(Investigative Ophthalmology and Visual Science. 2000;41:2466-2468.)
© 2000
by The Association for Research in Vision and Ophthalmology, Inc.
Rapid Detection of M1S1 Mutations by the Protein Truncation Test
Motokazu Tsujikawa1,
Kaoru Tsujikawa1,
Naoyuki Maeda1,
Hitoshi Watanabe1,
Yoshitsugu Inoue1,
Yukihiko Mashima2,
Yoshikazu Shimomura3 and
Yasuo Tano1
1 From the Department of Ophthalmology, Osaka University Medical School; the
2 Department of Ophthalmology, Keio University School of Medicine; and the
3 Department of Ophthalmology, Kinki University School of Medicine, Japan.
 |
Abstract
|
|---|
PURPOSE. To determine a method of rapid detection of M1S1 gene
mutations in patients with gelatinous droplike corneal
dystrophy.
METHODS. Forty-one patients from 35 families with gelatinous drop-like corneal
dystrophy were studied. The entire coding region of the M1S1
gene was screened using the protein truncation test (PTT), with a
polymerase chain reaction fragment amplified from genomic DNA serving
as a template of in vitro translation.
RESULTS. Homozygous or compound heterozygous mutations were detected in all
patients by a single reaction of the PTT. This result matched those
obtained using the polymerase chain reaction–restriction fragment
length polymorphism and direct sequence analyses. The Q118X
mutation was present in 63 of the 70 alleles, accounting for 90% of
the disease-associated chromosomes in Japanese patients.
CONCLUSIONS. The PTT is useful for detecting mutations in the M1S1 gene.
This technique showed that the Q118X mutation is a founder
mutation in Japanese patients with gelatinous droplike corneal
dystrophy, and it reflects the linkage disequilibrium reported
previously.
|
Introduction
|
|---|
Gelatinous droplike corneal dystrophy (GDLD) is an autosomal
recessive disorder characterized clinically by grayish corneal amyloid
deposits that cause severe visual impairment.1
Recently,
we successfully identified the gene responsible for GDLD,
Membrane component, chromosome 1, surface marker 1
(M1S1), by positional cloning methods and detected four
disease-causing mutations in Japanese patients with GDLD.2
It is possible to detect three of these mutations, but not the fourth,
using the polymerase chain reaction–restriction fragment length
polymorphism (PCR-RFLP) method. The M1S1 gene has a single
exon, but its 1.8-kb length is too long to be analyzed by a single
reaction of single-strand conformation polymorphism or direct-sequence
analysis. Therefore, we divided this region into several fragments and
analyzed each separately; however, this was an inconvenient and
time-consuming process. For rapid and convenient screening, we used the
protein truncation test (PTT) to detect mutations in the
M1S1 gene. PTT had been used to screen many genes related to
disease, including familial adenomatous polyposis,3
hereditary breast and ovarian cancer,4
5
and Duchenne’s
muscular dystrophy.6
Figure 1
is a schematic diagram of the PTT. Briefly, the coding region of the
gene was amplified by PCR, using a sense primer tailed by a T7 promoter
sequence. The PCR product was then used as a template for in vitro
translation testing. Synthesized protein was analyzed by sodium dodecyl
sulfate–polyacrylamide gel electrophoresis (SDS-PAGE). The shorter
product from the mutated allele was distinguished from the full-length
product of the normal allele. We report the first use of PTT in
ophthalmology.
|
Materials and Methods
|
|---|
Patients
We studied 41 patients from 35 families with GDLD. We previously
reported on 26 of these patients from 20 families who were homozygotes
or compound heterozygotes for the Q118X, 632delA,
Q207X, or S170X mutations,2
and they
were reanalyzed in the present study. Twenty milliliters of peripheral
blood was drawn from each participant. Genomic DNA was extracted from
the leukocytes using a DNA extraction kit (Stratagene, La Jolla, CA).
All patients provided written informed consent, and procedures followed
the tenets of the Declaration of Helsinki.
PCR for PTT
Double-stranded DNA (1.1 kb) containing the entire coding region
of the M1S1 gene was obtained from genomic DNA by PCR using
primer M1S1T7F that contained the T7 promoter sequence, the Kozac
consensus sequence, and the ATG-initiation codon
(GGAATTC-TAATACGACTCACTATAGGG-AACAG-CCACC-ATG-GCGTTCCTCCGCCCCACC)
and the M1S1R (GGAATTCAGGAATCAGGAAGCGTGACTCA). The ATG-initiation
codon was in frame and upstream of the natural translation initiation.
PCR was performed in a 20-µl reaction mixture containing 50 ng
genomic DNA, 10 picomoles of each primer, MgCl2
containing reaction buffer (Takara, Tokyo, Japan), 250 µM dNTPs, and
1.0 U polymerase (EX Taq; Takara). Samples were amplified in
35 cycles of 30 seconds each at 94°C for denaturing, 30 seconds at
60°C for annealing, and 60 seconds at 72°C for extension, in a
thermocycler (GeneAmp 9600; Perkin–Elmer, Foster City, CA).
PTT Analysis
An in vitro translation reaction was performed using a
commercial system (TNT T7 Quick Coupled Transcription/Translation
System; Promega, Madison, WI). A 25-µl reaction mixture containing
300 ng PCR products, 20 µl TNT Quick Master Mix, and 1 µl
35S-methionine was incubated at 30°C
for 90 minutes. A 5-µl aliquot of each reaction mixture was loaded
onto an 18% SDS–polyacrylamide gel. Electrophoresis was performed at
30 mA for 2 hours, and the gel was fixed with acetic
acid-methanol-water (10:30:60), dried, and visualized using the BAS
1000 system (Fujifilm, Tokyo, Japan) or autoradiography. When band
shifts were observed, nucleotide alterations of the corresponding
positions were detected by RFLP or direct-sequence analysis, as
described previously.2
|
Results
|
|---|
Figure 2
shows the PTT results from the M1S1 gene. In 35 Japanese
families with GDLD, 31 had truncated products corresponding to 20 kDa
detected by PTT (Fig. 2
, lane 1). Normal 46-kDa products were not
detected. A homozygous Q118X mutation was detected in all
patients by PCR-RFLP and sequence analysis. In one family, abnormal
35-kDa products were detected, and normal product was not detected
(Fig. 2 , lane 2). PCR-RFLP and direct-sequence analysis revealed that
these patients had a homozygous 632delA mutation. In another
patient, a compound heterozygote of Q118X and
632delA mutations, abnormal 20- and 35-kDa products were
detected (Fig. 2
, lane 5). PTT also detected homozygous
Q207X (Fig. 2
, lane 3) and S170X (Fig. 2 , lane 4)
mutations. Table 1
summarizes the mutations detected and their frequencies. The
Q118X mutation was found in 90% of affected chromosomes.
View larger version (84K):
[in this window]
[in a new window]
|
Figure 2. Protein truncation test results. Lane 1, homozygote of
the Q118X mutation; lane 2, homozygote of
the 632delA mutation; lane 3, homozygote
of the Q207X mutation; lane 4, homozygote
of the S170X mutation; lane 5, compound
heterozygote of the Q118X mutation and the
632delA mutation; lane 6, heterozygote of
the Q118X mutation (carrier); and lane 7,
normal control. M, molecular weight marker.
|
|
|
Discussion
|
|---|
PTT offers two advantages over other mutation-detection methods. A
single PTT reaction allows analysis of a large (2–3-kb) gene fragment,
and PTT detects mutations of pathologic interest (i.e., those that
result in a truncated protein). Phenotypically silent mutations
(polymorphism) or questionable mutations (missense mutations) are not
detected. For example, most of the Japanese population has a
D216E polymorphism in the M1S1 gene (data not
shown). However, this polymorphism was not detected by PTT in this
study.
The M1S1 gene codes 323 amino acids and consists of a single
exon. Because there is no intron on the gene, the entire coding region
can be amplified by a single PCR reaction from genomic DNA, and reverse
transcription from mRNA is therefore unnecessary. Considering that GDLD
has an autosomal recessive trait, dysfunction of the M1S1
gene may lead to a GDLD phenotype. In fact, all the reported
disease-causing mutations are nonsense or frame-shift mutations. These
features are ideal for PTT. Truncated products were detected in all
patients, and full-length products were not detected by PTT. Each of
four nonsense or frame-shift mutations was detected under homozygous
and heterozygous (carrier or compound heterozygote) conditions. These
results exactly matched the results of direct-sequence and PCR-RFLP
analysis, and all reactions using this method could be performed in 1
day. PTT is extremely useful for detecting mutations in the
M1S1 gene.
We present the first example of the application of PTT to ophthalmic
diseases. GDLD is ideal for screening by PTT; however, PTT also may be
useful in detecting mutations in other ophthalmic diseases—for
example, one type of autosomal dominant retinitis pigmentosa 1 (RP1).
Recently, the gene responsible for RP1 was identified.7
All the eight identified disease-causing mutations are nonsense or
frame-shift mutations on exon 4 of the RP1
gene.7
8
9
Exon 4 is large (6 kb), and the presence of some
polymorphisms in this exon makes screening difficult using
single-strand conformation polymorphism analysis.7
8
9
PTT
from the genomic PCR product of exon 4 enables rapid and convenient
screening, similar to the screening of exon 15 in patients with the
APC gene in familial adenomatous polyposis.3
For other genes that do not consist of a single exon or do not contain
a large exon, illegitimate transcript analysis by modified reverse
transcription-PCR from lymphocyte could be used to obtain a large open
reading frame, even if the gene expresses specifically in ocular
tissue.10
PTT may be useful in screening
protein-truncating mutations in ophthalmic diseases.
This is the second report of a search for mutations in the
M1S1 gene in patients with GDLD. All 15 families newly
analyzed in this study had the homozygous Q118X mutation.
Our previous results of haplotype analysis using nearby polymorphic
markers in other patients indicated that this Q118X mutation
is a Japanese founder mutation and reflects linkage
disequilibrium.2
11
It also explained that most patients
are in Japan and few cases have been reported in other countries. In
Japanese patients, 90% of the disease chromosomes have this major
mutation. This allelic homogeneity is not only an interesting
phenomenon in Japanese corneal dystrophy, but also is useful in the
clinical genetic diagnosis of GDLD.
No mutations have been reported in patients with GDLD in other
countries. Those patients may have a novel disease-causing mutation.
For a first screening, PCR-RFLP for Q118X may be sufficient
in Japan; however, this may not be the case in other countries. In our
hands, the mutated M1S1 gene can be screened quickly and
conveniently.
|
Footnotes
|
|---|
Supported by a Research on Human Genome and Gene Therapy grant from the Ministry of Health and Welfare of Japan and Japan Society for the Promotion of Science.
Submitted for publication March 20, 2000; accepted April 11, 2000.
Commercial relationships policy: N.
Corresponding author: Motokazu Tsujikawa, Department of Ophthalmology, Osaka University Medical School, 2-2 Yamadaoka, Suita 565-0871, Japan. moto{at}ophthal.med.osaka-u.ac.jp
|
References
|
|---|
-
Nakaizumi, G. (1914) A rare case of corneal dystrophy Acta Soc Ophthalmol Jpn 18,949-950
-
Tsujikawa, M, Kurahashi, H, Tanaka, T, et al (1999) Identification of the gene responsible for gelatinous drop-like corneal dystrophy Nat Genet 21,420-423[Medline][Order article via Infotrieve]
-
Powell, S, Petersen, G, Krush, A, et al (1993) Molecular diagnosis of familial adenomatous polyposis N Engl J Med 329,1982-1987[Abstract/Free Full Text]
-
Hogervorst, F, Cornelis, R, Bout, M, et al (1995) Rapid detection of BRCA1 mutations by the protein truncation test Nat Genet 10,208-212[Medline][Order article via Infotrieve]
-
Lancaster, J, Wooster, R, Mangion, J, et al (1996) BRCA2 mutations in primary breast and ovarian cancers Nat Genet 13,238-240[Medline][Order article via Infotrieve]
-
Roest, P, Roberts, R, Sugino, S, van Ommen, G, den Dunnen, J. (1993) Protein truncation test (PTT) for rapid detection of translation-terminating mutations Hum Mol Genet 2,1719-1721[Abstract/Free Full Text]
-
Pierce, EA, Quinn, T, Meehan, T, et al (1999) Mutations in a gene encoding a new oxygen-regulated photoreceptor protein cause dominant retinitis pigmentosa Nat Genet 22,248-254[Medline][Order article via Infotrieve]
-
Sullivan, LS, Heckenlively, JR, Bowne, SJ, et al (1999) Mutations in a novel retina-specific gene autosomal dominant retinitis pigmentosa Nat Genet 22,255-259[Medline][Order article via Infotrieve]
-
Bowne, SJ, Daiger, SP, Hims, MM, et al (1999) Mutations in the RP1 gene causing autosomal dominant retinitis pigmentosa Hum Mol Genet 8,2121-2128[Abstract/Free Full Text]
-
Tuffery, S, Bareil, C, Demaille, J, Claustres, M. (1996) Four novel dystrophin point mutations: detection by protein truncation test and transcript analysis in lymphocytes from Duchenne muscular dystrophy patients Eur J Hun Genet 4,143-152
-
Tsujikawa, M, Kurahashi, H, Tanaka, T, et al (1998) Homozygosity mapping of a gene responsible for gelatinous drop-like corneal dystrophy (GDLD) to chromosome 1p Am J Hum Genet 63,1073-1077[Medline][Order article via Infotrieve]
This article has been cited by other articles:
|
|
|
|
 
A. Alavi, E. Elahi, M. H. Tehrani, F. A. Amoli, M.-A. Javadi, N. Rafati, M. Chiani, S. S. Banihosseini, B. Bayat, R. Kalhor, et al.
Four Mutations (Three Novel, One Founder) in TACSTD2 among Iranian GDLD Patients
Invest. Ophthalmol. Vis. Sci.,
October 1, 2007;
48(10):
4490 - 4497.
[Abstract]
[Full Text]
[PDF]
|
|
|
Top
Abstract
Introduction
