tris [pH 7.5], 137 mM
NaCl, and 0.1% Tween-20). Filters were then incubated with the BAG-1
primary antibody at a 1:1000 dilution or with the Bcl-2 antibody at a
1:500 dilution in a solution containing 2% bovine serum albumin (BSA)
in 1x TBST at room temperature for 1 hour. BAG-1 antibody solution was
supplemented with 0.050 µg/µl ovalbumin. Filters were rinsed
several times with 1x TBST over approximately 30 minutes. Anti-rabbit
Ig horseradish peroxidase (HRP; Amersham, Arlington Heights, IL) was
used as the secondary antibody at a 1:2000 dilution in 1x TBST
supplemented with 0.050 µg/µl ovalbumin for BAG-1 and 1x TBST
containing 5% dry milk for Bcl-2. Secondary antibodies were incubated
with the filters for 1 hour at room temperature. After several rinses
with 1x TBST, a chemiluminescence detection system was used to
visualize the antibody–protein complex (ECL; Amersham). The rabbit
polyclonal antibody (BAG 1735-13) was generated using a synthetic
peptide corresponding to the C-terminal 16 amino acid residues of the
mouse BAG-1 protein.22
Bcl-2 antibody was a rabbit
polyclonal antibody (product number SC783; Santa Cruz Biotech, Santa
Cruz, CA). Purified recombinant His6-huBcl-2 and mBAG-1 protein were
used as controls.24
25
Tissue Processing for Light Microscopy
Retinal tissues for morphologic analysis were processed as
previously described26
with minor modifications.
Immunohistochemistry
Eyes were enucleated and placed in a solution containing 4%
paraformaldehyde in PBS. Eyecups, formed by removing the cornea and
lens, were kept in 4% paraformaldehyde for approximately 1 hour on
ice. Eyecups were rinsed extensively in cold PBS by changing the
solution several times over the course of an hour. Eyecups were then
embedded in polymerized acrylamide for sectioning, as previously
described.27
Cryosectioning was performed and 10-µm
sections were collected and stored at -80°C. Before immunostaining,
sections were thawed at room temperature and placed in a blocking
solution containing 0.5% BSA and 0.3% Triton X-100 in PBS. Several
drops of normal serum, obtained from the species in which the secondary
antibody was produced, were also added. After blocking was performed
for approximately 1 hour, the BAG-1 primary antibody was added at a
1:1000 dilution and the Bcl-2 primary antibody at a 1:25 dilution in
blocking solution for 1 hour. Sections were washed three times for 5
minutes with blocking solution. Fluorescein anti-rabbit IgG (H + L;
Vector, Burlingame, CA) was used as the secondary antibody, at a 1:100
dilution for 1 hour. Sections were washed three times for 5 minutes
each in blocking solution followed by three washes in PBS. Sections
were mounted under a glass coverslip in mounting medium (Vectashield;
Vector).
TdT-Mediated dUTP Nick End Labeling
TdT-mediated dUTP nick end labeling (TUNEL) analysis was
performed using the in situ cell death detection kit
(Boehringer–Mannheim, Mannheim, Germany) according to the
manufacturer’s instructions for cryopreserved tissue sections.
Sections were mounted under a glass coverslip in mounting medium
(Vectashield; Vector) containing 4', 6 diamidino-2-phenylindole (DAPI)
as a counterstain (Vector).
Morphometric Analysis
Morphometric analysis was performed by counting photoreceptor
cells within a 200-µm span of the central region of wild-type and
transgenic retinas that were oriented superior to inferior. Counts were
taken from two representative animals at each time point.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
CT), in which a nearly complete loss of photoreceptor
cells occurs by P15.
|
Expression Levels of BAG-1 and Bcl-2 in the Transgenic Retinas
Quantitation
of Bcl-2 and BAG-1 transgene expression by Western immunoblot analysis
using retinal extract preparations demonstrated that the Bcl-2 and
BAG-1 transgenes were expressed at similar levels in the single
transgenic retinas at 1 month of age (Fig. 3A ). Estimates of expressed protein levels were made by comparing the
intensity of bands obtained using various amounts of recombinant BAG-1
or Bcl-2 protein with the overall levels of transgene expression. The
total expressed protein is estimated to be approximately 400 to 800 ng
per retina for both the BAG-1 and the Bcl-2 transgenes. The amount of
the ectopically expressed proteins is considerably lower than the
amount of endogenous rhodopsin expression in a 4-week-old mouse
retina30
(0.31 nanomoles [12.4 µg] rhodopsin per
retina). Expression levels of BAG-1 and Bcl-2 in the double-transgenic
retinas, RhBAG-1B/Bcl-2B, were also analyzed and were found to be
similar (Fig. 3B)
. Therefore, whether expressed alone or together in
the photoreceptors, the overall protein levels of BAG-1 and Bcl-2 were
approximately the same.
|
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Because overexpression of BAG-1 was found to adversely affect the normal physiology of the photoreceptor cell and led to a moderate course of retinal degeneration, the photoreceptor environment in which the mutant rhodopsin transgene was expressed was somewhat compromised when coexpressed with BAG-1. Perhaps this compromised state of the photoreceptor cell does not permit the full degenerative effect usually produced by expression of the truncated rhodopsin to be exerted. It can be argued that it is this compromised state that allows the combined expression of BAG-1 and Bcl-2 to be more effective in preventing photoreceptor cell death than when Bcl-2 is expressed alone. However, this argument is not consistent with the observation that expression of BAG-1 alone is incapable of preventing photoreceptor cell death caused by the mutant rhodopsin transgene. The combined protective effect against photoreceptor cell death produced by the coexpression of BAG-1 and Bcl-2 suggests a synergy between these two proteins in the prevention of photoreceptor cell death.
Although the coexpression of BAG-1 and Bcl-2 significantly delays the retinal degenerative process, the rescued photoreceptor cells are probably not functional with respect to visual transduction. The level of BAG-1 expression in the transgenic lines analyzed produced an adverse affect on the overall morphology of the photoreceptor cell, specifically causing disorganization and shortening of the rod outer segments. Nonetheless, the integrity of the retina was maintained, and that could be sufficient to prolong function of the cone cells. Perhaps a lower level of BAG-1 expression that did not alter the physiology of the photoreceptor cell yet still enhanced the protective effect produced by Bcl-2 would result in functional photoreceptors and retention of vision in autosomal dominant forms of RP.
A variety of genes have been ectopically expressed in the retina without causing adverse effects. Although very high levels of Bcl-2 expression can lead to retinal degeneration, expression levels of Bcl-2 comparable to those of BAG-1 in the RhBAG-1B transgenic retinas had a minimal effect on retinal morphology. This indicates that the retina can tolerate certain levels of ectopic expression. Therefore, it was surprising that relatively low levels of BAG-1 expression caused photoreceptor cell death. This observation was also unexpected because previous reports indicate that high levels of BAG-1 expression in several cell culture systems as well as in certain tissues does not lead to cell death.22 23 Expression of BAG-1 caused a loss of photoreceptor cells within the first postnatal month; however, some photoreceptor cells survived for as long as 9 weeks (data not shown). The mechanism by which BAG-1 expression causes photoreceptor cells to die is not yet known. Many of the photoreceptors expressing BAG-1 were found to experience nuclear DNA fragmentation, evidenced by positive TUNEL staining (data not shown), suggesting that perhaps BAG-1 overexpression induces photoreceptors to die by an apoptotic mechanism. Perhaps, similar to Bcl-2, there is a minimal level of BAG-1 expression that would not cause death of photoreceptor cells. In future experiments it may be possible to introduce transgenes with inducible promoters that would permit in vivo manipulation of ectopic gene expression.
It has previously been shown that one of the isoforms of the human
homologue of BAG-1 (RAP46) interacts in vitro with the nuclear hormone
receptors for glucocorticoid, estrogen, and thyroid.32
Recently, it has been reported that the murine BAG-1 protein expressed
here also interacts with the retinoic acid receptor (RAR) and
interferes with certain biologic effects induced by
trans-retinoic acid.33
Mice that are null for
RARß2 and RAR
2 exhibit dysplasia and degeneration of the retina,
indicating that the RAR signaling pathway plays a fundamental role in
retinal development and maintenance.34
The importance of
retinoic acid in photoreceptor differentiation has also been
demonstrated.35
It is possible that the overexpression of
BAG-1 in photoreceptors causes abnormal retinal morphology and
degeneration by interacting with retinoic acid receptors and inhibiting
activation of their downstream effectors, which are normally required
for retinal development and maintenance.
The introduction of both the BAG-1 and Bcl-2 genes into photoreceptors of mice with an autosomal dominant form of RP was more effective in delaying the advance of retinal degeneration than the introduction of either gene alone. The additive inhibitory effect on the programmed cell death process produced by the combined expression of BAG-1 and Bcl-2 has also been demonstrated in cultured neuronal PC12 cells deprived of nerve growth factor.36 Coexpression of BAG-1 and Bcl-2 prevented the death of PC12 cells by interfering with caspase activation and with the generation of reactive oxygen species. It is not yet clear whether this is also the mechanism by which the combined expression of BAG-1 and Bcl-2 inhibits programmed cell death in the neural retina.
The programmed cell death process results in the formation of cell
remnants or apoptotic bodies that are immediately phagocytosed by
neighboring cells to avoid an inflammatory response. This rapid process
is evident in photoreceptor cells that express the truncated rhodopsin
transgene. A complete loss of photoreceptor cells occurs approximately
between P11 and P15 in the RhoCT animals. The mechanism by which
expression of the truncated rhodopsin protein leads to this rapid cell
death is currently unknown. Expression of BAG-1 and Bcl-2 in
photoreceptor cells expressing a defective rhodopsin transgene blocks
the photoreceptor cells from completing the cell death process. Many
photoreceptor cells undergo DNA fragmentation within the first month,
as assessed by TUNEL analysis (data not shown). This fragmentation is
thought to be a late stage in the apoptotic pathway, occurring just
before the disintegration of the cell and subsequent phagocytosis.
However, many photoreceptor nuclei remain relatively intact for more
than 2 months. Although, the coexpression of BAG-1 and Bcl-2 may
interfere with a late event in the cell death pathway initiated by the
mutant rhodopsin transgene, it probably is not with the removal process
of defective cells, because the surviving photoreceptor cells were not
all positive for the TUNEL assay.
The enhanced protective effect against photoreceptor cell death produced by the coexpression of Bcl-2 and BAG-1 indicates that these proteins act in concert to prevent cell death and play an important role in determining cell survival. The similar distribution patterns of BAG-1 and Bcl-2 proteins in the photoreceptor cell are consistent with BAG-1 and Bcl-2 interacting and cooperating to prevent cell death. Future experiments may elucidate the mechanism by which the combined expression of BAG-1 and Bcl-2 prolong photoreceptor cell survival. Although the enhanced protective effect produced by the coexpression of BAG-1 and Bcl-2 against photoreceptor cell death was still transient, the increase in photoreceptor cell survival from 2 weeks to approximately 4 weeks of age to greater than 9 weeks was significant. These results suggest that the coexpression of BAG-1 and Bcl-2, at the appropriate ratio and overall levels, may serve as a potential therapeutic approach to treat retinal degenerative diseases.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Submitted for publication April 29, 1999; revised December 7, 1999; accepted January 5, 2000.
Commercial relationships policy: N.
Corresponding author: Melvin I. Simon, Division of Biology, California Institute of Technology, Pasadena, California 91125. simonm{at}cco.caltech.edu
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
subunit of rod cGMP phosphodiesterase Nat Genet 11,468-471[Medline][Order article via Infotrieve]
subunit of the rod cGMP-gated channel in autosomal recessive retinitis pigmentosa Proc Natl Acad Sci USA 92,10177-10181-subunits Hollyfield, JG Anderson, RE LaVail, MM eds. Retinal Degeneration ,231-242 Plenum Press New York.
2 compound mutant mice Development 122,2173-2188[Abstract]
This article has been cited by other articles:
|
|
 |
|
  C. J. Zeiss, J. Neal, and E. A. Johnson Caspase-3 in Postnatal Retinal Development and Degeneration Invest. Ophthalmol. Vis. Sci., March 1, 2004; 45(3): 964 - 970. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Zeiss The Apoptosis-Necrosis Continuum: Insights from Genetically Altered Mice Vet. Pathol., September 1, 2003; 40(5): 481 - 495. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. He, G. A. Perkins, A. T. Poblenz, J. B. Harris, M. Hung, M. H. Ellisman, and D. A. Fox Bcl-xL overexpression blocks bax-mediated mitochondrial contact site formation and apoptosis in rod photoreceptors of lead-exposed mice PNAS, February 4, 2003; 100(3): 1022 - 1027. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. K. Vaughan, S. F. Coulibaly, R. M. Darrow, and D. T. Organisciak A Morphometric Study of Light-Induced Damage in Transgenic Rat Models of Retinitis Pigmentosa Invest. Ophthalmol. Vis. Sci., February 1, 2003; 44(2): 848 - 855. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. McNally, P. F. Kenna, D. Rancourt, T. Ahmed, A. Stitt, W. H. Colledge, D. G. Lloyd, A. Palfi, B. O'Neill, M. M. Humphries, et al. Murine model of autosomal dominant retinitis pigmentosa generated by targeted deletion at codon 307 of the rds-peripherin gene Hum. Mol. Genet., May 1, 2002; 11(9): 1005 - 1016. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. S. Papermaster The Birth and Death of Photoreceptors : The Friedenwald Lecture Invest. Ophthalmol. Vis. Sci., May 1, 2002; 43(5): 1300 - 1309. [Full Text] [PDF]
|
|
|
|
|
|
P. Eversole-Cire, J. Chen, and M. I. Simon Bax Is Not the Heterodimerization Partner Necessary for Sustained Anti-photoreceptor-Cell-Death Activity of Bcl-2 Invest. Ophthalmol. Vis. Sci., May 1, 2002; 43(5): 1636 - 1644. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kudoh, D. A. Knee, S. Takayama, and J. C. Reed Bag1 Proteins Regulate Growth and Survival of ZR-75-1 Human Breast Cancer Cells Cancer Res., March 1, 2002; 62(6): 1904 - 1909. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yang, R. Gross, S. Basinger, and S. Wu Apoptotic cell death of cultured salamander photoreceptors induced by cccp: CsA-insensitive mitochondrial permeability transition J. Cell Sci., January 5, 2001; 114(9): 1655 - 1664. [Abstract] [PDF]
|
|
|
|
|
|
Y Niyaz, M Zeiner, and U Gehring Transcriptional activation by the human Hsp70-associating protein Hap50 J. Cell Sci., January 5, 2001; 114(10): 1839 - 1845. [Abstract] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
