IOVS AJP: Endocrinology and Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Inatani, M.
Right arrow Articles by Honda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Inatani, M.
Right arrow Articles by Honda, Y.
(Investigative Ophthalmology and Visual Science. 2000;41:2748-2754.)
© 2000 by The Association for Research in Vision and Ophthalmology, Inc.

Upregulated Expression of Neurocan, a Nervous Tissue Specific Proteoglycan, in Transient Retinal Ischemia

Masaru Inatani1, Hidenobu Tanihara2, Atsuhiko Oohira3, Megumi Honjo1, Noriaki Kido1 and Yoshihito Honda1

1 From the Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Kyoto, Japan; the 2 Department of Ophthalmology, Tenri Hospital, Nara, Japan; and the 3 Department of Perinatology, Institute for Developmental Research, Aichi Human Service Center, Kasugai, Aichi, Japan.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Neurocan, a nervous tissue–specific chondroitin sulfate proteoglycan synthesized primarily by neurons, is expressed abundantly in developing rat retina, whereas it is rarely expressed in adult rat retinas. This study investigated the reexpression of neurocan in a pathologic condition of adult rat retina.

METHODS. Transient retinal ischemia was produced by occlusion of the retinal artery for 60 minutes. After transient retinal ischemia, neurocan expression was investigated by reverse transcription–initiated polymerase chain reaction (RT-PCR), immunohistochemistry, and immunoblot analysis.

RESULTS. Semiquantitative analysis using RT-PCR revealed that mRNA expression for neurocan increased at 24 hours after reperfusion. Furthermore, on immunoblot analysis using an anti-neurocan antibody, MAb 1G2, the intensity of the 220-kDa band as well as the 150-kDa band increased markedly at 24 and 72 hours after reperfusion. The 220-kDa band was predominant at 24 hours after reperfusion, whereas the intensity of the 150-kDa band became almost the same as that of the 220-kDa band at 72 hours after reperfusion. Immunohistochemical analysis revealed that upregulated neurocan immunoreactivity was associated with glial Müller cells.

CONCLUSIONS. Thus, upregulated expression of neurocan in transient retinal ischemia was demonstrated. Furthermore, the immunohistochemical analysis revealed that the upregulated expression of neurocan is derived from Müller cells, although it has been thought that neurocan is synthesized by neurons so far. The neurocan expression by Müller cells suggests that this proteoglycan plays a role in the damage and repair processes in diseased retina.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Proteoglycans are components of the extracellular matrix that regulates numerous cellular behaviors. The common molecular structure of proteoglycans consists of a core protein to which sulfated carbohydrate chains, termed glycosaminoglycans (GAGs), are covalently attached as side chains.1 2 During development of the nervous system, proteoglycans play important roles in cell adhesion and proliferation, differentiation, induction of neurites, and neural network formation.3 4 Among the known proteoglycans, neurocan is a nervous tissue–specific proteoglycan and is a major constituent of chondroitin sulfate proteoglycans (CSPGs) in the brain.5 Neurocan inhibits the homophilic aggregation of neural cells via Ng-CAM/l1 and N-CAM.6 7 8 9 10 In our previous study,11 we found that the expression of neurocan is abundant in developing rat retinas, but is only faint in mature retinas, which suggests that it plays a role in retinal neural network formation. Moreover, it has been reported that proteolytic variants of neurocan are expressed in the brain and that proteolytic processes cause an alteration in binding activities of neurocan to cell adhesion molecules.10 Furthermore, our studies revealed that expression of the neurocan variants are regulated temporally and spatially in rat retinas.11

So far, it has been revealed that expression of numerous molecules such as excitatory amino acids,12 growth factors,13 cytokines,14 and intermediate filaments15 are upregulated in response to transient retinal ischemia. It has been hypothesized that the alteration in expression of these gene products may represent damaging, protective, and regenerating processes against stresses caused by transient ischemia (and/or subsequent reperfusion). Previously, we found that the expression of decorin, a chondroitin/dermatan sulfate proteoglycan, is transiently downregulated but then returns to normal levels after retinal ischemia.16 Retinal ganglion cells and amacrine cells in the inner retina are known to be damaged by transient retinal ischemia.16 Because brain-derived CSPGs are reported to have protective effects on the survival of retinal ganglion cells,17 18 19 alteration in the expression of proteoglycans may be important in retinal ischemic damage. Because neurocan is a representative nervous tissue–specific proteoglycan, as mentioned above, responsive changes in expression of this proteoglycan may play a major role in the damaging or repair processes in retinas of eyes subjected to transient ischemia. Herein we report that expression of the neurocan gene and its products is upregulated after transient ischemia and that the cell origin at least part of this upregulation is attributable to retinal glial cells, namely Müller cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animal Model
All animal studies were conducted in accordance with the ARVO Statement for Use of Animals in Ophthalmic and Vision Research. All animals were given water and food ad libitum. Transient retinal ischemia was induced using the method of Stefánsson et al.,20 with slight modifications as described previously.14 In brief, male Wistar rats (6 weeks after birth) were anesthetized by diethyl ether and intramuscular injection of xylazine (2 mg) and ketamine (5 mg). After exposure of the optic nerve sheath by blunt dissection with scissors, the exposed sheath was tied off with a 6-0 nylon suture under direct observation by an operating microscope. The suture was removed after 60 minutes, and reperfusion of the retinal vessels was observed through the operating microscope. The eyes were subsequently enucleated at 6, 24, and 72 hours after reperfusion. Sham-operated control rats underwent similar surgery but without tightening of the suture. The animals were killed by overdose injections of pentobarbital.

Semiquantitative Reverse Transcription–Initiated Polymerase Chain Reaction and Subsequent Southern Blotting
As described previously,11 16 21 semiquantitative reverse transcription–initiated polymerase chain reaction (RT-PCR) experiments on mRNA expression levels of proteoglycan core protein genes were conducted as follows. Neural retinas of the enucleated eyes were removed by scissors and forceps under an operating microscope. Total RNA extracted from the retina by the acid guanidium thiocyanate-phenol chloroform extraction method was used to synthesize cDNAs for RT-PCR experiments with the use of reverse transcriptase (First-Strand cDNA Synthesis Kit; Amersham Pharmacia Biotech, Uppsala, Sweden). Each cDNA concentration was normalized by PCR experiment using primers to ß-actin in the same manner as described previously.11 16 21 The sequences for primers to ß-actin were AGCTGAGAGGGAAATCGTGC (sense) and ACCAGACAGCACTGTGTTGG (antisense).22 In the PCR experiment, the following conditions were used: denaturation at 95°C for 30 seconds, annealing at 65°C for 30 seconds, and polymerization at 72°C for 1 minute for 22 cycles. After the normalization of each cDNA concentration based on gene expression of ß-actin, PCR experiments for neurocan were performed. The sequences of the sense and the antisense primers for neurocan were AGGAGCCAGCTCCAGTATGG and TTGGCTCTGTGCCGGGGATA, respectively.23 The number of PCR cycles for neurocan was 32. The PCR samples, separated by 2% agarose gel electrophoresis, were transferred to a membrane, Hybond-N+ (Amersham Pharmacia Biotech), by the capillary transfer method with 20x standard saline citrate (SSC). In Southern blotting, a synthesized internal oligonucleotide probe (sequence: TGCTGTGGCTGCTTCTCCTA) was hybridized to the PCR samples by ECL 3'-oligolabeling and detection systems (Amersham Pharmacia Biotech) to exclude the nonspecific bands. Optical densities of hybridizing bands were measured by NIH Image 1.59. A standard curve was generated from the optical densities of hybridizing bands from serial dilutions of template cDNAs, and the linearity of the created standard curve among the selected concentrations was confirmed. The relative levels of mRNA expression were calculated as a ratio to the control (the sham-operated retinal sample).

Antibodies
An anti-rat neurocan monoclonal IgG (MAb 1G2) that recognizes both the 220-kDa full-length core glycoprotein of neurocan and a 150-kDa proteolytic C-terminal half product (also called CSPG-150 or neurocan-C) was produced as described previously.24 An anti-glial fibrillary acidic protein (GFAP) antibody was purchased from DAKO JAPAN (Kyoto, Japan).

Sample Preparation for Immunoblotting
Rat retinal tissues were homogenized in 50 µl ice-cold phosphate-buffered saline (PBS) containing 10 mM N-ethylmaleimide (NEM), 20 mM EDTA, and 2 mM phenylmethylsulfonyl fluoride (PMSF). The homogenate was mixed with 200 µl of 20 mM Tris-HCl buffer (pH 7.5) containing 2% sodium dodecylsulfate (SDS), 10 mM NEM, 20 mM EDTA, and 2 mM PMSF, and the mixture was boiled for 5 minutes. The protein concentration was measured by Bio-Rad DC protein assay (Bio-Rad Laboratories, Tokyo, Japan). Protease-free chondroitinase ABC (EC 4.2.2.4; Seikagaku, Tokyo, Japan) was used to digest chondroitin sulfate side chains linked to core proteins, as described previously.11 The sample (the protein concentration; 50 µg) was electrophoresed by SDS-PAGE on a 3% stacking gel and a 6% separating gel and then electrotransferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA). The membrane was incubated in blocking solution (2% bovine serum albumin [BSA]/2% normal horse serum/2% normal goat serum in PBS) for 1 hour at room temperature and then incubated in the anti-rat neurocan monoclonal IgG (MAb 1G2) diluted 1:2 for 2 hours, and subsequently incubated in the biotinylated anti-mouse IgG (Vector Laboratories, Burlingame, CA) diluted 1:200 for 30 minutes at room temperature. Immunoreactive materials on the membrane were detected using a Vectastain elite ABC kit (Vector Laboratories). The optical densities of immunoreactive bands were measured by NIH Image 1.59.

Immunohistochemistry
After perfusion with 4% paraformaldehyde in PBS, the enucleated eyes were postfixed for 2 hours at 4°C with 4% paraformaldehyde in PBS and then gently shaken overnight at 4°C in 30% sucrose/PBS before freezing on powdered dry ice. Sections (16 µm) were cut using a cryostat and collected onto silanized slides. Retinal sections were washed twice for 3 minutes each in PBS and then incubated in cold methanol (-20°C) for 15 minutes. After washing three times for 3 minutes each in PBS, the retinal sections were treated sequentially with the above mentioned blocking solution for 1 hour, with MAb 1G2 (1:2 dilution) for overnight at 4°C and with Texas red–conjugated anti-mouse IgG (Vector Laboratories) diluted 1:200 for 1 hour at 4°C. The sections were then observed under a confocal microscope (LSM410; Carl Zeiss, Oberkochen, Germany). To identify the cell type of the neurocan-expressing cells in the ischemia–reperfusion retinas, in addition to MAb 1G2, an anti-GFAP antibody (1:500 dilution) was used for double staining. The GFAP immunoreactivities were detected with fluorescein-conjugated anti-rabbit IgG (Vector Laboratories) diluted 1:200.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Increased Gene Expression for Neurocan in Retinas with Transient Ischemia
RT-PCR using specific primers for the neurocan gene showed that cDNA fragments of the expected length (378 bp) were amplified from retinal cDNA samples. In Southern blot analysis, the PCR products were hybridized with the internal probe, which indicates that the amplified products were derived from the target sequence of the rat neurocan gene. To quantify relative levels of mRNA expression for neurocan after transient retinal ischemia, we carried out semiquantitative RT-PCR experiments and subsequent Southern blot analysis after normalization to ß-actin (Fig. 1) . In Southern blotting experiments using the PCR products from sham-operated retinal cDNAs, only a faint hybridizing band of the expected length was detected (lane 1), which suggests that the amounts of gene expression for neurocan are limited in sham-operated retinas as well as in normal mature retinas, as described previously.11 In contrast, the semiquantitative RT-PCR analysis revealed that the intensity of the hybridizing band increased markedly at 24 hours after the cessation of ischemia (lane 2), the mean level (± SE) of gene expression for neurocan in the experimental retinas being 31.6 ± 7.8-fold that of the sham-operated retinas (1.0 ± 0.6). At 72 hours after cessation of ischemia (lane 3), the mean level was 10.2 ± 6.2-fold that of the control. Statistical analysis revealed that the increase in levels of neurocan gene expression at 24 and 72 hours after the cessation of ischemia was significant in comparison to the sham-operated samples (P < 0.05, Mann–Whitney U test).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Semiquantification of neurocan gene expression by RT-PCR and subsequent Southern blot analysis. Semiquantitative RT-PCR experiments for neurocan (A) were performed after normalization to ß-actin (B). A faint hybridizing band was detected in Southern blotting (C) after 32 cycles of PCR using neurocan primers in the control (lane 1). The intensity of the hybridizing band increased markedly at 24 hours (lane 2) after the cessation of ischemia. Even at 72 hours (lane 3) the intense hybridizing band was detected. HincII-digested {phi}X174 DNA was used as a marker (lane M). Arrow, neurocan PCR products of the expected length (378 bp). The densitometrical analysis (D) showed that the mean level (±SE) of gene expression for neurocan at 24 and 72 hours after reperfusion was 31.6 ± 7.8- and 10.2 ± 6.2-fold that of the control (1.0 ± 0.6), respectively. Statistical analysis showed that the levels of neurocan gene expression at 24 and 72 hours after reperfusion increased significantly, compared with the sham-operated samples (n = 4; P < 0.05, Mann–Whitney U test). Error bar, SE.

 
Immunoblot Analysis for Neurocan Core Proteins
As described previously,11 immunoblot analysis of early postnatal rat retinal homogenates treated with chondroitinase ABC shows two immunopositive bands, one of 220 kDa (the full-length neurocan core protein) and one of 150 kDa (a neurocan proteolytic C-terminal product [neurocan-C]). In contrast, in adult rat retina, the immunopositive bands are faintly detectable. Using the same anti-neurocan monoclonal antibody, MAb 1G2, we carried out further immunoblot analysis on homogenates of adult rat retinas with and without transient ischemia. The immunopositive bands were barely detectable in the sham-operated retinal homogenates (without transient ischemia) (Fig. 2A ), which agrees with a very low expression level of neurocan mRNA in sham-operated eyes. Also, it appeared to coincide with the results of immunoblot analysis of the intact adult rat retinal homogenates, as described previously.11



View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. Immunoblot analysis of retina subjected to transient ischemia. Each 50 µg of the retinal homogenate was applied to SDS-PAGE (A). The bands were barely detected in the control, but then the intensity of immunopositive bands of 220 and 150 kDa increased slightly at 6 hours after reperfusion. At 24 and 72 hours after reperfusion, the intensity of the 220-kDa band as well as the 150-kDa band increased markedly. The 220-kDa band was predominant at 24 hours after reperfusion, whereas the intensity of the 150-kDa band became almost the same as that of the 220-kDa band at 72 hours after reperfusion. Closed and open arrowheads, the 220- and 150-kDa bands, respectively. The positions of molecular mass markers are indicated in kDa. The densitometrical analysis demonstrated that the mean level (±SE) of 220-kDa bands at 6 hours was 1.4 ± 0.8-fold that of the control, increased to 9.1 ± 1.4-fold of the control at 24 hours, and then increased to 12.2 ± 1.9-fold at 72 hours (B). The mean level (±SE) of 150-kDa bands at 6 hours was 3.3 ± 1.7-fold of the control, increased to 7.5 ± 1.4-fold at 24 hours, and then increased to 24.4 ± 2.5-fold at 72 hours (C). Statistical analysis showed significantly upregulated expression of the 220- and 150-kDa core proteins at 24 and 72 hours, respectively, after reperfusion (n = 3; P < 0.05, Mann–Whitney U test). Error bar, SE.

 
The intensity of the immunopositive bands of 220 and 150 kDa increased slightly at 6 hours after reperfusion (Fig. 2A) . At 24 and 72 hours after reperfusion, the intensity of the 220-kDa band as well as the 150-kDa band increased markedly. The 220-kDa band was predominant at 24 hours after reperfusion, whereas the intensity of the 150-kDa band became almost the same as that of the 220-kDa band at 72 hours after reperfusion. The intensities of the 220- and 150-kDa bands were semiquantified with the aid of a densitometer, and relative levels were calculated as the folds of the mean level of the controls (sham-operated retinas). The mean level (± SE) of the 220-kDa bands at 6 hours was 1.4 ± 0.8-fold that of the control and then increased to 9.1 ± 1.4-fold at 24 hours and increased to 12.2 ± 1.9-fold at 72 hours after cessation of retinal ischemia (Fig. 2B) . The mean level (± SE) of the 150-kDa bands at 6 hours was 3.3 ± 1.7-fold that of the control, increased to 7.5 ± 1.4-fold at 24 hours, and then increased to 24.4 ± 2.5-fold at 72 hours (Fig. 2C) . Expression of the 220- and 150-kDa bands at 24 and 72 hours after reperfusion was statistically significantly greater than that of sham-operated eyes (P < 0.05, Mann–Whitney U test).

Immunohistochemical Studies of Neurocan-Expressing Retinal Cells after Transient Ischemia
As described previously,11 in retinal sections at P14, strong neurocan immunoreactivities were observed in the inner plexiform layer (IPL) and outer plexiform layer (OPL), whereas in adult retinal sections (postnatal day 42 [P42]), only faint immunoreactivities were shown in the IPL and OPL. Similarly, in sham-operated retinal sections (controls), the neurocan immunoreactivities were very faint in the IPL and OPL (Fig. 3A ). At 6 hours after the cessation of retinal ischemia, the immunoreactive patterns were almost the same as in the sham-operated retinas, but at 24 hours the immunoreactivities in the IPL and OPL increased slightly compared with those in the sham-operated retinas. Moreover, retinal cell bodies and radially oriented processes in the inner nuclear layer (INL) were immunopositive (Fig. 3B) . Immunopositive cells were also found at 72 hours after cessation of retinal ischemia. The radial pattern of immunoreactivities in the INL suggests that they may be derived from retinal Müller cells. Thus, to determine if the immunopositive retinal cells in the INL are identical with Müller cells, we carried out additional immunohistochemical studies using an anti-GFAP antibody. In the sham-operated sections, retinal glial cells (possibly astrocytes) in the ganglion cell layer (GCL) were slightly GFAP-positive (Fig. 3C) . At 24 hours after cessation of retinal ischemia, however, GFAP immunoreactivities became strong in retinal glial cells, in both Müller cells in the INL and astrocytes in the GCL (Fig. 3D) . The confocal image of the double-stained retinal sections with MAb 1G2 and anti-GFAP antibody showed that at least some of the neurocan-immunopositive retinal cells were also GFAP-positive, indicating that at least some of neurocan-expressing cells are Müller cells.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 3. Immunohistochemical analysis of retinas after ischemia. In the sham-operated retina (A), the neurocan immunoreactivities were faint in the inner plexiform layer (IPL) and outer plexiform layer (OPL). At 24 hours after reperfusion (B), immunoreactivities in the IPL and OPL increased slightly compared with the control. Moreover, retinal cell bodies and radial running processes (arrowheads) in the inner nuclear layer (INL) were immunopositive. Immunohistochemical studies using an anti-GFAP antibody showed that at 24 hours after reperfusion, compared with the control retina (C), glial cells throughout the retinal layers (Müller cells) and astrocytes were stained considerably (D). The confocal image of the double staining with MAb 1G2 (Texas red) and the anti-GFAP antibody (fluorescein) (E) showed that neurocan-immunopositive retinal cells with radial running processes (arrowheads) in the INL at 24 hours after reperfusion also were stained with the anti-GFAP antibody. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Original magnification, x400.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present studies we have demonstrated that transient retinal ischemia upregulates the expression of neurocan, a nervous tissue–specific proteoglycan. Previously, we showed that this proteoglycan is expressed in neural retina, especially during its development.11 Our semiquantitative RT-PCR studies showed that, at early postnatal stages (P0–P3), mRNA expression for neurocan increased gradually, reaching a peak on P7, and then began to decrease, having almost disappeared in adult retinas by P42. On the other hand, similar semiquantitative experiments in this study clearly showed that the mean level (±SE) of gene expression for neurocan in the experimental retinas was 31.6 ± 7.8-fold that of the sham-operated retinas (1.0 ± 0.6) at 24 hours after the cessation of ischemia (Fig. 1) . Because the increase in gene expression for neurocan was so rapid and conspicuous after transient ischemia, neurocan may play a role in the damaging and/or regenerating processes in transiently ischemic retinas as well as in developing retinas. Thus, the present study is the first to reveal that expression of this nervous tissue–specific proteoglycan is altered in response to ischemic events in neural tissues.

The amount of neurocan estimated by immunoblot analysis seems to correlate with the above-mentioned mRNA expression of the neurocan. Intensity of the 220-kDa band (the full-length core protein of neurocan) as well as mRNA expression increases significantly at 24 hours after the cessation of retinal ischemia (Fig. 2) . At 72 hours after cessation of retinal ischemia, the amounts of 220 kDa (full-length) neurocan still increase, whereas its mRNA expression decreased to about one third of the level at 24 hours. It is very likely that the differences between protein and mRNA levels at this time point may be attributed to the accumulation of the translated neurocan. Thus, our studies showed that, in addition to mRNA expression, production and accumulation of neurocan increase in response to ischemia.

To date, there have been some reports23 24 that show presence of the proteolytic variants of neurocan. Our previous study11 demonstrated that these are also present in neural retinas. Immunoblot analysis using MAb 1G2 after chondroitinase ABC treatment to remove GAG side chains demonstrated the presence of two types of neurocan core protein, 220 kDa (full-length) and 150 kDa (a proteolytic variant), in rat retinas. In the rat cerebrum, the full-length core protein of neurocan (220 kDa) is detectable on embryonic day 14 (E14), reaches peak level on P10, and then disappears from the brain at around P30, whereas a fairly large amount of its proteolytic product (150 kDa) remains in the mature brain.23 24 Our previous studies revealed that, in developing rat retinas, the amount of the 220-kDa core protein reaches peak level on P3, whereas the amount of its 150-kDa proteolytic variant increases even after P3 and reaches peak on P14.11 In mature retinas, both full-length and proteolytic variants are barely detectable, which is different from mature brains. In transient retinal ischemia, the intensity of the 220-kDa band as well as the 150-kDa band increases markedly at 24 and 72 hours after reperfusion. Moreover, the expression of the full-length (220 kDa) neurocan core protein is predominant at 24 hours after reperfusion, whereas the expression of the proteolytic C-terminal half variant (150 kDa) becomes almost the same as that of the full-length (220 kDa) neurocan at 72 hours after reperfusion. This may reflect the fact that the 150-kDa neurocan variant is produced by the proteolytic events against full-length (220 kDa) neurocan. Thus, our present studies showed, in rat retinas with transient ischemia, that proteolytic events are the same as those that occur during retinal development.

In the transient ischemic retinas, our immunohistochemical studies demonstrated that some of GFAP-expressing cells are in accordance with neurocan-expressing cells (Fig. 3E) , suggesting that retinal glial cells, especially Müller cells, may be a part of cell origin for the neurocan expression in the retina after cessation of ischemia. It has been reported that, in retina affected by pathologic stresses such as transient ischemia,15 16 25 experimental glaucoma,26 retinal detachment,27 surgical intervention,28 and laser injuries,29 GFAP is upregulated in retinal glial cells, particularly Müller cells. Previously, we investigated alterations in cell components in rat models of retinal ischemia, which also were used in this study.16 Our immunohistochemical results demonstrated that, in retinas with transient ischemia, retinal glial cells, such as Müller cells, become the major component, whereas neural cells and their neurites diminish.16 Thus, our immunohistochemical results suggest that retinal Müller cells originate the upregulated expression of neurocan. However, it has been believed that neurocan is synthesized by neurons in the developing rat central nervous tissues so far.3 30 Also, our previous immunohistochemical studies showed no specific localization of neurocan in retinal Müller cells.11 These findings seem to contradict the above-mentioned results in this study. One possible explanation is that different cells may be responsible in a different situation, such as retinal insults. Our present studies suggest that, at least in pathologic situations, neurocan can be expressed by glial cells. This hypothesis may be supported by the fact that astrocytes from rat brain synthesize and secrete neurocan in culture.24 Furthermore, recently, Haas et al.31 and McKeon et al.32 have reported that neurocan immunoreactivities and mRNA expression were detected in the rat reactive astrocytes in mechanically injured brain.

Our immunohistochemical results show that the immunoreactivity of neurocan is localized in the cell bodies and processes of Müller cells, although neurocan is an extracellular matrix. However, some reports have shown that CSPGs, including neurocan, exist intracellularly in adult rat brain but not in developing brain.5 33 34 35 Thus, our immunohistochemical studies showed that in in vivo experiments, neurocan was found in glial cell components of rat retinas, a part of the central nervous system.

So far, there have been no reports about the biological significance of upregulated expression of neurocan in diseased nervous tissues. It is known that Müller cells release soluble factors in culture that are effective on survival of retinal ganglion cells during development.36 Because retinal ganglion cells are in contact with Müller cells within the retina,28 37 it is likely that neurocan expressed from activated Müller cells in ischemic retinas may be involved in the neurotrophic effects on damaged retinal ganglion cells. There has been some evidence17 18 19 that CSPGs have neurotrophic effects on retinal ganglion cells. It has been known that retinal ischemia induces a large increase in the release of glutamate, which activates glutamate receptors such as N-methyl-D-aspartate (NMDA) receptors.12 It has been also reported that glutamate activation of the receptors induces the synthesis of neurocan mRNA in cultivated fetal rat hippocampal neurons.38 Additionally, because neurocan binds basic fibroblast growth factor,39 which is upregulated in transient retinal ischemia,40 neurocan may interact with other molecules upregulated by the ischemic stress. On the other hand, some investigators32 suggest another possibility that neurocan may inhibit the sprouting process of the damaged axon and regeneration of damaged neural network in mammalian central nervous system. Because neurocan has a strong inhibitory effect to neurite outgrowth in vitro,6 41 it is possible that neurocan may prevent the damaged neuronal axons from making abnormal neural networks with intact neurons. Further studies will be required to identify the significance of neurocan expression in diseased retinas.

In conclusion, our studies demonstrated that expression of the full-length core protein and a proteolytic variant of neurocan is upregulated in rat retinas with transient ischemia and that retinal Müller cells are at least in part the source of the increased expression of neurocan in ischemic retinas.


    Footnotes
 
Supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture, Japan.

Submitted for publication December 20, 1999; revised February 28, 2000; accepted March 22, 2000.

Commercial relationships policy: N.

Corresponding author: Hidenobu Tanihara, Department of Ophthalmology, Tenri Hospital, 200 Mishima-cho, Tenri, Nara, 632-8552 Japan. tanihara{at}pearl.ocn.ne.jp


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ruoslahti, E. (1989) Proteoglycan in cell regulation J Biol Chem 264,13369-13372[Free Full Text]
  2. Iozzo, RV (1998) Matrix proteoglycans: from molecular design to cellular function Annu Rev Biochem 67,609-652[Medline][Order article via Infotrieve]
  3. Margolis, RK, Rauch, U, Maurel, P, Margolis, RU (1995) Neurocan and phosphacan: two major nervous tissue-specific chondroitin sulfate proteoglycans Perspect Dev Neurobiol 3,273-290
  4. Oohira, A, Katoh-Semba, R, Watanabe, E, Matsui, F. (1994) Brain development and multiple molecular species of proteoglycan Neurosci Res 20,195-207[Medline][Order article via Infotrieve]
  5. Rauch, U, Gao, P, Janetzko, A, et al (1991) Isolation and characterization of developmentally regulated chondroitin sulfate and chondroitin/keratan sulfate proteoglycan of brain identified with monoclonal antibodies J Biol Chem 266,14785-14801[Abstract/Free Full Text]
  6. Friedlander, DR, Milev, P, Karthikeyan, L, Margolis, RK, Margolis, RU, Grumet, M. (1994) The neuronal chondroitin sulfate proteoglycan neurocan binds to the neural cell adhesion molecules Ng-CAM/L1/NILE/and N-CAM, and inhibits neuronal adhesion and neurite outgrowth J Cell Biol 125,669-680[Abstract/Free Full Text]
  7. Retzler, C, Gohring, W, Rauch, U. (1996) Analysis of neurocan structures interacting with the neural cell adhesion molecule N-CAM J Biol Chem 271,27304-27310[Abstract/Free Full Text]
  8. Grumet, M, Flaccus, A, Margolis, RU (1993) Functional characterization of chondroitin sulfate proteoglycan of brain: interactions with neurons and neural cell adhesion molecules J Cell Biol 120,815-824[Abstract/Free Full Text]
  9. Grumet, M, Milev, P, Sakurai, T, et al (1994) Interactions with tenascin and differential effects on cell adhesion of neurocan and phosphacan, two major chondroitin sulfate proteoglycans of nervous tissue J Biol Chem 269,12142-12146[Abstract/Free Full Text]
  10. Milev, P, Chiba, A, Haring, M, et al (1998) High affinity binding and overlapping localization of neurocan and phosphacan/protein-tyrosine phosphatase-zeta/beta with tenascin-R, amphoterin, and the heparin-binding growth-associated molecule J Biol Chem 273,6998-7005[Abstract/Free Full Text]
  11. Inatani, M, Tanihara, H, Oohira, A, Honjo, M, Honda, Y. (1999) Identification of a nervous tissue-specific chondroitin sulfate proteoglycan, neurocan, in developing rat retina Invest Ophthalmol Vis Sci 40,2350-2359[Abstract/Free Full Text]
  12. Louzada-Junior, P, Dias, JJ, Santos, WF, Lachat, JJ, Bradford, HF, Coutinho-Netto, J. (1992) Glutamate release in experimental ischaemia of the retina: an approach using microdialysis J Neurochem 59,358-363[Medline][Order article via Infotrieve]
  13. Tanihara, H, Inatani, M, Honda, Y. (1997) Growth factors and their receptors in the retina and pigment epithelium Prog Retinal Eye Res 16,271-301
  14. Hangai, M, Yoshimura, N, Yoshida, M, Yabuuchi, K, Honda, Y. (1995) Interleukin-1 gene expression in transient retinal ischemia in the rat Invest Ophthalmol Vis Sci 36,571-578[Abstract/Free Full Text]
  15. Osborne, NN, Block, F, Sontag, KH (1991) Reduction of ocular blood flow results in glial fibrillary acidic protein (GFAP) expression in rat retinal Müller cells Vis Neurosci 7,637-639[Medline][Order article via Infotrieve]
  16. Inatani, M, Tanihara, H, Honjo, M, Hangai, M, Kresse, H, Honda, Y. (1999) Expression of proteoglycan decorin in neural retina Invest Ophthalmol Vis Sci 40,1783-1791[Abstract/Free Full Text]
  17. Schulz, M, Raju, T, Ralston, G, Bennett, MR (1990) A retinal ganglion cell neurotrophic factor purified from the superior colliculus J Neurochem 55,832-841[Medline][Order article via Infotrieve]
  18. Huxlin, KR, Carr, R, Schulz, M, Sefton, AJ, Bennett, MR (1995) Trophic effect of collicular proteoglycan on neonatal rat retinal ganglion cells in situ Brain Res Dev Brain Res 84,77-88[Medline][Order article via Infotrieve]
  19. Nichol, KA, Schulz, MW, Bennett, MR (1995) Nitric oxide-mediated death of cultured neonatal retinal ganglion cells: neuroprotective properties of glutamate and chondroitin sulfate proteoglycan Brain Res 697,1-16[Medline][Order article via Infotrieve]
  20. Stefánsson, E, Wilson, CA, Schoen, T, Kuwabara, T. (1988) Experimental ischemia induces cell mitosis in the adult rat retina Invest Ophthalmol Vis Sci 29,1050-1055[Abstract/Free Full Text]
  21. Inatani, M, Tanihara, H, Oohira, A, Honjo, M, Kido, N, Honda, Y. (2000) Spatiotemporal expression patterns of 6B4 proteoglycan/phosphacan in the developing rat retina Invest Ophthalmol Vis Sci 41,1990-1997[Abstract/Free Full Text]
  22. Nudel, U, Zakut, R, Shani, M, Neuman, S, Levy, Z, Yaffe, D. (1983) The nucleotide sequence of the rat cytoplasmic ß-actin gene Nucleic Acids Res 11,1759-1771[Abstract/Free Full Text]
  23. Rauch, U, Karthikeyan, L, Maurel, P, Margolis, RU, Margolis, RK (1992) Cloning and primary structure of neurocan, a developmentally regulated, aggregating chondroitin sulfate proteoglycan of brain J Biol Chem 267,19536-19547[Abstract/Free Full Text]
  24. Oohira, A, Matsui, F, Watanabe, E, Kushima, Y, Maeda, N. (1994) Developmentally regulated expression of a brain-specific species of chondroitin sulfate proteoglycan, neurocan, identified with a monoclonal antibody 1G2 in the rat cerebrum Neuroscience 60,145-157[Medline][Order article via Infotrieve]
  25. Osborne, NN, Larsen, AK (1996) Antigens associated with specific retinal cells are affected by ischaemia caused by raised intraocular pressure: effect of glutamate antagonists Neurochem Int 29,263-270[Medline][Order article via Infotrieve]
  26. Tanihara, H, Hangai, M, Sawaguchi, S, et al (1997) Up-regulation of glial fibrillary acidic protein in the retina of eyes with experimental glaucoma Arch Ophthalmol 115,752-756[Abstract/Free Full Text]
  27. Erickson, PA, Fisher, SK, Guerin, CJ, Anderson, DH, Kaska, DD (1987) Glial fibrillary acidic protein increases in Müller cells after retinal detachment Exp Eye Res 44,37-48[Medline][Order article via Infotrieve]
  28. Bignami, A, Dahl, D. (1979) The radial glia of Müller in the rat retina and their response to injury. An immunofluorescence study with antibodies to the glial fibrillary acidic (GFA) protein Exp Eye Res 28,63-69[Medline][Order article via Infotrieve]
  29. Grosche, J, Hartig, W, Reichenbach, A. (1995) Expression of glial fibrillary acidic protein (GFAP), glutamine synthetase (GS), and Bcl-2 protooncogene protein by Müller (glial) cells in retinal light damage of rats Neurosci Lett 185,119-122[Medline][Order article via Infotrieve]
  30. Engel, M, Maurel, P, Margolis, RU, Margolis, RK (1996) Chondroitin sulfate proteoglycans in the developing central nervous system. I. Cellular sites of synthesis of neurocan and phosphacan J Comp Neurol 366,34-43[Medline][Order article via Infotrieve]
  31. Haas, CA, Rauch, U, Thon, N, Merten, T, Deller, T. (1999) Entorhinal cortex lesion in adult rats induces the expression of the neuronal chondroitin sulfate proteoglycan neurocan in reactive astrocytes J Neurosci 19,9953-9963[Abstract/Free Full Text]
  32. McKeon, RJ, Jurynec, MJ, Buck, CR (1999) The chondroitin sulfate proteoglycans neurocan and phosphacan are expressed by reactive astrocytes in the chronic CNS glial scar J Neurosci 19,10778-10788[Abstract/Free Full Text]
  33. Aquino, DA, Margolis, RU, Margolis, RK (1984) Immunocytochemical localization of a chondroitin sulfate proteoglycan in nervous tissue. I. Adult brain, retina, and peripheral nerve J Cell Biol 99,1117-1129[Abstract/Free Full Text]
  34. Aquino, DA, Margolis, RU, Margolis, RK (1984) Immunocytochemical localization of a chondroitin sulfate proteoglycan in nervous tissue. II. Studies in developing brain J Cell Biol 99,1130-1139[Abstract/Free Full Text]
  35. Matsui, F, Nishizuka, M, Yasuda, Y, Aono, S, Watanabe, E, Oohira, A. (1998) Occurrence of an N-terminal proteolytic fragment of neurocan, not a C-terminal half, in a perineuronal net in the adult rat cerebrum Brain Res 790,45-51[Medline][Order article via Infotrieve]
  36. Raju, TR, Bennett, MR (1986) Retinal ganglion cell survival requirements: a major but transient dependence on Müller glia during development Brain Res 383,165-176[Medline][Order article via Infotrieve]
  37. Rasmussen, KE (1972) A morphometric study of the Müller cell cytoplasm in the rat retina J Ultrastruct Res 39,413-429[Medline][Order article via Infotrieve]
  38. Wang, W, Dow, KE (1997) Differential regulation of neuronal proteoglycans by activation of excitatory amino acid receptors Neuroreport 8,659-663[Medline][Order article via Infotrieve]
  39. Milev, P, Monnerie, H, Popp, S, Margolis, RK, Margolis, RU (1998) The core protein of the chondroitin sulfate proteoglycan phosphacan is a high-affinity ligand of fibroblast growth factor-2 and potentiates its mitogenic activity J Biol Chem 273,21439-21442[Abstract/Free Full Text]
  40. Miyashiro, M, Ogata, N, Takahashi, K, et al (1998) Expression of basic fibroblast growth factor and its receptor mRNA in retinal tissue following ischemic injury in the rat Graefes Arch Clin Exp Ophthalmol 236,295-300[Medline][Order article via Infotrieve]
  41. Oohira, A, Matsui, F, Katoh-Semba, R. (1991) Inhibitory effects of brain chondroitin sulfate proteoglycans on neurite outgrowth from PC12D cells J Neurosci 11,822-827[Abstract]



This article has been cited by other articles:


Home page
IOVSHome page
B. Tucker, H. Klassen, L. Yang, D. F. Chen, and M. J. Young
Elevated MMP Expression in the MRL Mouse Retina Creates a Permissive Environment for Retinal Regeneration
Invest. Ophthalmol. Vis. Sci., April 1, 2008; 49(4): 1686 - 1695.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Y. Zhang, A. K. Kardaszewska, T. van Veen, U. Rauch, and M.-T. R. Perez
Integration between Abutting Retinas: Role of Glial Structures and Associated Molecules at the Interface
Invest. Ophthalmol. Vis. Sci., December 1, 2004; 45(12): 4440 - 4449.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
K. Maeda, A. Sawada, M. Matsubara, Y. Nakai, A. Hara, and T. Yamamoto
A Novel Neuroprotectant against Retinal Ganglion Cell Damage in a Glaucoma Model and an Optic Nerve Crush Model in the Rat
Invest. Ophthalmol. Vis. Sci., March 1, 2004; 45(3): 851 - 856.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Y. Zhang, U. Rauch, and M.-T. R. Perez
Accumulation of Neurocan, a Brain Chondroitin Sulfate Proteoglycan, in Association with the Retinal Vasculature in RCS Rats
Invest. Ophthalmol. Vis. Sci., March 1, 2003; 44(3): 1252 - 1261.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. Inatani, M. Honjo, Y. Otori, A. Oohira, N. Kido, Y. Tano, Y. Honda, and H. Tanihara
Inhibitory Effects of Neurocan and Phosphacan on Neurite Outgrowth from Retinal Ganglion Cells in Culture
Invest. Ophthalmol. Vis. Sci., July 1, 2001; 42(8): 1930 - 1938.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Inatani, M.
Right arrow Articles by Honda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Inatani, M.
Right arrow Articles by Honda, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS