(Investigative Ophthalmology and Visual Science. 2000;41:2438-2444.)
© 2000
by The Association for Research in Vision and Ophthalmology, Inc.
Osteonectin/SPARC Secreted by RPE and Localized to the Outer Plexiform Layer of the Monkey Retina
Ignacio R. Rodríguez1,
Ernesto F. Moreira1,
Dean Bok2 and
Marc Kantorow3
1 From the National Eye Institute, National Institutes of Health, LRCMB, Bethesda, Maryland; the
2 Jules Stein Eye Institute, Brain Research Institute, and Department of Neurobiology, University of California, Los Angeles; and the
3 Department of Biology, West Virginia University, Morgantown.
 |
Abstract
|
|---|
PURPOSE. Osteonectin/SPARC is a secreted protein that has been implicated in
ocular disease. Deletion of osteonectin/SPARC causes age-onset cataract
in mice and the cataractous human lens has increased expression of
osteonectin/SPARC. In this study, the expression and localization of
osteonectin/SPARC in the monkey retina were determined as was secretion
by cultured human retinal pigment epithelial (RPE) cells.
METHODS. Adult Rhesus monkey eyes (Macaca mulatta) were dissected, and 5-mm
macula and peripheral retina punches were obtained. Supernatants were
collected from cultured human RPE cells. Subcellular fractionation of
whole monkey retina was also performed. Osteonectin/SPARC expression
and/or secretion was monitored by Northern and Western blot analyses,
and localization was determined by immunocytochemistry.
RESULTS. Outside of the retina osteonectin/SPARC mRNA is broadly expressed in
many human tissues. Northern blot analysis shows that in the retina
osteonectin/SPARC is expressed almost exclusively by the macular
RPE/choroid. Western blot analysis revealed osteonectin/SPARC in both
the macula and the peripheral neural retina but only in trace amounts
in the RPE/choroid. In subcellular fractions of the whole retina,
osteonectin/SPARC was detected, mainly in the soluble fraction but also
in the membrane and nuclear fractions. Immunohistochemical analysis
localized osteonectin/SPARC specifically to the outer plexiform layer.
Western blot analysis of conditioned medium from human RPE cells
cultured on porous substrates indicated that osteonectin/SPARC is
secreted in large amounts from both the apical and basal sides of the
RPE.
CONCLUSIONS. Collectively these data provide evidence that osteonectin/SPARC is
synthesized in the macular RPE, secreted, and subsequently transported
to the outer plexiform layer. The expression pattern of
osteonectin/SPARC in the subcellular retinal fractions is consistent
with a soluble protein that is transported and
internalized.
|
Introduction
|
|---|
Osteonectin,1
also known as SPARC2
and
BM-40,3
is a 43-kDa Ca2+ binding
glycoprotein with complex biological functions.4
Osteonectin/SPARC is believed to regulate cell growth through
interactions with the extracellular matrix.5
Increased
secretion of osteonectin/SPARC is associated with endothelial cell
injury in vitro6
and the inhibition of cell spreading on
collagen. It can also induce cell rounding in cultured endothelial
cells and fibroblasts.7
Osteonectin/SPARC will associate
directly with platelet-derived growth factor (PDGF) and modulate its
activity.8
This binding activity to PDGF seems to be
Ca2+ independent, whereas its binding to collagen
is Ca2+ dependent.9
Its
Ca2+ binding domain is unique10
and
may be involved in modulating cell shape and
adhesion.11
12
Previous studies have implicated osteonectin/SPARC in ocular disease.
Increased expression of osteonectin/SPARC mRNA13
and
protein14
is associated with age-related human cataract,
and several independent studies demonstrate that deletion of
osteonectin/SPARC causes cataract in mice.15
16
Osteonectin/SPARC has previously been detected in quail,17
chicken,18
and monkey14
retinas.
In humans osteonectin/SPARC mRNA is found in two distinct messages, a
predominant 2.2-kb message and a less abundant 3.0-kb
message.19
20
These messages arise from different
polyadenylation sites and have identical coding regions.19
The gene contains 10 exons and is located on chromosome
5q35.21
Presently, there are no genetic retinal diseases
associated with that locus
(http://www.sph.uth.tmc.edu/RetNet/disease.htm).
To establish a potential role for osteonectin/SPARC in retinal
function, we examined the expression of osteonectin/SPARC protein and
mRNA in the monkey retina. We also localized the protein by
immunocytochemistry and examined secretion of osteonectin/SPARC protein
by cultured human retinal pigment epithelial (RPE) cells. Collectively,
these data provide evidence that osteonectin/SPARC is produced in the
RPE and localized to the outer plexiform layer (OPL) of the retina.
|
Methods
|
|---|
Materials
Fresh eye tissue was obtained from Rhesus monkeys (Maccaca
mulatta, 2–3 years old) through the courtesy of the Center for
Biologics Research and Testing, US Food and Drug Administration
(Bethesda, MD). Animal studies were conducted in accordance with the
NIH guidelines and the ARVO statement on the care and use of animals in
research. The monkeys were anesthetized, then exsanguinated,
and the enucleation was performed within 3 to 4 minutes after death.
The eyes were immediately placed on ice or in tissue fixative. Macular
and peripheral retinal tissue was obtained using a 5-mm trephine. The
neural retina was separated from the pigment epithelium–choroid and
frozen at -75°C before further processing. Each retinal sample is
from a pool of 10 eyes.
Tissue Preparation
After enucleation, a small incision was made at the limbus, and
the monkey eyes were submerged overnight in 4% paraformaldehyde
buffered with 100 mM sodium phosphate, pH 7.4. The anterior chamber was
removed, and the retinal cup was incubated for an additional 24 hours
in the same buffer. The vitreous was removed carefully and the retinal
cup was then trimmed, dehydrated, embedded in paraffin, and sectioned.
Subcellular Fractionation
Subcellular fractionation of the retina was performed as
previously described.22
In brief, fresh Rhesus
(Maccaca mulatta) monkey retinas were homogenized in 10x
volume of 10 mM HEPES buffer (pH 7.2) containing 5 mM
MgCl2, 4% (wt/vol) sucrose and Complete
Inhibitor (1 tablet/50 ml, Boehringer–Mannheim, Rockford, IL). The
homogenate was subjected to a low speed (300g)
centrifugation to separate the nuclei (P1), and the remaining
supernatant was centrifuged at high speed (27,000g) to
pellet the subcellular organelles (P2). The P2 pellet was subsequently
subjected to a high salt wash and a detergent wash.
Northern Blot Analysis
Human RNAs were either purchased from Clontech (Palo Alto, CA) or
purified directly from human and monkey tissues using the RNeasy Kit
from Qiagen (Valencia, CA). The Northern blot analysis was probed with
a 32P-labeled 304-bp PCR (polymerase chain
reaction) product within the coding region of osteonectin/SPARC. The
probe was generated with primers Ost-1F (CTGATGAGACAGAGGTGGTGGAAG) and
Ost-1R (AAGAAGTGGCAGGAAGAGTCGAAG). The probe was labeled using the RTS
RadPrime DNA labeling system (Life Technologies, Gaithersburg, MD) and
Redivue 
-32P dCTP (Amersham Pharmacia Biotech,
Piscataway, NJ). The authenticity of the PCR probe was confirmed by
sequencing. Human total RNAs (~5 µg) were loaded in a 1%
agarose/formaldehyde gel, separated by electrophoresis, and stained
with SYBR Green II (Molecular Probes, Eugene, OR). The amount of
osteonectin/SPARC mRNA was quantified relative to the 28S ribosomal RNA
band using a Storm 860 phosphoimager (Molecular Dynamics, Sunnyvale,
CA) as previously described.23
Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresis and
Western Blot Analysis
Unless specified, all electrophoresis reagents and apparatus were
purchased from NOVEX, San Diego, CA. Protein samples were mixed with
sample buffer at a 1:1 volume ratio and heated at 100° degrees for 2
minutes. The samples were separated by electrophoresis in 10% to 20%
Tricine–sodium dodecyl sulfate (SDS) gels at room temperature for
11/2 hours at 150 volts. The gels were transferred onto
nitrocellulose membranes (Schleicher & Schuell, Keene, NH) using a
Trans-Blot electrophoresis transfer cell apparatus (Bio–Rad, Richmond,
CA). The transfers were performed overnight at 20 volts in 25 mM Tris,
192 mM glycine, 20% methanol at room temperature. The membrane was
equilibrated in Tris-buffered saline (TBS), pH 7.4, 0.05% Tween-20
(Quality Biological, Gaithersburg, MD) for 15 minutes then blocked in
TBS (pH 7.4), 5% Carnation nonfat milk, and 0.05% Tween-20, for 2
hours. The membrane was incubated with anti-osteonectin/SPARC
antibody11
at 1:2500 dilution for 2 hours, followed by
incubation for 1 hour with monoclonal anti-rabbit IgG alkaline
phosphatase–conjugated secondary antibody (Sigma Chemical, St. Louis,
MO). In between each incubation three successive washes of 10 minutes
each were performed with TBS, 0.05% Tween-20. The blot was developed
with BCIP/NBT (5-bromo-4chloro-3-indolyl phosphate/nitro blue
tetrazolium) solution (Sigma Chemical) and scanned directly. Gels were
also stained with Coomassie blue for half an hour and destained with
20% methanol and 10% acetic acid.
Immunocytochemistry
Paraffin-embedded monkey retina sections were deparaffinized with
xylene and rehydrated with successive ethanol washes. The sections were
blocked using diluted (1:200) goat serum for 1 hour. The tissue was
then incubated with anti-osteonectin/SPARC (1:200) antibody for 2 to 4
hours and washed with TBS–Tween. Rabbit anti-osteonectin/SPARC was
generated against a keyhole limpet hemocyanin (KLH)-conjugated
synthetic peptide from the C-terminal region (amino acids 254–273) of
mouse osteonectin/SPARC that contains the EF hand
(Ca2+-binding motif). It has previously been
shown to be specific in the mouse, humans, bovines, chickens, and
rats.11
The secondary antibody (mouse anti-rabbit alkaline
phosphatase conjugate, same as for westerns above) was applied at 1:500
dilutions for 2 hours. After the TBS–Tween washes, the sections were
developed using Fast Red (Fast Red tablets; Boehringer–Mannheim,
Indianapolis, IN) according to the manufacturer’s instructions. The
slides were photographed using a Nikon Eclipse E800 microscope
with a SPOT II digital camera.
Cultured RPE Cells
Human fetal RPE (16–24 weeks’ gestation) was collected in
accordance with the tenets of the Declaration of Helsinki. Consent for
research use of fetal tissue was obtained in compliance with federal
and state laws and institutional regulations of the University of
California. Institutional approval was obtained for the use of human
eyes. The RPE was dissected from the choroid and cultured as described
previously24
except that the substrate was 12 mm
Millicell-PCF culture plate inserts (Millipore, Bedford, MA) with a
pore diameter of 0.4 µm. After the cells had proliferated to
confluence and resided in culture for at least 2 months,
transepithelial resistances (TER) were measured. When the TER exceeded
700 Ohm x cm2, conditioned culture medium
was separately collected from the apical and basolateral compartment of
the culture chambers 3 days after each change of the culture medium.
The volume in each compartment of the chamber was approximately 0.45
ml.
|
Results
|
|---|
Northern Blot Analysis of Osteonectin/SPARC in Macula versus
Peripheral Retina and RPE
To determine the general location of osteonectin/SPARC mRNA in the
retina, Northern blot analysis was performed on total RNA from monkey
macula and peripheral retina (Fig. 1)
. Punches 5 mm in diameter were taken from fresh monkey retina and the
tissue separated into neural retina and RPE/choroid. Each sample was
from a pool of 10 retina punches. The blot was probed using a 304-bp
PCR product from the coding region of osteonectin/SPARC. The levels of
osteonectin/SPARC were quantified relative to the ribosomal 28S bands
using only the 2.2-kb message as previously described.23
The probe also detects a 3.0-kb message that is produced by a
downstream polyadenylation signal that increases the size of the 3'
untranslated region.19
The levels of osteonectin/SPARC
mRNA in the macular RPE/choroid are approximately 10-fold greater than
those detected in the neural macula and peripheral tissues. These
results indicate that synthesis of osteonectin/SPARC is occurring
mainly in the RPE–choroid region in the macula. Identical results were
obtained using a different RNA preparation (also a pool of 10 retinas)
and a 3' untranslated probe (data not shown).
View larger version (62K):
[in this window]
[in a new window]
|
Figure 1. Expression of osteonectin/SPARC mRNA in monkey macula and peripheral
retina by Northern blot analysis. Each lane was loaded with 5 µg of
total RNA. Each sample represents a pool of 10 retinas. The left
panel shows the SYBR Green II–stained gel, and the
right panel is the blot probed with a 304-bp human
osteonectin/SPARC probe generated with primers
(CTGATGAGACAGAGGTGGTGGAAG and AAGAAGTGGCAGGAAGAGTCGAAG). The
graphshows the relative levels of
osteonectin/SPARC in the different tissues normalized to the 28S band
as previously described.23
The 2.2-kb main
osteonectin/SPARC band was used for quantification. Ost,
osteonectin; PE/C, pigment epithelium/choroid.
|
|
Expression of Osteonectin/SPARC mRNA in Human Tissues
Northern blot analysis was also performed on 19 different human
tissues to determine the tissue specificity of osteonectin/SPARC (Fig. 2) . The same probe and quantification procedure described in Figure 1
was
used in this blot. Osteonectin/SPARC was detectable, and the levels
varied significantly among the human tissues examined. The lowest
levels were detected in heart and skeletal muscle, and the highest
levels were detected in testis, placenta, and uterus. In the latter
tissues the levels of osteonectin/SPARC were four- to fivefold or
greater than in all other tissues.
View larger version (60K):
[in this window]
[in a new window]
|
Figure 2. Northern blot analysis to measure the expression of osteonectin/SPARC
mRNA in human tissues. The lanes were loaded with 5 µg of total RNA.
The gel, probe, and quantification conditions were identical to those
used in Figure 1
. The top panel shows the probed and
exposed blot. The middle panel shows the 28S SYBR green
II–stained band. The bottom graph shows the relative
levels of osteonectin/SPARC expression in the different human tissues
normalized to the 28S band. Ost, osteonectin.
|
|
Western Blot Analysis of Osteonectin/SPARC in Monkey Retinas
To compare the location of the osteonectin/SPARC message (Fig. 1) with the location of the osteonectin/SPARC protein, a Western blot
analysis of the monkey macula and peripheral retinal tissues was
performed (Fig. 3A
). Each lane contains approximately 20 µg of protein. The blot probed
with a well-characterized anti-osteonectin/SPARC
antibody.12
Abundant osteonectin/SPARC peptide was
detected in the neural macula and peripheral retina but only in trace
amounts in the RPE/choroid. This is opposite of what was observed for
the mRNA (Fig. 1)
, suggesting that the macular RPE/choroid translates
and secretes osteonectin/SPARC that is subsequently transported and
widely distributed within the OPL of the neural retina.
View larger version (62K):
[in this window]
[in a new window]
|
Figure 3. Western blot analyses of osteonectin/SPARC in monkey retinal tissues.
Each lane was loaded with approximately 20 µg total protein.
(A) Results of Western blot analysis of the macular and
peripheral retina punches (same as Fig. 1
) probed with rabbit
anti-osteonectin/SPARC antibody (1:3000). (B) Results of
Western blot analysis of the subcellularly fractionated whole monkey
retina. The blots were processed as described in the Methods section.
PE, pigment epithelium.
|
|
To further localize osteonectin/SPARC, whole monkey retina was
fractionated as previously described.22
The different
subcellular fractions were run on SDS–polyacrylamide gel
electrophoresis (SDS–PAGE), and osteonectin/SPARC was detected by
Western blot (Fig. 3B)
. As expected, osteonectin/SPARC was detected
mostly in the soluble S2 fraction. However, osteonectin/SPARC was also
detected in the other fractions, indicating that it is interacting with
a number of cellular components and possibly entering the nucleus as
previously described.25
Expression of Osteonectin/SPARC by Cultured RPE Cells
Conditioned media from cultured fetal RPE cells were collected
from both the apical and basal sides and the protein precipitated in
2% trichloroacetic acid (TCA). The proteins were dissolved in 0.25
volume of sample buffer. Each lane was loaded with an equivalent of 160
µl of conditioned media. The presence of osteonectin/SPARC was
determined by Western blot analysis (Fig. 4)
. Osteonectin/SPARC was detected in both the apical and basal media in
two different culture preparations.
View larger version (84K):
[in this window]
[in a new window]
|
Figure 4. Expression of osteonectin/SPARC in conditioned media from cultured
fetal RPE cells. Conditioned media from the apical and basal sides of
the RPE were collected and the proteins concentrated by TCA
precipitation. An equivalent of 160 µl of conditioned media was
loaded per lane. Top panel shows Coomassie blue–stained
gel, and bottom panel shows the blot probed with
anti-osteonectin/SPARC at 1:3000 dilution. Two different preparations
were tested. The development of the Western blot was performed as
described in the Methods section. A monkey retina sample was run as a
positive control.
|
|
Immunocytochemical Localization of Osteonectin/SPARC in Monkey
Retinas
Paraformaldehyde-fixed monkey retina embedded in paraffin were
used to localize osteonectin/SPARC by immunocytochemistry (Fig. 5)
. Sections were cut across the macular region to see if there were
differences between the two areas. Osteonectin/SPARC was localized to
the OPL, and less intense staining was observed in the macula (Fig. 5A)
versus the peripheral retina (Fig. 5B) . Punctate labeling was observed
throughout the retina in both the macular and peripheral areas.
Müller cell processes around the OPL may also be labeled, but no
generalized labeling of the Müller cells was observed. No
significant labeling was observed in the macular RPE (site of mRNA
synthesis), although the dark pigment may mask intracellular labeling
(Fig. 5A)
.
View larger version (113K):
[in this window]
[in a new window]
|
Figure 5. Immunocytochemical localization of osteonectin/SPARC in the OPL of the
monkey retina. (A) shows the anti-osteonectin/SPARC labeling
of the monkey macula including a portion of the fovea. (B)
shows the more intense labeling observed in the peripheral retina. The
immunoreactivity is seen in red. ROS, rod outer segments;
ONL, outer nuclear layer; INL, inner nuclear layer. Scale bar, 200
µm.
|
|
|
Discussion
|
|---|
The most important conclusions from our data are that
osteonectin/SPARC is mainly synthesized by the macular pigment
epithelium but that the peptide is widely distributed throughout the
OPL of the retina. The results of Northern blot analysis shown in
Figure 1 indicate that osteonectin/SPARC mRNA expression was
approximately 10-fold greater in the macular RPE/choroid than in the
peripheral retina. Although the Northern blot analysis barely detected
osteonectin/SPARC in the neural retina, we were able to detect message
there by reverse transcription–PCR using cDNA reverse-transcribed on
magnetic beads as template (see Ref. 26
; data not shown). This suggests
that there may be additional source(s) of osteonectin/SPARC in the
neural retina. Although the macular RPE/choroid seems to be the most
active site of mRNA synthesis, the peripheral RPE is also synthesizing
osteonectin/SPARC mRNA, and the differences in amounts seen between the
two tissues may be due to differential rates of protein turnover. The
differential turnover rate could explain both the differences in
message synthesis observed in Figure 1
and the differences in
intensities seen in the immunocytochemistry in Figure 5
, because the
macula is noticeably more metabolically active than the peripheral
retina. The clear detection of osteonectin/SPARC in only 160 µl of
RPE conditioned media (Fig. 4)
suggests that the RPE is manufacturing
this protein in significant amounts. Western blot analyses of macula
and peripheral retinas (Fig. 3) and the immunocytochemical localization
(Fig. 5)
indicated that osteonectin/SPARC is distributed throughout the
OPL of the retina. We also observed punctate labeling throughout the
photoreceptor layer and the inner and outer nuclear layers (Fig. 5A)
.
This is in agreement with the observations from the subcellular
fractionation of whole retina (Fig. 3B)
, where osteonectin/SPARC is
observed mostly in the soluble fraction but is also associated with
membranes and the nucleus. The nuclear association of osteonectin/SPARC
has been previously observed,25
but its function as a
nuclear protein is not well understood. Because the OPL is comprised
mainly of synaptic terminals from the photoreceptor cells, horizontal
cells, and the receptive arbors of the bipolar cells, the possible
function of osteonectin/SPARC in this area of the retina is very
interesting. Osteonectin/SPARC may also be interacting with specific
areas in the Müller cells because their processes traverse the
OPL in numerous places.
Osteonectin/SPARC is widely expressed in human
tissues,19
20
but interestingly the reproduction-related
tissues such as testis, placenta, and uterus (Fig. 2)
show a 5- to
10-fold greater level of expression than most other tissues. The
exception is the prostate gland, which seems to have mRNA expression
levels similar to most of the other human tissues. In our experience,
having done dozens of Northern blot analyses on dozens of individual
human samples (data not shown), mRNA levels will vary mostly in the 2-
to 3-fold range. These variations are likely due to the complexities in
obtaining and processing human tissues samples. However, variations in
the 5- to 10-fold range especially in a group of related tissues are
probably significant and warrant further investigation. Other
investigators have shown that osteonectin/SPARC mRNA is abundant in
mouse reproductive tissues27
and in tissues with high rate
of turnover.28
Osteonectin/SPARC is preferentially associated with highly
proliferative and migrating tissues,4
but because the
retina is composed of terminally differentiated cells that are neither
migrating nor proliferating, the function of osteonectin/SPARC in the
OPL may be related to its extracellular
Ca2+-modulating properties.4
Its
counter-adhesive function may also be important in maintaining the
integrity of the synaptic junctions in the OPL.
In summary, our results strongly suggest that osteonectin/SPARC is
performing an important function in the retina. Before more specific
functional questions can be asked, some basic properties of the protein
need to be determined, such as its turnover in the macula versus
peripheral retina, possible feedback mechanisms that affect regulation
of transcription, its calcium binding activity, and which retinal cell
type(s) other than the RPE may be synthesizing it. This preferential
expression and secretion by the macular RPE is rather unique and may be
of particular interest to macular degenerations.
|
Acknowledgements
|
|---|
This work would not have been possible without the generous gift of
anti-SPARC antibody from Helene Sage. We also thank Sue Gentleman for
the subcellularly fractionated whole monkey retina, Xian Jie Yang for
help with the photography, Jane Hu for RPE cell culture and collection
of conditioned medium, and Quingling Huang for help with the Western
blot analyses. Marc Kantorow would like to thank Joseph Howitz for his
support and guidance during the course of this work.
|
Footnotes
|
|---|
Supported by NIH Grants EY00444 (DB), EY00331 (DB), and 1R01EY13022
(MK); The Foundation Fighting Blindness (DB); the UCLA Dolly Green
Endowed Chair at UCLA (DB); and the National Eye Institute Intramural Research Program (IRR and EFM).
Submitted for publication January 14, 2000; revised March 3, 2000; accepted March 15, 2000.
Commercial relationships policy: N.
Corresponding author: Ignacio R. Rodríguez, National Eye Institute/NIH, 6 Center Drive MSC 2740, Building 6, Room 304, Bethesda, MD 20892. ignacio{at}helix.nih.gov
|
References
|
|---|
-
Termine, JD, Kleinman, HK, Whitson, SW, Conn, KM, McGarvey, ML, Martin, GR (1981) Osteonectin, a bone-specific protein linking mineral to collagen Cell 26,99-105[Medline][Order article via Infotrieve]
-
Mason, IJ, Murphy, D, Munke, M, Francke, U, Elliott, RW, Hogan, BL (1986) Developmental and transformation-sensitive expression of the Sparc gene on mouse chromosome 11 Embo J 5,1831-1837[Medline][Order article via Infotrieve]
-
Dziadek, M, Paulsson, M, Aumailley, M, Timpl, R. (1986) Purification and tissue distribution of a small protein (BM-40) extracted from a basement membrane tumor Eur J Biochem 161,455-464[Medline][Order article via Infotrieve]
-
Yan, Q, Sage, EH (1999) SPARC, a matricellular glycoprotein with important biological functions J Histochem Cytochem 47,1495-1506[Free Full Text]
-
Lane, TF, Sage, EH (1994) The biology of SPARC, a protein that modulates cell-matrix interactions FASEB J 8,163-173[Abstract]
-
Sage, H, Decker, J, Funk, S, Chow, M. (1989) SPARC: a Ca++-binding extracellular protein associated with endothelial cell injury and proliferation J Mol Cell Cardiol 21(suppl 1),13-22
-
Sage, EH (1992) Secretion of SPARC by endothelial cells transformed by polyoma middle T oncogene inhibits the growth of normal endothelial cells in vitro Biochem Cell Biol 70,579-592[Medline][Order article via Infotrieve]
-
Raines, EW, Lane, TF, Iruela–Arispe, ML, Ross, R, Sage, EH (1992) The extracellular glycoprotein SPARC interacts with platelet-derived growth factor (PDGF)-AB and -BB and inhibits the binding of PDGF to its receptors Proc Natl Acad Sci USA 89,1281-1285[Abstract/Free Full Text]
-
Gohring, W, Sasaki, T, Heldin, CH, Timpl, R. (1998) Mapping of the binding of platelet-derived growth factor to distinct domains of the basement membrane proteins BM-40 and perlecan and distinction from the BM-40 collagen-binding epitope Eur J Biochem 255,60-66[Medline][Order article via Infotrieve]
-
Hohenester, E, Maurer, P, Hohenadl, C, Timpl, R, Jansonius, JN, Engel, J. (1996) Structure of a novel extracellular Ca(2+)-binding module in BM-40 Nat Struct Biol 3,67-73[Medline][Order article via Infotrieve]
-
Engel, J, Taylor, W, Paulsson, M, Sage, H, Hogan, B. (1987) Calcium binding domains and calcium-induced conformational transition of SPARC/BM-40/osteonectin, an extracellular glycoprotein expressed in mineralized and nonmineralized tissues Biochemistry 26,6958-6965[Medline][Order article via Infotrieve]
-
Lane, TF, Sage, EH (1990) Functional mapping of SPARC: peptides from two distinct Ca+(+)-binding sites modulate cell shape J Cell Biol 111,3065-3076[Abstract/Free Full Text]
-
Kantorow, M, Horwitz, J, Carper, D. (1998) Up-regulation of osteonectin/SPARC in age-related cataractous human lens epithelia Mol Vis 4,17[Medline][Order article via Infotrieve]
-
Kantorow, M, Sage, EH, Moreira, E, Rodriguez, IR. (1999) Increased expression of SPARC in cataractous human lenses and monkey macular RPE [ARVO Abstract] Invest Ophthalmol Vis Sci 40(4),S580Abstract nr 3052
-
Gilmour, DT, Lyon, GJ, Carlton, MB, et al (1998) Mice deficient for the secreted glycoprotein SPARC/osteonectin/BM40 develop normally but show severe age-onset cataract formation and disruption of the lens EMBO J 17,1860-1870[Medline][Order article via Infotrieve]
-
Norose, K, Clark, JI, Syed, NA, et al (1998) SPARC deficiency leads to early-onset cataractogenesis Invest Ophthalmol Vis Sci 39,2674-2680[Abstract/Free Full Text]
-
Guermah, M, Crisanti, P, Laugier, D., et al (1991) Transcription of a quail gene expressed in embryonic retinal cells is shut off sharply at hatching Proc Natl Acad Sci USA 88,4503-4507[Abstract/Free Full Text]
-
Kim, SY, Ondhia, N, Vidgen, D, Malaval, L, Ringuette, M, Kalnins, VI (1997) Spatiotemporal distribution of SPARC/osteonectin in developing and mature chicken retina Exp Eye Res 65,681-689[Medline][Order article via Infotrieve]
-
Swaroop, A, Hogan, BL, Francke, U. (1988) Molecular analysis of the cDNA for human SPARC/osteonectin/BM-40: sequence, expression, and localization of the gene to chromosome 5q31–q33 Genomics 2,37-47[Medline][Order article via Infotrieve]
-
Young, MF, Day, AA, Dominquez, P, McQuillan, CI, Fisher, LW, Termine, JD (1990) Structure and expression of osteonectin mRNA in human tissue Connect Tissue Res 24,17-28[Medline][Order article via Infotrieve]
-
Villarreal, XC, Mann, KG, Long, GL (1989) Structure of human osteonectin based upon analysis of cDNA and genomic sequences Biochemistry 28,6483-6491[Medline][Order article via Infotrieve]
-
Putilina, T, Wong, P, Gentleman, S. (1999) The DHHC domain: a new highly conserved cysteine-rich motif Mol Cell Biochem 195,219-226[Medline][Order article via Infotrieve]
-
Spiess, AN, Ivell, R. (1999) Normalization of RNA hybridization signals by means of SYBR green II-stained 28S or 18S ribosomal RNA and a phosphor imager BioTechniques 26,46-48[Medline][Order article via Infotrieve]
-
Hu, JG, Gallemore, RP, Bok, D, Frambach, DA (1996) Chloride transport in cultured fetal human retinal pigment epithelium Invest Ophthalmol Vis Sci 62,443-448
-
Gooden, MD, Vernon, RB, Bassuk, JA, Sage, EH (1999) Cell cycle-dependent nuclear location of the matricellular protein SPARC: association with the nuclear matrix J Cell Biochem 74,152-167[Medline][Order article via Infotrieve]
-
Rodriguez, IR, Mazuruk, K, Schoen, TJ, Chader, GJ (1994) Structural analysis of the human hydroxyindole-O-methyltransferase gene: presence of two distinct promoters J Biol Chem 269,31969-31977[Abstract/Free Full Text]
-
Howe, CC, Overton, GC, Sawicki, J, Solter, D, Stein, P, Strickland, S. (1988) Expression of SPARC/osteonectin transcript in murine embryos and gonads Differentiation 37,20-25[Medline][Order article via Infotrieve]
-
Sage, H, Vernon, RB, Decker, J, Funk, S, Iruela–Arispe, ML (1989) Distribution of the calcium-binding protein SPARC in tissues of embryonic and adult mice J Histochem Cytochem 37,819-829[Abstract]
Top
Abstract
Introduction
