(Investigative Ophthalmology and Visual Science. 2000;41:2748-2754.)
© 2000
by The Association for Research in Vision and Ophthalmology, Inc.
Upregulated Expression of Neurocan, a Nervous Tissue Specific Proteoglycan, in Transient Retinal Ischemia
Masaru Inatani1,
Hidenobu Tanihara2,
Atsuhiko Oohira3,
Megumi Honjo1,
Noriaki Kido1 and
Yoshihito Honda1
1 From the Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Kyoto, Japan; the
2 Department of Ophthalmology, Tenri Hospital, Nara, Japan; and the
3 Department of Perinatology, Institute for Developmental Research, Aichi Human Service Center, Kasugai, Aichi, Japan.
 |
Abstract
|
|---|
PURPOSE. Neurocan, a nervous tissuespecific chondroitin sulfate proteoglycan
synthesized primarily by neurons, is expressed abundantly in developing
rat retina, whereas it is rarely expressed in adult rat retinas. This
study investigated the reexpression of neurocan in a pathologic
condition of adult rat retina.
METHODS. Transient retinal ischemia was produced by occlusion of the retinal
artery for 60 minutes. After transient retinal ischemia, neurocan
expression was investigated by reverse transcriptioninitiated
polymerase chain reaction (RT-PCR), immunohistochemistry, and
immunoblot analysis.
RESULTS. Semiquantitative analysis using RT-PCR revealed that mRNA expression
for neurocan increased at 24 hours after reperfusion. Furthermore, on
immunoblot analysis using an anti-neurocan antibody, MAb 1G2, the
intensity of the 220-kDa band as well as the 150-kDa band increased
markedly at 24 and 72 hours after reperfusion. The 220-kDa band was
predominant at 24 hours after reperfusion, whereas the intensity of the
150-kDa band became almost the same as that of the 220-kDa band at 72
hours after reperfusion. Immunohistochemical analysis revealed that
upregulated neurocan immunoreactivity was associated with glial
Müller cells.
CONCLUSIONS. Thus, upregulated expression of neurocan in transient retinal ischemia
was demonstrated. Furthermore, the immunohistochemical analysis
revealed that the upregulated expression of neurocan is derived from
Müller cells, although it has been thought that neurocan is
synthesized by neurons so far. The neurocan expression by Müller
cells suggests that this proteoglycan plays a role in the damage and
repair processes in diseased retina.
 |
Introduction
|
|---|
Proteoglycans are components of the extracellular matrix that
regulates numerous cellular behaviors. The common molecular structure
of proteoglycans consists of a core protein to which sulfated
carbohydrate chains, termed glycosaminoglycans (GAGs), are covalently
attached as side chains.1
2
During development of the
nervous system, proteoglycans play important roles in cell adhesion and
proliferation, differentiation, induction of neurites, and neural
network formation.3
4
Among the known proteoglycans,
neurocan is a nervous tissuespecific proteoglycan and is a major
constituent of chondroitin sulfate proteoglycans (CSPGs) in the
brain.5
Neurocan inhibits the homophilic aggregation of
neural cells via Ng-CAM/l1 and N-CAM.6
7
8
9
10
In our previous
study,11
we found that the expression of neurocan is
abundant in developing rat retinas, but is only faint in mature
retinas, which suggests that it plays a role in retinal neural network
formation. Moreover, it has been reported that proteolytic variants of
neurocan are expressed in the brain and that proteolytic processes
cause an alteration in binding activities of neurocan to cell adhesion
molecules.10
Furthermore, our studies revealed that
expression of the neurocan variants are regulated temporally and
spatially in rat retinas.11
So far, it has been revealed that expression of numerous molecules such
as excitatory amino acids,12
growth
factors,13
cytokines,14
and intermediate
filaments15
are upregulated in response to transient
retinal ischemia. It has been hypothesized that the alteration in
expression of these gene products may represent damaging, protective,
and regenerating processes against stresses caused by transient
ischemia (and/or subsequent reperfusion). Previously, we found that the
expression of decorin, a chondroitin/dermatan sulfate proteoglycan, is
transiently downregulated but then returns to normal levels after
retinal ischemia.16
Retinal ganglion cells and amacrine
cells in the inner retina are known to be damaged by transient retinal
ischemia.16
Because brain-derived CSPGs are reported to
have protective effects on the survival of retinal ganglion
cells,17
18
19
alteration in the expression of proteoglycans
may be important in retinal ischemic damage. Because neurocan is a
representative nervous tissuespecific proteoglycan, as mentioned
above, responsive changes in expression of this proteoglycan may play a
major role in the damaging or repair processes in retinas of eyes
subjected to transient ischemia. Herein we report that expression of
the neurocan gene and its products is upregulated after transient
ischemia and that the cell origin at least part of this upregulation is
attributable to retinal glial cells, namely Müller cells.
 |
Materials and Methods
|
|---|
Animal Model
All animal studies were conducted in accordance with the ARVO
Statement for Use of Animals in Ophthalmic and Vision Research. All
animals were given water and food ad libitum. Transient retinal
ischemia was induced using the method of Stefánsson et
al.,20
with slight modifications as described
previously.14
In brief, male Wistar rats (6 weeks after
birth) were anesthetized by diethyl ether and intramuscular injection
of xylazine (2 mg) and ketamine (5 mg). After exposure of the optic
nerve sheath by blunt dissection with scissors, the exposed sheath was
tied off with a 6-0 nylon suture under direct observation by an
operating microscope. The suture was removed after 60 minutes, and
reperfusion of the retinal vessels was observed through the operating
microscope. The eyes were subsequently enucleated at 6, 24, and 72
hours after reperfusion. Sham-operated control rats underwent similar
surgery but without tightening of the suture. The animals were killed
by overdose injections of pentobarbital.
Semiquantitative Reverse TranscriptionInitiated Polymerase Chain
Reaction and Subsequent Southern Blotting
As described previously,11
16
21
semiquantitative
reverse transcriptioninitiated polymerase chain reaction (RT-PCR)
experiments on mRNA expression levels of proteoglycan core protein
genes were conducted as follows. Neural retinas of the enucleated eyes
were removed by scissors and forceps under an operating microscope.
Total RNA extracted from the retina by the acid guanidium
thiocyanate-phenol chloroform extraction method was used to synthesize
cDNAs for RT-PCR experiments with the use of reverse transcriptase
(First-Strand cDNA Synthesis Kit; Amersham Pharmacia Biotech, Uppsala,
Sweden). Each cDNA concentration was normalized by PCR experiment using
primers to ß-actin in the same manner as described
previously.11
16
21
The sequences for primers to ß-actin
were AGCTGAGAGGGAAATCGTGC (sense) and ACCAGACAGCACTGTGTTGG
(antisense).22
In the PCR experiment, the following
conditions were used: denaturation at 95°C for 30 seconds, annealing
at 65°C for 30 seconds, and polymerization at 72°C for 1 minute for
22 cycles. After the normalization of each cDNA concentration based on
gene expression of ß-actin, PCR experiments for neurocan were
performed. The sequences of the sense and the antisense primers for
neurocan were AGGAGCCAGCTCCAGTATGG and TTGGCTCTGTGCCGGGGATA,
respectively.23
The number of PCR cycles for neurocan was
32. The PCR samples, separated by 2% agarose gel electrophoresis, were
transferred to a membrane, Hybond-N+ (Amersham Pharmacia Biotech), by
the capillary transfer method with 20x standard saline citrate (SSC).
In Southern blotting, a synthesized internal oligonucleotide probe
(sequence: TGCTGTGGCTGCTTCTCCTA) was hybridized to the PCR samples by
ECL 3'-oligolabeling and detection systems (Amersham Pharmacia Biotech)
to exclude the nonspecific bands. Optical densities of hybridizing
bands were measured by NIH Image 1.59. A standard curve was generated
from the optical densities of hybridizing bands from serial dilutions
of template cDNAs, and the linearity of the created standard curve
among the selected concentrations was confirmed. The relative levels of
mRNA expression were calculated as a ratio to the control (the
sham-operated retinal sample).
Antibodies
An anti-rat neurocan monoclonal IgG (MAb 1G2) that recognizes both
the 220-kDa full-length core glycoprotein of neurocan and a 150-kDa
proteolytic C-terminal half product (also called CSPG-150 or
neurocan-C) was produced as described previously.24
An
anti-glial fibrillary acidic protein (GFAP) antibody was purchased from
DAKO JAPAN (Kyoto, Japan).
Sample Preparation for Immunoblotting
Rat retinal tissues were homogenized in 50 µl ice-cold
phosphate-buffered saline (PBS) containing 10 mM
N-ethylmaleimide (NEM), 20 mM EDTA, and 2 mM
phenylmethylsulfonyl fluoride (PMSF). The homogenate was mixed with 200
µl of 20 mM Tris-HCl buffer (pH 7.5) containing 2% sodium
dodecylsulfate (SDS), 10 mM NEM, 20 mM EDTA, and 2 mM PMSF, and the
mixture was boiled for 5 minutes. The protein concentration was
measured by Bio-Rad DC protein assay (Bio-Rad Laboratories, Tokyo,
Japan). Protease-free chondroitinase ABC (EC 4.2.2.4; Seikagaku, Tokyo,
Japan) was used to digest chondroitin sulfate side chains linked to
core proteins, as described previously.11
The sample (the
protein concentration; 50 µg) was electrophoresed by SDS-PAGE on a
3% stacking gel and a 6% separating gel and then electrotransferred
onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford,
MA). The membrane was incubated in blocking solution (2% bovine serum
albumin [BSA]/2% normal horse serum/2% normal goat serum in PBS)
for 1 hour at room temperature and then incubated in the anti-rat
neurocan monoclonal IgG (MAb 1G2) diluted 1:2 for 2 hours, and
subsequently incubated in the biotinylated anti-mouse IgG (Vector
Laboratories, Burlingame, CA) diluted 1:200 for 30 minutes at room
temperature. Immunoreactive materials on the membrane were detected
using a Vectastain elite ABC kit (Vector Laboratories). The optical
densities of immunoreactive bands were measured by NIH Image 1.59.
Immunohistochemistry
After perfusion with 4% paraformaldehyde in PBS, the enucleated
eyes were postfixed for 2 hours at 4°C with 4% paraformaldehyde in
PBS and then gently shaken overnight at 4°C in 30% sucrose/PBS
before freezing on powdered dry ice. Sections (16 µm) were cut using
a cryostat and collected onto silanized slides. Retinal sections were
washed twice for 3 minutes each in PBS and then incubated in cold
methanol (-20°C) for 15 minutes. After washing three times for 3
minutes each in PBS, the retinal sections were treated sequentially
with the above mentioned blocking solution for 1 hour, with MAb 1G2
(1:2 dilution) for overnight at 4°C and with Texas redconjugated
anti-mouse IgG (Vector Laboratories) diluted 1:200 for 1 hour at 4°C.
The sections were then observed under a confocal microscope (LSM410;
Carl Zeiss, Oberkochen, Germany). To identify the cell type of the
neurocan-expressing cells in the ischemiareperfusion retinas, in
addition to MAb 1G2, an anti-GFAP antibody (1:500 dilution) was used
for double staining. The GFAP immunoreactivities were detected with
fluorescein-conjugated anti-rabbit IgG (Vector Laboratories) diluted
1:200.
 |
Results
|
|---|
Increased Gene Expression for Neurocan in Retinas with Transient
Ischemia
RT-PCR using specific primers for the neurocan gene showed that
cDNA fragments of the expected length (378 bp) were amplified from
retinal cDNA samples. In Southern blot analysis, the PCR products were
hybridized with the internal probe, which indicates that the amplified
products were derived from the target sequence of the rat neurocan
gene. To quantify relative levels of mRNA expression for neurocan after
transient retinal ischemia, we carried out semiquantitative RT-PCR
experiments and subsequent Southern blot analysis after normalization
to ß-actin (Fig. 1)
. In Southern blotting experiments using the PCR products from
sham-operated retinal cDNAs, only a faint hybridizing band of the
expected length was detected (lane 1), which suggests that the amounts
of gene expression for neurocan are limited in sham-operated retinas as
well as in normal mature retinas, as described
previously.11
In contrast, the semiquantitative RT-PCR
analysis revealed that the intensity of the hybridizing band increased
markedly at 24 hours after the cessation of ischemia (lane 2), the mean
level (± SE) of gene expression for neurocan in the experimental
retinas being 31.6 ± 7.8-fold that of the sham-operated retinas
(1.0 ± 0.6). At 72 hours after cessation of ischemia (lane 3),
the mean level was 10.2 ± 6.2-fold that of the control.
Statistical analysis revealed that the increase in levels of neurocan
gene expression at 24 and 72 hours after the cessation of ischemia was
significant in comparison to the sham-operated samples
(P < 0.05, MannWhitney U test).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 1. Semiquantification of neurocan gene expression by RT-PCR and
subsequent Southern blot analysis. Semiquantitative RT-PCR experiments
for neurocan (A) were performed after normalization to
ß-actin (B). A faint hybridizing band was detected in
Southern blotting (C) after 32 cycles of PCR using neurocan
primers in the control (lane 1). The intensity of the
hybridizing band increased markedly at 24 hours (lane 2)
after the cessation of ischemia. Even at 72 hours (lane 3)
the intense hybridizing band was detected. HincII-digested
X174 DNA was used as a marker (lane M).
Arrow, neurocan PCR products of the expected length (378
bp). The densitometrical analysis (D) showed that the mean
level (±SE) of gene expression for neurocan at 24 and 72 hours after
reperfusion was 31.6 ± 7.8- and 10.2 ± 6.2-fold that of the
control (1.0 ± 0.6), respectively. Statistical analysis showed
that the levels of neurocan gene expression at 24 and 72 hours after
reperfusion increased significantly, compared with the sham-operated
samples (n = 4; P < 0.05,
MannWhitney U test). Error bar, SE.
|
|
Immunoblot Analysis for Neurocan Core Proteins
As described previously,11
immunoblot analysis of
early postnatal rat retinal homogenates treated with chondroitinase ABC
shows two immunopositive bands, one of 220 kDa (the full-length
neurocan core protein) and one of 150 kDa (a neurocan proteolytic
C-terminal product [neurocan-C]). In contrast, in adult rat retina,
the immunopositive bands are faintly detectable. Using the same
anti-neurocan monoclonal antibody, MAb 1G2, we carried out further
immunoblot analysis on homogenates of adult rat retinas with and
without transient ischemia. The immunopositive bands were barely
detectable in the sham-operated retinal homogenates (without transient
ischemia) (Fig. 2A
), which agrees with a very low expression level of neurocan mRNA in
sham-operated eyes. Also, it appeared to coincide with the results of
immunoblot analysis of the intact adult rat retinal homogenates, as
described previously.11

View larger version (37K):
[in this window]
[in a new window]
|
Figure 2. Immunoblot analysis of retina subjected to transient ischemia. Each 50
µg of the retinal homogenate was applied to SDS-PAGE (A).
The bands were barely detected in the control, but then the intensity
of immunopositive bands of 220 and 150 kDa increased slightly at 6
hours after reperfusion. At 24 and 72 hours after reperfusion, the
intensity of the 220-kDa band as well as the 150-kDa band increased
markedly. The 220-kDa band was predominant at 24 hours after
reperfusion, whereas the intensity of the 150-kDa band became almost
the same as that of the 220-kDa band at 72 hours after reperfusion.
Closed and open arrowheads, the 220- and 150-kDa
bands, respectively. The positions of molecular mass markers are
indicated in kDa. The densitometrical analysis demonstrated that the
mean level (±SE) of 220-kDa bands at 6 hours was 1.4 ± 0.8-fold
that of the control, increased to 9.1 ± 1.4-fold of the control
at 24 hours, and then increased to 12.2 ± 1.9-fold at 72 hours
(B). The mean level (±SE) of 150-kDa bands at 6 hours was
3.3 ± 1.7-fold of the control, increased to 7.5 ± 1.4-fold
at 24 hours, and then increased to 24.4 ± 2.5-fold at 72 hours
(C). Statistical analysis showed significantly upregulated
expression of the 220- and 150-kDa core proteins at 24 and 72 hours,
respectively, after reperfusion (n = 3;
P < 0.05, MannWhitney U test). Error bar,
SE.
|
|
The intensity of the immunopositive bands of 220 and 150 kDa increased
slightly at 6 hours after reperfusion (Fig. 2A)
. At 24 and 72 hours
after reperfusion, the intensity of the 220-kDa band as well as the
150-kDa band increased markedly. The 220-kDa band was predominant at 24
hours after reperfusion, whereas the intensity of the 150-kDa band
became almost the same as that of the 220-kDa band at 72 hours after
reperfusion. The intensities of the 220- and 150-kDa bands were
semiquantified with the aid of a densitometer, and relative levels were
calculated as the folds of the mean level of the controls
(sham-operated retinas). The mean level (± SE) of the 220-kDa bands at
6 hours was 1.4 ± 0.8-fold that of the control and then increased
to 9.1 ± 1.4-fold at 24 hours and increased to 12.2 ±
1.9-fold at 72 hours after cessation of retinal ischemia (Fig. 2B)
. The
mean level (± SE) of the 150-kDa bands at 6 hours was 3.3 ±
1.7-fold that of the control, increased to 7.5 ± 1.4-fold at 24
hours, and then increased to 24.4 ± 2.5-fold at 72 hours (Fig. 2C)
. Expression of the 220- and 150-kDa bands at 24 and 72 hours after
reperfusion was statistically significantly greater than that of
sham-operated eyes (P < 0.05, MannWhitney
U test).
Immunohistochemical Studies of Neurocan-Expressing Retinal Cells
after Transient Ischemia
As described previously,11
in retinal sections at
P14, strong neurocan immunoreactivities were observed in the inner
plexiform layer (IPL) and outer plexiform layer (OPL), whereas in adult
retinal sections (postnatal day 42 [P42]), only faint
immunoreactivities were shown in the IPL and OPL. Similarly, in
sham-operated retinal sections (controls), the neurocan
immunoreactivities were very faint in the IPL and OPL (Fig. 3A
). At 6 hours after the cessation of retinal ischemia, the
immunoreactive patterns were almost the same as in the sham-operated
retinas, but at 24 hours the immunoreactivities in the IPL and OPL
increased slightly compared with those in the sham-operated retinas.
Moreover, retinal cell bodies and radially oriented processes in the
inner nuclear layer (INL) were immunopositive (Fig. 3B)
. Immunopositive
cells were also found at 72 hours after cessation of retinal ischemia.
The radial pattern of immunoreactivities in the INL suggests that they
may be derived from retinal Müller cells. Thus, to determine if
the immunopositive retinal cells in the INL are identical with
Müller cells, we carried out additional immunohistochemical
studies using an anti-GFAP antibody. In the sham-operated sections,
retinal glial cells (possibly astrocytes) in the ganglion cell layer
(GCL) were slightly GFAP-positive (Fig. 3C)
. At 24 hours after
cessation of retinal ischemia, however, GFAP immunoreactivities became
strong in retinal glial cells, in both Müller cells in the INL
and astrocytes in the GCL (Fig. 3D)
. The confocal image of the
double-stained retinal sections with MAb 1G2 and anti-GFAP antibody
showed that at least some of the neurocan-immunopositive retinal cells
were also GFAP-positive, indicating that at least some of
neurocan-expressing cells are Müller cells.

View larger version (54K):
[in this window]
[in a new window]
|
Figure 3. Immunohistochemical analysis of retinas after ischemia.
In the sham-operated retina (A), the neurocan
immunoreactivities were faint in the inner plexiform layer (IPL) and
outer plexiform layer (OPL). At 24 hours after reperfusion
(B), immunoreactivities in the IPL and OPL increased
slightly compared with the control. Moreover, retinal cell bodies and
radial running processes (arrowheads) in the inner nuclear
layer (INL) were immunopositive. Immunohistochemical studies using an
anti-GFAP antibody showed that at 24 hours after reperfusion, compared
with the control retina (C), glial cells throughout the
retinal layers (Müller cells) and astrocytes were stained
considerably (D). The confocal image of the double staining
with MAb 1G2 (Texas red) and the anti-GFAP antibody (fluorescein)
(E) showed that neurocan-immunopositive retinal cells with
radial running processes (arrowheads) in the INL at 24 hours
after reperfusion also were stained with the anti-GFAP antibody. GCL,
ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear
layer; OPL, outer plexiform layer; ONL, outer nuclear layer.
Original magnification, x400.
|
|
 |
Discussion
|
|---|
In the present studies we have demonstrated that transient retinal
ischemia upregulates the expression of neurocan, a nervous
tissuespecific proteoglycan. Previously, we showed that this
proteoglycan is expressed in neural retina, especially during its
development.11
Our semiquantitative RT-PCR studies showed
that, at early postnatal stages (P0P3), mRNA expression for neurocan
increased gradually, reaching a peak on P7, and then began to decrease,
having almost disappeared in adult retinas by P42. On the other hand,
similar semiquantitative experiments in this study clearly showed that
the mean level (±SE) of gene expression for neurocan in the
experimental retinas was 31.6 ± 7.8-fold that of the
sham-operated retinas (1.0 ± 0.6) at 24 hours after the cessation
of ischemia (Fig. 1)
. Because the increase in gene expression for
neurocan was so rapid and conspicuous after transient ischemia,
neurocan may play a role in the damaging and/or regenerating processes
in transiently ischemic retinas as well as in developing retinas. Thus,
the present study is the first to reveal that expression of this
nervous tissuespecific proteoglycan is altered in response to
ischemic events in neural tissues.
The amount of neurocan estimated by immunoblot analysis seems to
correlate with the above-mentioned mRNA expression of the neurocan.
Intensity of the 220-kDa band (the full-length core protein of
neurocan) as well as mRNA expression increases significantly at 24
hours after the cessation of retinal ischemia (Fig. 2)
. At 72 hours
after cessation of retinal ischemia, the amounts of 220 kDa
(full-length) neurocan still increase, whereas its mRNA expression
decreased to about one third of the level at 24 hours. It is very
likely that the differences between protein and mRNA levels at this
time point may be attributed to the accumulation of the translated
neurocan. Thus, our studies showed that, in addition to mRNA
expression, production and accumulation of neurocan increase in
response to ischemia.
To date, there have been some reports23
24
that show
presence of the proteolytic variants of neurocan. Our previous
study11
demonstrated that these are also present in neural
retinas. Immunoblot analysis using MAb 1G2 after chondroitinase ABC
treatment to remove GAG side chains demonstrated the presence of two
types of neurocan core protein, 220 kDa (full-length) and 150 kDa (a
proteolytic variant), in rat retinas. In the rat cerebrum, the
full-length core protein of neurocan (220 kDa) is detectable on
embryonic day 14 (E14), reaches peak level on P10, and then disappears
from the brain at around P30, whereas a fairly large amount of its
proteolytic product (150 kDa) remains in the mature
brain.23
24
Our previous studies revealed that, in
developing rat retinas, the amount of the 220-kDa core protein reaches
peak level on P3, whereas the amount of its 150-kDa proteolytic variant
increases even after P3 and reaches peak on P14.11
In
mature retinas, both full-length and proteolytic variants are barely
detectable, which is different from mature brains. In transient retinal
ischemia, the intensity of the 220-kDa band as well as the 150-kDa band
increases markedly at 24 and 72 hours after reperfusion. Moreover, the
expression of the full-length (220 kDa) neurocan core protein is
predominant at 24 hours after reperfusion, whereas the expression of
the proteolytic C-terminal half variant (150 kDa) becomes almost the
same as that of the full-length (220 kDa) neurocan at 72 hours after
reperfusion. This may reflect the fact that the 150-kDa neurocan
variant is produced by the proteolytic events against full-length (220
kDa) neurocan. Thus, our present studies showed, in rat retinas with
transient ischemia, that proteolytic events are the same as those that
occur during retinal development.
In the transient ischemic retinas, our immunohistochemical studies
demonstrated that some of GFAP-expressing cells are in accordance with
neurocan-expressing cells (Fig. 3E)
, suggesting that retinal glial
cells, especially Müller cells, may be a part of cell origin for
the neurocan expression in the retina after cessation of ischemia. It
has been reported that, in retina affected by pathologic stresses such
as transient ischemia,15
16
25
experimental
glaucoma,26
retinal detachment,27
surgical
intervention,28
and laser injuries,29
GFAP is
upregulated in retinal glial cells, particularly Müller cells.
Previously, we investigated alterations in cell components in rat
models of retinal ischemia, which also were used in this
study.16
Our immunohistochemical results demonstrated
that, in retinas with transient ischemia, retinal glial cells, such as
Müller cells, become the major component, whereas neural cells
and their neurites diminish.16
Thus, our
immunohistochemical results suggest that retinal Müller cells
originate the upregulated expression of neurocan. However, it has been
believed that neurocan is synthesized by neurons in the developing rat
central nervous tissues so far.3
30
Also, our previous
immunohistochemical studies showed no specific localization of neurocan
in retinal Müller cells.11
These findings seem to
contradict the above-mentioned results in this study. One possible
explanation is that different cells may be responsible in a different
situation, such as retinal insults. Our present studies suggest that,
at least in pathologic situations, neurocan can be expressed by glial
cells. This hypothesis may be supported by the fact that astrocytes
from rat brain synthesize and secrete neurocan in
culture.24
Furthermore, recently, Haas et
al.31
and McKeon et al.32
have reported that
neurocan immunoreactivities and mRNA expression were detected in the
rat reactive astrocytes in mechanically injured brain.
Our immunohistochemical results show that the immunoreactivity of
neurocan is localized in the cell bodies and processes of Müller
cells, although neurocan is an extracellular matrix. However, some
reports have shown that CSPGs, including neurocan, exist
intracellularly in adult rat brain but not in developing
brain.5
33
34
35
Thus, our immunohistochemical studies
showed that in in vivo experiments, neurocan was found in glial cell
components of rat retinas, a part of the central nervous system.
So far, there have been no reports about the biological significance of
upregulated expression of neurocan in diseased nervous tissues. It is
known that Müller cells release soluble factors in culture that
are effective on survival of retinal ganglion cells during
development.36
Because retinal ganglion cells are in
contact with Müller cells within the retina,28
37
it
is likely that neurocan expressed from activated Müller cells in
ischemic retinas may be involved in the neurotrophic effects on damaged
retinal ganglion cells. There has been some evidence17
18
19
that CSPGs have neurotrophic effects on retinal ganglion cells. It has
been known that retinal ischemia induces a large increase in the
release of glutamate, which activates glutamate receptors such as
N-methyl-D-aspartate (NMDA)
receptors.12
It has been also reported that glutamate
activation of the receptors induces the synthesis of neurocan mRNA in
cultivated fetal rat hippocampal neurons.38
Additionally,
because neurocan binds basic fibroblast growth factor,39
which is upregulated in transient retinal ischemia,40
neurocan may interact with other molecules upregulated by the ischemic
stress. On the other hand, some investigators32
suggest
another possibility that neurocan may inhibit the sprouting process of
the damaged axon and regeneration of damaged neural network in
mammalian central nervous system. Because neurocan has a strong
inhibitory effect to neurite outgrowth in vitro,6
41
it is
possible that neurocan may prevent the damaged neuronal axons from
making abnormal neural networks with intact neurons. Further studies
will be required to identify the significance of neurocan expression in
diseased retinas.
In conclusion, our studies demonstrated that expression of the
full-length core protein and a proteolytic variant of neurocan is
upregulated in rat retinas with transient ischemia and that retinal
Müller cells are at least in part the source of the increased
expression of neurocan in ischemic retinas.
 |
Footnotes
|
|---|
Supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture, Japan.
Submitted for publication December 20, 1999; revised February 28, 2000; accepted March 22, 2000.
Commercial relationships policy: N.
Corresponding author: Hidenobu Tanihara, Department of Ophthalmology, Tenri Hospital, 200 Mishima-cho, Tenri, Nara, 632-8552 Japan. tanihara{at}pearl.ocn.ne.jp
 |
References
|
|---|
-
Ruoslahti, E. (1989) Proteoglycan in cell regulation J Biol Chem 264,13369-13372[Free Full Text]
-
Iozzo, RV (1998) Matrix proteoglycans: from molecular design to cellular function Annu Rev Biochem 67,609-652[Medline][Order article via Infotrieve]
-
Margolis, RK, Rauch, U, Maurel, P, Margolis, RU (1995) Neurocan and phosphacan: two major nervous tissue-specific chondroitin sulfate proteoglycans Perspect Dev Neurobiol 3,273-290
-
Oohira, A, Katoh-Semba, R, Watanabe, E, Matsui, F. (1994) Brain development and multiple molecular species of proteoglycan Neurosci Res 20,195-207[Medline][Order article via Infotrieve]
-
Rauch, U, Gao, P, Janetzko, A, et al (1991) Isolation and characterization of developmentally regulated chondroitin sulfate and chondroitin/keratan sulfate proteoglycan of brain identified with monoclonal antibodies J Biol Chem 266,14785-14801[Abstract/Free Full Text]
-
Friedlander, DR, Milev, P, Karthikeyan, L, Margolis, RK, Margolis, RU, Grumet, M. (1994) The neuronal chondroitin sulfate proteoglycan neurocan binds to the neural cell adhesion molecules Ng-CAM/L1/NILE/and N-CAM, and inhibits neuronal adhesion and neurite outgrowth J Cell Biol 125,669-680[Abstract/Free Full Text]
-
Retzler, C, Gohring, W, Rauch, U. (1996) Analysis of neurocan structures interacting with the neural cell adhesion molecule N-CAM J Biol Chem 271,27304-27310[Abstract/Free Full Text]
-
Grumet, M, Flaccus, A, Margolis, RU (1993) Functional characterization of chondroitin sulfate proteoglycan of brain: interactions with neurons and neural cell adhesion molecules J Cell Biol 120,815-824[Abstract/Free Full Text]
-
Grumet, M, Milev, P, Sakurai, T, et al (1994) Interactions with tenascin and differential effects on cell adhesion of neurocan and phosphacan, two major chondroitin sulfate proteoglycans of nervous tissue J Biol Chem 269,12142-12146[Abstract/Free Full Text]
-
Milev, P, Chiba, A, Haring, M, et al (1998) High affinity binding and overlapping localization of neurocan and phosphacan/protein-tyrosine phosphatase-zeta/beta with tenascin-R, amphoterin, and the heparin-binding growth-associated molecule J Biol Chem 273,6998-7005[Abstract/Free Full Text]
-
Inatani, M, Tanihara, H, Oohira, A, Honjo, M, Honda, Y. (1999) Identification of a nervous tissue-specific chondroitin sulfate proteoglycan, neurocan, in developing rat retina Invest Ophthalmol Vis Sci 40,2350-2359[Abstract/Free Full Text]
-
Louzada-Junior, P, Dias, JJ, Santos, WF, Lachat, JJ, Bradford, HF, Coutinho-Netto, J. (1992) Glutamate release in experimental ischaemia of the retina: an approach using microdialysis J Neurochem 59,358-363[Medline][Order article via Infotrieve]
-
Tanihara, H, Inatani, M, Honda, Y. (1997) Growth factors and their receptors in the retina and pigment epithelium Prog Retinal Eye Res 16,271-301
-
Hangai, M, Yoshimura, N, Yoshida, M, Yabuuchi, K, Honda, Y. (1995) Interleukin-1 gene expression in transient retinal ischemia in the rat Invest Ophthalmol Vis Sci 36,571-578[Abstract/Free Full Text]
-
Osborne, NN, Block, F, Sontag, KH (1991) Reduction of ocular blood flow results in glial fibrillary acidic protein (GFAP) expression in rat retinal Müller cells Vis Neurosci 7,637-639[Medline][Order article via Infotrieve]
-
Inatani, M, Tanihara, H, Honjo, M, Hangai, M, Kresse, H, Honda, Y. (1999) Expression of proteoglycan decorin in neural retina Invest Ophthalmol Vis Sci 40,1783-1791[Abstract/Free Full Text]
-
Schulz, M, Raju, T, Ralston, G, Bennett, MR (1990) A retinal ganglion cell neurotrophic factor purified from the superior colliculus J Neurochem 55,832-841[Medline][Order article via Infotrieve]
-
Huxlin, KR, Carr, R, Schulz, M, Sefton, AJ, Bennett, MR (1995) Trophic effect of collicular proteoglycan on neonatal rat retinal ganglion cells in situ Brain Res Dev Brain Res 84,77-88[Medline][Order article via Infotrieve]
-
Nichol, KA, Schulz, MW, Bennett, MR (1995) Nitric oxide-mediated death of cultured neonatal retinal ganglion cells: neuroprotective properties of glutamate and chondroitin sulfate proteoglycan Brain Res 697,1-16[Medline][Order article via Infotrieve]
-
Stefánsson, E, Wilson, CA, Schoen, T, Kuwabara, T. (1988) Experimental ischemia induces cell mitosis in the adult rat retina Invest Ophthalmol Vis Sci 29,1050-1055[Abstract/Free Full Text]
-
Inatani, M, Tanihara, H, Oohira, A, Honjo, M, Kido, N, Honda, Y. (2000) Spatiotemporal expression patterns of 6B4 proteoglycan/phosphacan in the developing rat retina Invest Ophthalmol Vis Sci 41,1990-1997[Abstract/Free Full Text]
-
Nudel, U, Zakut, R, Shani, M, Neuman, S, Levy, Z, Yaffe, D. (1983) The nucleotide sequence of the rat cytoplasmic ß-actin gene Nucleic Acids Res 11,1759-1771[Abstract/Free Full Text]
-
Rauch, U, Karthikeyan, L, Maurel, P, Margolis, RU, Margolis, RK (1992) Cloning and primary structure of neurocan, a developmentally regulated, aggregating chondroitin sulfate proteoglycan of brain J Biol Chem 267,19536-19547[Abstract/Free Full Text]
-
Oohira, A, Matsui, F, Watanabe, E, Kushima, Y, Maeda, N. (1994) Developmentally regulated expression of a brain-specific species of chondroitin sulfate proteoglycan, neurocan, identified with a monoclonal antibody 1G2 in the rat cerebrum Neuroscience 60,145-157[Medline][Order article via Infotrieve]
-
Osborne, NN, Larsen, AK (1996) Antigens associated with specific retinal cells are affected by ischaemia caused by raised intraocular pressure: effect of glutamate antagonists Neurochem Int 29,263-270[Medline][Order article via Infotrieve]
-
Tanihara, H, Hangai, M, Sawaguchi, S, et al (1997) Up-regulation of glial fibrillary acidic protein in the retina of eyes with experimental glaucoma Arch Ophthalmol 115,752-756[Abstract]
-
Erickson, PA, Fisher, SK, Guerin, CJ, Anderson, DH, Kaska, DD (1987) Glial fibrillary acidic protein increases in Müller cells after retinal detachment Exp Eye Res 44,37-48[Medline][Order article via Infotrieve]
-
Bignami, A, Dahl, D. (1979) The radial glia of Müller in the rat retina and their response to injury. An immunofluorescence study with antibodies to the glial fibrillary acidic (GFA) protein Exp Eye Res 28,63-69[Medline][Order article via Infotrieve]
-
Grosche, J, Hartig, W, Reichenbach, A. (1995) Expression of glial fibrillary acidic protein (GFAP), glutamine synthetase (GS), and Bcl-2 protooncogene protein by Müller (glial) cells in retinal light damage of rats Neurosci Lett 185,119-122[Medline][Order article via Infotrieve]
-
Engel, M, Maurel, P, Margolis, RU, Margolis, RK (1996) Chondroitin sulfate proteoglycans in the developing central nervous system. I. Cellular sites of synthesis of neurocan and phosphacan J Comp Neurol 366,34-43[Medline][Order article via Infotrieve]
-
Haas, CA, Rauch, U, Thon, N, Merten, T, Deller, T. (1999) Entorhinal cortex lesion in adult rats induces the expression of the neuronal chondroitin sulfate proteoglycan neurocan in reactive astrocytes J Neurosci 19,9953-9963[Abstract/Free Full Text]
-
McKeon, RJ, Jurynec, MJ, Buck, CR (1999) The chondroitin sulfate proteoglycans neurocan and phosphacan are expressed by reactive astrocytes in the chronic CNS glial scar J Neurosci 19,10778-10788[Abstract/Free Full Text]
-
Aquino, DA, Margolis, RU, Margolis, RK (1984) Immunocytochemical localization of a chondroitin sulfate proteoglycan in nervous tissue. I. Adult brain, retina, and peripheral nerve J Cell Biol 99,1117-1129[Abstract/Free Full Text]
-
Aquino, DA, Margolis, RU, Margolis, RK (1984) Immunocytochemical localization of a chondroitin sulfate proteoglycan in nervous tissue. II. Studies in developing brain J Cell Biol 99,1130-1139[Abstract/Free Full Text]
-
Matsui, F, Nishizuka, M, Yasuda, Y, Aono, S, Watanabe, E, Oohira, A. (1998) Occurrence of an N-terminal proteolytic fragment of neurocan, not a C-terminal half, in a perineuronal net in the adult rat cerebrum Brain Res 790,45-51[Medline][Order article via Infotrieve]
-
Raju, TR, Bennett, MR (1986) Retinal ganglion cell survival requirements: a major but transient dependence on Müller glia during development Brain Res 383,165-176[Medline][Order article via Infotrieve]
-
Rasmussen, KE (1972) A morphometric study of the Müller cell cytoplasm in the rat retina J Ultrastruct Res 39,413-429[Medline][Order article via Infotrieve]
-
Wang, W, Dow, KE (1997) Differential regulation of neuronal proteoglycans by activation of excitatory amino acid receptors Neuroreport 8,659-663[Medline][Order article via Infotrieve]
-
Milev, P, Monnerie, H, Popp, S, Margolis, RK, Margolis, RU (1998) The core protein of the chondroitin sulfate proteoglycan phosphacan is a high-affinity ligand of fibroblast growth factor-2 and potentiates its mitogenic activity J Biol Chem 273,21439-21442[Abstract/Free Full Text]
-
Miyashiro, M, Ogata, N, Takahashi, K, et al (1998) Expression of basic fibroblast growth factor and its receptor mRNA in retinal tissue following ischemic injury in the rat Graefes Arch Clin Exp Ophthalmol 236,295-300[Medline][Order article via Infotrieve]
-
Oohira, A, Matsui, F, Katoh-Semba, R. (1991) Inhibitory effects of brain chondroitin sulfate proteoglycans on neurite outgrowth from PC12D cells J Neurosci 11,822-827[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
B. Tucker, H. Klassen, L. Yang, D. F. Chen, and M. J. Young
Elevated MMP Expression in the MRL Mouse Retina Creates a Permissive Environment for Retinal Regeneration
Invest. Ophthalmol. Vis. Sci.,
April 1, 2008;
49(4):
1686 - 1695.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, A. K. Kardaszewska, T. van Veen, U. Rauch, and M.-T. R. Perez
Integration between Abutting Retinas: Role of Glial Structures and Associated Molecules at the Interface
Invest. Ophthalmol. Vis. Sci.,
December 1, 2004;
45(12):
4440 - 4449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Maeda, A. Sawada, M. Matsubara, Y. Nakai, A. Hara, and T. Yamamoto
A Novel Neuroprotectant against Retinal Ganglion Cell Damage in a Glaucoma Model and an Optic Nerve Crush Model in the Rat
Invest. Ophthalmol. Vis. Sci.,
March 1, 2004;
45(3):
851 - 856.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, U. Rauch, and M.-T. R. Perez
Accumulation of Neurocan, a Brain Chondroitin Sulfate Proteoglycan, in Association with the Retinal Vasculature in RCS Rats
Invest. Ophthalmol. Vis. Sci.,
March 1, 2003;
44(3):
1252 - 1261.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Inatani, M. Honjo, Y. Otori, A. Oohira, N. Kido, Y. Tano, Y. Honda, and H. Tanihara
Inhibitory Effects of Neurocan and Phosphacan on Neurite Outgrowth from Retinal Ganglion Cells in Culture
Invest. Ophthalmol. Vis. Sci.,
July 1, 2001;
42(8):
1930 - 1938.
[Abstract]
[Full Text]
[PDF]
|
 |
|