IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, J. J.
Right arrow Articles by Wilson, S. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, J. J.
Right arrow Articles by Wilson, S. E.
(Investigative Ophthalmology and Visual Science. 2001;42:2776-2783.)
© 2001 by The Association for Research in Vision and Ophthalmology, Inc.

Characterization of Human and Mouse Angiopoietin-like Factor CDT6 Promoters

Janice J. Liu and Steven E. Wilson

From the Department of Ophthalmology, University of Washington School of Medicine, Seattle.


   Abstract
Top
 Abstract
Introduction
 Methods
 Results
 Discussion
 References
 
PURPOSE. Angiogenesis refers to the latter stage of vascular development. It has been reported that angiopoietin-like factor cornea-derived transcript 6 (CDT6) encodes a protein homologous to angiopoietins that could play a critical role in blocking a receptor of angiopoietin (Tie2) and therefore contribute to the avascularity and transparency of the cornea in the developing embryo and the adult. This study was focused on isolation and characterization of the CDT6 promoter.

METHODS. Rapid amplification of cDNA ends (5'-RACE) was used to isolate the CDT6 promoter from an adaptor-ligated genomic DNA fragment library and to identify the transcription initiation site of the CDT6 gene. The RNase protection assay was performed to confirm the initiation site. The sequence similarity, binding sites for putative transcription factors, and transcriptional activity of human and mouse CDT6 promoters were compared. Corneal and noncorneal cells from humans and other animals were transiently transfected with CDT6 promoter-chloramphenicol acetyltransferase (CAT) reporter constructs to analyze the transcriptional activity of the promoter.

RESULTS. A 2956-bp human CDT6 promoter fragment and a 3142-bp mouse CDT6 promoter fragment were isolated. The major transcription initiation sites of the human and mouse CDT6 genes were located at 224 and 168 bp, respectively, upstream of the translation initiation site. Human and mouse CDT6 promoter sequences were very similar. Both promoters were minus TATA and CAAT boxes close to the transcription initiation site. Transfection into human corneal and noncorneal cells and into nonhuman cells revealed that the human CDT6 promoter probably contains positive and negative cis-regulatory elements that modulate cell, tissue, and species specificity. The human CDT6 promoter contains four interferon (IFN)-stimulated response elements (ISREs). No ISREs could be identified in the mouse promoter. IFN-{alpha} stimulated transcriptional activity of the human promoter.

CONCLUSIONS. The human and mouse CDT6 promoters have similar sequences and share many cis-regulatory elements. IFN-{alpha} appears to have an important role in regulating transcription of the human, but not the mouse, CDT6 promoter.


   Introduction
Top
 Abstract
 Introduction
Methods
 Results
 Discussion
 References
 
Angiogenesis refers to the latter stage of vascular development, which includes the sprouting, branching, and differential growth of blood vessels.1 2 3 Angiopoietins belong to a family of angiogenic factors involved in the formation of blood vessels. Angiopoietin (Ang)-1 and Ang2 both function through endothelial cell–specific tyrosine kinase receptors termed Ties (Tie1 and Tie2). Ang1 acts as an activator of the Tie2 receptor.4 5 6 7 8 Ang2 functions as a competitive inhibitor of the Tie2 receptor.4 5 6 7 8 These positive and negative regulators of the Tie2 receptor may be important in regulating normal avascularity of the cornea and vascularization that develops in response to disorders such as infection. The angiopoietin-like factor cornea-derived transcript 6 (CDT6) cloned from human cornea9 encodes a protein homologous to the angiopoietins that appears also to block the Tie2 receptor to maintain the avascularity and transparency of the cornea. Characterization of this gene may provide insight into the factors regulating corneal avascularity and vascularization.

It has been reported that the angiopoietin-like factor CDT6 cloned from human cornea is expressed only in keratocytes and encodes a protein homologous to the angiopoietins that could block the Tie2 receptor to maintain the avascularity and transparency of the cornea.9 In this study, we cloned, sequenced, and partially characterized the promoters regulating CDT6 in the human and the mouse.


   Methods
Top
 Abstract
 Introduction
 Methods
Results
 Discussion
 References
 
Isolation of Human and Mouse Promoters
Rapid amplification of cDNA ends (5'-RACE) was used to isolate human and mouse CDT6 promoters from adaptor-ligated human and mouse genomic DNA fragment libraries, respectively (GenomeWalker; Clontech, Palo Alto, CA). The gene-specific primers (GSPs; downstream primers) were designed from the DNA sequences of the published human CDT6 gene.9 Human GSP1 and GSP2 were CGATGAAAATGCAGAGCCAGGTCAC and GCTGAGAGAGGCTTTTTCAGCATC, respectively. Mouse GSP was CACGCTGGGTGGCTGACAAAG. 5'-RACE was performed according to the instructions of the manufacturer (Clontech). The conditions for two-step PCR were 7 cycles at 94°C for 25 seconds and at 72°C for 4 minutes; 32 cycles at 94°C for 25 seconds and at 67°C for 4 minutes; and 67°C for 4 minutes in a programmable thermal controller (PTC-100; MJ Research, Inc., Watertown, MA). To ensure isolation and amplification of DNA fragments with few point mutations, a proof-reading polymerase and an antibody to DNA polymerase were added into all PCR reactions, according to the manufacturer’s instructions (Clontech). The PCR products were purified (Geneclean II; (BIO 101, Vista, CA), cloned into the pCR II vector (Invitrogen, San Diego, CA), and sequenced using the automatic genetic analyzer (Prism 310; PE-Applied Biosystems, Foster City, CA).

Identification of the Transcription Initiation Sites of Human and Mouse CDT6 Genes
Total cellular RNA was prepared from human or mouse primary cultured corneal stromal fibroblasts using RNA extraction (TRIzol; Gibco, Grand Island, NY). The 5'-RACE system (Version 2.0; Gibco) was applied to identify the transcription initiation site of the human CDT6 gene. An RNase protection assay was performed to confirm the initiation site of the gene. GSPs (downstream primers) were designed referring to DNA sequence of the published human CDT6 gene.9 GSP1, nested GSP2, and nested GSP were GCTTATACACTCCAGAGATGCG, CACGCTGGGTGGCTGACAAAG, and GCTGACAAAGGCCACGATGAAAATGC, respectively. Twenty-five nanograms total cellular RNA was used in the reverse-transcription reaction, according to the protocol of the manufacturer (Gibco).

For identification of the transcription start site of mouse CDT6 gene, the 5'-RACE kit (GenomeWalker; Clontech) was used with an upstream primer CCTGACCCTCCCAGATGAGGTG designed from the sequence of the isolated mouse CDT6 promoter (Fig. 1B) . A 555-bp DNA fragment of mouse CDT6 gene was obtained and sequenced. The RACE system (Smart; Clontech) with a downstream primer GAGCTCCCTCATCTCCTCACAGCAGC designed from the sequence of the 555-bp fragment was used. Two micrograms total cellular RNA was used to perform this 5'-RACE reaction, according to the manufacturer’s instructions.



View larger version (69K):
[in this window]
[in a new window]
  		Figure 1. Identification of the transcription initiation sites of human and mouse CDT6 genes. (A) PCR products resolved on a 1.5% agarose gel. Lane 1: 100-bp DNA ladder; lane 2: human nested GSP2-PCR, showing four cDNA bands; lane 3: human nested GSP-PCR, showing a strong, apparently single cDNA band. However, cloning and sequencing on polyacrylamide revealed that this was a doublet (see B). Lane 4: mouse GSP1-PCR, showing a single cDNA band, confirmed by cloning and sequencing (not shown). (B) The two 5' ends of the human CDT6 cDNA that were generated by the last run of PCR using the abridged universal amplification primer (AUAP) with sequence shown to the right. The result is consistent with those of the RPA. Arrows: alternative transcription initiation sites at T (clone 1 shown in four lanes to left) and G (clone 2 shown in four lanes to right) in the human CDT6 gene. Sequencing yielded some ambiguous nucleotides later in the sequence, a common occurrence in a PCR using a primer such as AUAP with a long stretch of G nucleotides; however, this does not confound identification of the alternative initiation sites in the two clones. This experiment was repeated three times with identical results. (C) RPA was performed to confirm the transcription start site of human CDT6 gene. A 299-bp human CDT6 cDNA fragment spanning the region from -1 to +298 was used as a template to synthesize RNA probes. Arrows: two protected CDT6 mRNA bands. Lanes 1, 2, and 3: cellular RNA prepared from HSF cells at 4, 12, and 20 µg, respectively. The RPA experiment was repeated three times with identical results each time.

 
The DNA fragments amplified by PCR were purified with a kit (Geneclean; BIO 101), cloned into the pCR II vector, and sequenced. The dideoxy sequencing method (Amersham, Piscataway, NJ) was used for the human fragment, and the automatic genetic analyzer (Prism 310; PE-Applied Biosystems) was used for the mouse fragment, once this technology was obtained at our institution.

RNase Protection Assay
Total cellular RNA was prepared from human stromal fibroblasts using RNA extraction reagent (TRIzol; Gibco). A human CDT6 cDNA fragment spanning the region from -1 to +298 was cloned into the pCR II vector. The vector was linearized with XbaI restriction enzyme. The linearized vector was used to synthesize RNA probe with T7 RNA polymerase (SP6/T7 transcription kit; Roche, Indianapolis, IN) and [{alpha}-32P]UTP (800 Ci/mmol; NEN, Boston, MA), according to the manufacturer’s instructions. The RNA probe was purified by ethanol precipitation to remove unincorporated nucleotides. The ribonuclease protection assay (RPA) was performed based on a published method.10 Briefly, 3 x 106 cpm RNA probe was hybridized with total cellular RNA at 45°C overnight. The RNA mixture was digested with 40 µg/ml RNase A and 1000 U/ml RNase T1 (Sigma, St. Louis, MO) at 30°C for 1 hour. The protected CDT6 mRNA sequences were analyzed on 6% sequencing gels. Each gel was dried and exposed to film (BioMax MS; Eastman Kodak, Rochester, NY) for 1 or 2 days.

Construction of CDT6 Promoter–Reporter Genes
PCR was used to create two restriction enzyme sites (KpnI at the 5' end and XhoI at the 3' end) to engineer a series of deletion constructs of the human CDT6 promoter. The five sense primers were AAGGTACCGACGGCCCGGGCTGGTAAAA, AAGGTACCTGGTACATAGCACTTCTGTGGC, AAGGTACCTTCTGACACCTCCTTGCA, AAGGTACCACACAAATTCACAGTCCTC, and AAGGTACCTAGGCTACCCATTCAGCTC.The anti-sense primer was AACTCGAGCTTTTGTGGGTTTGGGTGAG. The five resultant DNA fragments were linked to the chloramphenicol acetyltransferase (CAT) reporter gene through the multiple cloning site of the vector (pCAT3-Basic; Promega Corp., Madison, WI). Sequences were confirmed by DNA sequencing.

PCR was also used to engineer the mouse CDT6 promoter. The sense primer was CCTGTGCACATTCTATACCTACAG and the antisense primer was GGTGTGCAGGCCTGCTCCCCTTA. The 3-kb mouse CDT6 promoter–reporter construct was inserted into the vector (pCAT3-Basic) using KpnI and XhoI restriction enzyme sites of the pCR II vector. The 1-kb mouse CDT6 promoter–reporter construct was ligated into the vector (pCAT3-Basic) through an internal SacI restriction enzyme site of the 3-kb mouse promoter and XhoI restriction enzyme site of the pCR II vector.

Cell Culture
Human lung fibroblasts (MRC-5), human corneal epithelial cells transformed with simian virus (SV)40 large T-antigen (HCE-SV40), human embryonic kidney strain 293 epithelial cells, strain 293 human corneal endothelial cells transduced with the human papilloma virus E6 and E7 genes (HCN-E6/E7), human umbilical vein endothelial cells (HVECs), and monkey embryonic kidney Cos7 fibroblasts (COS7) were cultured by published methods.11 12

Human corneas excluded from use in corneal transplantation by nonocular criteria such as donor sepsis were used for ex vivo cells. Rabbit corneas were obtained from Pel-Freez (Rogers, AR) for ex vivo cells. The epithelial layer of human, mouse, or rabbit corneas was removed by scraping. The corneal tissues were cut into 3-ml2 pieces and placed in a culture dish, with the corneal endothelial layer facing upward. The explants were incubated in MEM (JRH Biosciences, Lenexa, KS), complemented with essential amino acids, nonessential amino acids, vitamins, glutamine, sodium pyruvate, and 10% fetal bovine serum (FBS; Gibco) at 37°C and 5% CO2, until the corneal fibroblasts grew out from the explants. The medium was renewed two times weekly. First- or second-passage human, mouse, or rabbit corneal fibroblasts (HSFs, MSFs, and RSFs, respectively) were used.

Transfection and Detection of the Reporter
Cells were transiently transfected with human and mouse CDT6 promoter constructs (phCDT6-CATs and pmCDT6-CATs) using a lipofection solution (Lipofectamine; Gibco) according to a published method.12 CAT reporter vectors without a promoter or with a human cytomegalovirus (CMV) promoter (Invitrogen) were also transfected in parallel into the cells as negative and positive controls, respectively. CAT enzyme-linked immunosorbent assays (CAT ELISA; Roche) were performed to determine the promoter activity according to the supplier’s instructions. The vector with the CMV promoter linked to a ß-galactosidase reporter (Gibco) was cotransfected with all other vectors to normalize for the variability of transfection efficiency and preparation of cell lysates and conditioned media. The ß-galactosidase ELISA (Roche) was applied to monitor ß-galactosidase activity. A protein assay (Bio-Rad, Hercules, CA) was used to measure the concentration of protein in the cell lysates and conditioned media.

All data were analyzed by computer (Prism, ver. 2.0; GraphPad Software, Inc., San Diego, CA).

Treatment with IFN-{alpha}
Human primary cultured corneal stromal fibroblasts were grown to 90% confluence. The cells were transfected with phCDT6-CAT vector or pmCDT6-CAT vector by using a lipofection reagent according to a published method.12 Cells were treated with 1000 U/ml human IFN-{alpha}A/D (PBL Biomedical Laboratory, New Brunswick, NJ) in fresh media beginning at 24 hours after transfection. Control cells were treated with vehicle alone. The conditioned media were harvested, and the activity of the promoter was evaluated using the CAT ELISA after treatment for 48 hours.


   Results
Top
 Abstract
 Introduction
 Methods
 Results
Discussion
 References
 
Sequences of Human and Mouse CDT6 Promoters
A 2979-bp human CDT6 gene fragment spanning the region from -2732 to +274 (reported to GenBank, accession number AF350361; provided in the public domain by the National Center for Biotechnology Information [NCBI], National Institutes of Health [NIH], and available at http://www.ncbi.nlm.nih.gov/genbank) and a 3419-bp mouse CDT6 gene fragment spanning the region from -2974 to +445 (reported to GenBank, accession number AF350362) were isolated from human and mouse genomic DNA, respectively. A primer that was designed from the human CDT6 gene sequence was used to isolate the mouse CDT6 gene fragment. It was found that this human primer differed by only one base from the sequence of the mouse and therefore successfully amplified the mouse sequence.

Identification of the Transcription Initiation Sites of Human and Mouse CDT6 Genes
The transcription initiation sites for human and mouse CDT6 genes were determined using the 5'-RACE technique. Four cDNA bands were noted in the nested GSP2-PCR (Fig. 1A , lane 2). In the nested GSP-PCR a strong, apparently single cDNA band was observed on the agarose gel (Fig. 1A , lane 3). When this band from the human CDT6 gene was cloned and sequenced, by using a polyacrylamide gel with greater resolution, however, two transcription initiation sites were identified (Fig. 1B) . The two initiation sites were 3 bp apart. This result was consistent with that obtained with RPA (Fig. 1C) .

Two transcription initiation sites only a few bases apart were also detected in the mouse CDT6 gene by using the same methods. A RACE technique (Smart; Clontech) was used to confirm the transcription initiation site of the mouse CDT6 gene. A single cDNA band was generated with this system (Fig. 1A , lane 4). Cloning and sequencing using a polyacrylamide gel confirmed only one transcript in the mouse (not shown).

The transcription initiation sites of human and mouse CDT6 genes were located 224 or 221 bp (Fig. 1B) and 168 or 167 bp (data not shown) 5' upstream of the translation initiation site, respectively. The major transcription initiation sites of the human CDT6 gene appeared to be at both the G and T residues, but the intensity of the protected mRNA band (298 bp) with the 5' ending in G was somewhat higher than the intensity of protected mRNA band (295 bp) with a 5' ending in T (Fig. 1C) . The major transcription initiation site of the mouse CDT6 gene was at the G residue, because cDNA clones that ended with a G nucleotide at the 5' end were several times more numerous than those ending with a T nucleotide (not shown).

Comparison of Transcription Factor–Binding Sites of the Human and Mouse CDT6 Promoters
Putative transcription factor–binding sites in the human and mouse CDT6 promoters were analyzed by computer (MacVector, ver. 5.0, Oxford Molecular Group, Campbell, CA). In both 5' flanking regions of the human and mouse CDT6 genes, transcription factor–binding sites at similar locations included an activator protein (AP) 1, an AP3, three AP4, a CCAAT-binding transcription factor for nuclear factor 1 (CTF-NF1), and an adenovirus promoter element E2aE-CB.

Four IFN-stimulated response elements (ISREs) were present in the human CDT6 promoter. No ISREs were found in the mouse CDT6 promoter.

Similarity of Human and Mouse CDT6 Promoters
The similarity between the human and mouse CDT6 promoters was analyzed using BLAST (provided in the public domain by the NCBI, NIH, and available at http://www.ncbi.nlm.nih.gov/blast). Seven similar sequence regions with 71% to 95% identity were distributed within 1 kb of the transcription initiation sites in the human and mouse CDT6 genes (Fig. 2A) . The stretches with the greatest similarity (95%) were near the transcription initiation sites (Fig. 2B) .



View larger version (57K):
[in this window]
[in a new window]
  		Figure 2. Sequence similarities in the human and mouse CDT6 promoters. (A) The seven similar regions of the two promoters are located between the transcription initiation site +1 and approximately -1000 bp. The region of greatest similarity (95%) is near the transcription initiation site. Arrowheads: transcription initiation site. (B) Alignments of the regions with sequence similarity in the human and mouse CDT6 promoters.

 
Transcriptional Activity of CDT6 Promoters
All PCR-generated CDT6 promoter–CAT reporter constructs had a variable 5' end and an identical 3' end terminating at +224 for the human and at +168 for the mouse, relative to the transcription start site +1 (Fig. 3) . The functions of the 5' flanking regions of human and mouse CDT6 promoters in human or nonhuman cells were assessed by monitoring the capacity to drive expression of the CAT reporter gene.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 3. Truncated human and mouse CDT6 promoters–CAT reporter gene constructs. All constructs had identical 3' ends that ended at the translation initiation codon, but had variable 5' ends. (A) Human CDT6 promoter–CAT reporter constructs designated phCDT6-CAT. (B) Mouse CDT6 promoter–CAT reporter constructs designated pmCDT6-CAT.

 
Transient transfection of the series of human CDT6 promoter–reporter deletion constructs into human corneal stromal fibroblasts (HSFs), human lung fibroblasts (MRC-5), human corneal epithelial cells (HCE-SV40), human embryonic kidney epithelial cells, 293 strain of human corneal endothelial cells (HCN-E6/E7), and umbilical vein endothelial cells (HVECs) illustrated that the truncated promoter fragments had different levels of transcriptional activity in different cells (Fig. 4A) . Of particular interest, the negative control fragment +19 to +224 (206 bp) showed a high level of transcriptional activity in HCE-SV40 and 293 cells, although it did not have the transcription initiation site (Fig. 3) . This fragment also drove the expression of CAT in HSFs and HVECs at low levels, but did not drive expression of CAT in MRC-5 or HCN-E6/E7 cells. The explanation for this is unclear but could indicate that there are important negative regulatory elements in the promoter. The fragment -232 to +224 (456 bp) had a high level of transcriptional activity in HCN-E6/E7 cells and a low level of the activity in HSFs, HCE-SV40, and 293 cells. This construct had no activity in MRC-5 and HVECs. The fragment -732 to +224 (956 bp) demonstrated a moderate level of transcriptional activity in most cells tested (HSFs, MRC-5, HCE-SV40, 293, and HVECs). The fragment -1732 to +224 (1956 bp) showed a high level of transcriptional activity in MRC-5 cells; a low level in HSFs, HCE-SV40, and HVECs; and none in 293 or HCN-E6/E7 cells. The fragment -2732 to +224 (2956 bp) drove the expression of CAT at high levels in MRC-5, HCN-E6/E7, and HVECs, but did not drive expression in HSFs, HCE-SV40, or 293 cells in the absence of IFN-{alpha}.



View larger version (30K):
[in this window]
[in a new window]
  		Figure 4. Characterization of the human CDT6 promoter fragments in cells from humans and other species. (A) Characterization of the human CDT6 promoter fragments in different human cell types. (B) Comparison of 1- and 3-kb human CDT6 promoter activity in human, mouse, and rabbit corneal stromal fibroblast cells and control Cos7 cells. (C) Comparison of the human and mouse CDT6 promoter activities in RSF cells. Cells were cotransfected with 1 µg pCMV-ßgal vector and 5 µg of either ph/mCDT6-CAT vector or promoterless pCAT3-Basic vector (as a negative control) or pCMV-CAT vector (as a positive control). CAT reporter activity was determined with a CAT ELISA and was normalized with respect to ß-galactosidase activity and protein concentration. The results are representative of three experiments in which each transfection was performed a minimum of three times. The results were similar in the different experiments. All errors are expressed as SEM.

 
In Figure 4B the 956-bp and 2956-bp human CDT6 promoters are compared in stromal fibroblast cells from different species in the absence of IFN, with COS7 cells as control cultures. The shorter CDT6 promoter fragment is more promiscuous, driving expression at significant levels in human, mouse, and rabbit stromal fibroblasts. This indicates that the longer fragment may contain negative regulatory elements that function across species lines.

In Figure 4C , approximately 1- and 3-kb CDT6 promoter fragments from human and mouse are compared in rabbit stromal fibroblast cells in the absence of IFN. Both the 1- and 3-kb mouse promoter fragments drove CAT expression at significant levels in stromal fibroblasts from rabbit. Human CDT6 promoter fragments were much less efficient at driving CAT expression in the rabbit stromal fibroblasts, with the longer human promoter fragment having little activity in the rabbit cells.

IFN-{alpha} treatment of human stromal fibroblasts that had been transfected with human CDT6 promoter–reporter constructs increased transcription of the reporter gene (Fig. 5) . A significant effect of IFN was noted with the 956-bp, 1956-bp, and 2956-bp human CDT6 promoter constructs. No effect of IFN-{alpha} was noted with human stromal fibroblasts transfected with the 3142-bp mouse CDT6 promoter (Fig. 5) .



View larger version (14K):
[in this window]
[in a new window]
  		Figure 5. The effect of IFN-{alpha} on CDT6 promoter activity in human corneal stromal fibroblasts. HSFs were cotransfected with 1 µg pCMV-ßgal vector and 5 µg of either phCDT6-CAT vector or pmCDT6-CAT vector. The cells were treated with or without 1000 U/ml human IFN-{alpha} A/D beginning 24 hours after transfection for a total of 48 hours. CAT reporter activity was determined by CAT ELISA and was normalized with respect to ß-galactosidase activity and protein concentration. The experiment was repeated three times with similar results. Representative results are shown. All errors are expressed as SEM. Transcription by the human 2956-bp promoter fragment in human corneal stromal fibroblasts was dependent on IFN-{alpha}. The increase with IFN-{alpha} was statistically significant (P < 0.05, ANOVA) for the 956-, 1956-, and 2956-bp human promoter fragments.

 

   Discussion
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
References
 
Corneal function is dependent on transparency. Avascularity is an important component of corneal transparency. Corneal disorders associated with vascularization such as infection, advanced bullous keratopathy, and chronic contact lens wear cause decreases in vision when vascularity encroaches on the central cornea. In some cases, however, vascularization contributes to halting severe corneal infection that could otherwise spread into the eye and perhaps the central nervous system. Thus, regulation of angiogenesis is vital to normal corneal physiology.

Both the human and mouse CDT6 promoters appear to have two transcription initiation sites. Multiple transcription initiation sites may be important in regulation of the expression and function of a gene.13 14 15 16 17 18 19 20 It is rare to find two sites within a few base pares. It has been reported that avian myeloblastosis virus (AMV) reverse transcriptase can erroneously synthesize cDNA with an "extra" nucleotide at the 5' end of the mRNA template.21 This could lead to the false conclusion that there are two transcription initiation sites. However, RPA without the application of AMV also demonstrated the existence of the two protected CDT6 mRNA bands (Fig. 1C) . The physiological roles of these alternative transcription initiation sites are unknown.

Both the human and mouse CDT6 promoters had no TATA boxes and CCAAT elements close to the transcription initiation site. The presence of multiple transcription initiation sites is also characteristic of TATA-less GC-rich promoters.22 23 The TATA-less human and mouse CDT6 promoters appear to have transcription initiation sites that are different in sequence from those found in other genes.13 14 15 16 17 18 19 20 Genes with regulated (not constitutive) expression during differentiation and development are often found not to have TATA and CCAAT elements close to the transcription initiation site.24

There is high homology between the human and mouse CDT6 promoters. There are seven similar sequence regions with 71% to 95% identity distributed within 1 kb of the transcription initiation sites in the human and mouse CDT6 genes (Fig. 2) . The regions with the greatest similarity (95%) between humans and mice were near the transcription initiation sites. This level of similarity appears to be a common feature of human and mouse gene promoters. For example, the proximal promoters of the human and mouse sulfonylurea receptor 1 (SUR1),25 new Notch target (Hey1),26 clock (Period1),27 fibroblast growth factor receptor 4 (FGFR4),28 and novel nonerythroid Rh glycoprotein (RhCG) genes29 all have shown high similarity between the species. The high homology between human and mouse CDT6 promoters suggests that there could be similarities in the regulation of the CDT6 genes in both species. Thus, the in vitro studies suggest that there are several positive and negative regulatory elements shared by both the human and mouse promoters. Some of these may be important in tissue specificity. However, one important difference was that the human CDT6 promoter has four ISREs in the 5' flanking region. No ISREs were noted in the mouse promoter. Consistent with this, transcription of the human, but not the mouse, promoter was found to be upregulated in response to IFN. There was complete dependence on IFN for transcription of the longest human promoter fragment in vitro. These results suggest that IFN may be an important regulator of angiogenesis of the human cornea in vivo.

IFNs have a number of important physiological roles that involve control of cell proliferation and differentiation.30 IFNs are produced by cells in response to stimuli such as viral infection. Because CDT6 appears to have an antiangiogenic function in the cornea,9 it may be that these ISREs promote CDT6 expression in response to viral infections and other factors that increase IFN expression and thereby regulate the growth of blood vessels into the cornea during such insults.

Transfection of promoter–reporter constructs into cells of different types from humans and from other species suggested that the promoters have cis-positive and -negative transcriptional regulatory elements that modulate reporter gene expression. For example, the 2956-bp human CDT6 promoter fragment was not as strong a driver of CAT expression in human stromal fibroblasts as the 956-bp human CDT6 promoter fragment (Fig. 4B) . However, with the addition of IFN, the longer promoter fragment showed more augmentation of expression than the shorter promoter fragment (Fig. 5) . Detailed site-directed mutagenesis studies are needed to precisely locate these transcriptional regulatory elements and to determine their physiological significance.

One of our motivations for studying the CDT6 promoters was the report of corneal keratocyte specificity9 and the possibility, therefore, that this promoter could be used to express genes in the corneal stroma in transgenic animals. Our in vitro studies suggest that neither the 3419-bp mouse fragment of the CDT6 promoter nor the smaller fragments would have corneal specificity or be specific for the keratocytes in the cornea. It is possible, however, that a longer stretch of the promoter would show more keratocyte specificity or that other factors promote specificity in vivo.


   Footnotes
 
Supported in part by Grants EY10056 and EY01730 from the National Eye Institute and an unrestricted grant from Research to Prevent Blindness.

Submitted for publication February 21, 2001; revised June 25, 2001; accepted July 20, 2001.

Commercial relationships policy: N.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Steven E. Wilson, Department of Ophthalmology, University of Washington School of Medicine, Box 356485, Seattle, WA 98195-6485.


   References
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Risau, W. (1997) Mechanisms of angiogenesis Nature 386,671-674[Medline][Order article via Infotrieve]
  2. Folkman, J, D’Amore, PA (1996) Blood vessel formation: what is its molecular basis? Cell 86,1153-1155
  3. Lindahl, P, Johansson, BR, Leveen, P, Betsholtz, C. (1997) Pericyte loss and microaneurysm formation in PDGF-B-deficient mice Science 277,242-245[Abstract/Free Full Text]
  4. Davis, S, Aldrich, TH, Jones, PF, Acheson, A, et al (1996) Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap expression cloning Cell 87,1161-1169[Medline][Order article via Infotrieve]
  5. Suri, C, Jones, PF, Patan, S, et al (1996) Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis Cell 87,1171-1180[Medline][Order article via Infotrieve]
  6. Maisonpierre, PC, Suri, C, Jones, PF, et al (1997) Science 277,55-60[Abstract/Free Full Text]
  7. Valenzuela, DM, Griffiths, JA, Rojas, J, et al (1996) Angiopoietins 3 and 4: diverging gene counterparts in mice and humans Proc Natl Acad Sci USA 96,1904-1909[Abstract/Free Full Text]
  8. Sato, TN, Tozawa, Y, Deutsch, U, et al (1995) Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation Nature 376,70-74[Medline][Order article via Infotrieve]
  9. Peek, R, van Gelderen, BE, Bruinenberg, M, Kijlstra, A. (1998) Molecular cloning of a new angiopoietinlike factor from the human cornea Invest Ophthalmol Vis Sci 39,1782-1788[Abstract/Free Full Text]
  10. Ausubel FM, Brent R, Kingston RE, et al., eds. et al. Current Protocols in Molecular Biology. New York: John Wiley & Sons, Inc.
  11. Liu, JJ, Shay, JW, Wilson, SE (1998) Characterization of a soluble KGF receptor cDNA from human corneal and breast epithelial cells Invest Ophthalmol Vis Sci 39,2584-2593[Abstract/Free Full Text]
  12. Liu, JJ, Kao, WW, Wilson, SE (1999) Corneal epithelium-specific mouse keratin K12 promoter Exp Eye Res 68,293-301
  13. Salbaum, JM, Weidemann, A, Masters, CL, Beyreuther, K. (1989) The promoter of Alzheimer’s disease amyloid A4 precursor gene Prog Clin Biol Res 317,277-283[Medline][Order article via Infotrieve]
  14. Stein, GS, Lian, JB, Dworetzky, SI, et al (1991) Regulation of transcription-factor activity during growth and differentiation: involvement of the nuclear matrix in concentration and localization of promoter binding proteins J Cell Biochem 47,300-305[Medline][Order article via Infotrieve]
  15. Beale, EG, Clouthier, DE, Hammer, RE (1992) Cell-specific expression of cytosolic phosphoenolpyruvate carboxykinase in transgenic mice FASEB J 6,3330-3337[Abstract]
  16. LeRoith, D, Roberts, CT, Jr (1993) Insulin-like growth factors Ann NY Acad Sci 692,1-9
  17. Brenner, M. (1994) Structure and transcriptional regulation of the GFAP gene Brain Pathol 4,245-257[Medline][Order article via Infotrieve]
  18. Quinn, JP, Mendelson, SC, Paterson, JM, McAllister, J, Morrison, CF (1995) Transcriptional control of neuropeptide gene expression in sensory neurons, using the preprotachykinin-A gene as a model Can J Physiol Pharmacol 73,957-962[Medline][Order article via Infotrieve]
  19. Lenka, N, Vijayasarathy, C, Mullick, J, Avadhani, NG (1998) Structural organization and transcription regulation of nuclear genes encoding the mammalian cytochrome c oxidase complex Prog Nucleic Acids Res Mol Biol 61,309-344[Medline][Order article via Infotrieve]
  20. Cook, GA, Park, EA (1999) Expression and regulation of carnitine palmitoyltransferase-Ialpha and -Ibeta genes Am J Med Sci 318,43-48[Medline][Order article via Infotrieve]
  21. Gupta, KC, Kingsbury, DW (1989) Complete sequences of the intergenic and mRNA start signals in the Sendai virus genome: homologies with the genome of vesicular stomatitis virus Nucleic Acids Res 12,3829-3841[Abstract/Free Full Text]
  22. Reynolds, GA, Basu, SK, Osborne, TF, et al (1983) HMG CoA reductase: a negatively regulated gene with unusual promoter and 5' untranslated regions Cell 38,275-285
  23. McKeon, C, Moncada, V, Pham, T, et al (1990) Structural and functional analysis of the insulin receptor promoter Mol Endocrinol 4,647-656[Medline][Order article via Infotrieve]
  24. Smale, ST, Baltimore, D. (1989) The "initiator" as a transcription control element Cell 57,103-113[Medline][Order article via Infotrieve]
  25. Hernandez-Sanchez, C, Ito, Y, Ferrer, J, Reitman, M, LeRoith, D. (1999) Characterization of the mouse sulfonylurea receptor 1 promoter and its regulation J Biol Chem 274,18261-18270[Abstract/Free Full Text]
  26. Maier, MM, Gessler, M. (2000) Comparative analysis of the human and mouse Hey1 promoter: Hey genes are new Notch target genes Biochem Biophys Res Commun 275,652-660[Medline][Order article via Infotrieve]
  27. Hida, A, Koike, N, Hirose, M, Hattori, M, Sakaki, Y, Tei, H. (2000) The human and mouse Period1 genes: five well-conserved E-boxes additively contribute to the enhancement of mPer1 transcription Genomics 65,224-233[Medline][Order article via Infotrieve]
  28. Becker, M, Brauninger, A, Wolf, G, Kaufmann, M, Strebhardt, K. (2000) Identification and functional characterization of the human and murine fibroblast growth factor receptor 4 promoters Biochem Biophys Res Commun 276,493-501[Medline][Order article via Infotrieve]
  29. Liu, Z, Chen, Y, Mo, R, et al (2000) Characterization of human RhCG and mouse Rhcg as novel nonerythroid Rh glycoprotein homologues predominantly expressed in kidney and testis J Biol Chem 275,25641-25651[Abstract/Free Full Text]
  30. Vilcek, J, Sen, GC (1999) Interferons and other cytokines Fundamental Virology ,341-365 Lippincott-Raven Philadelphia.



This article has been cited by other articles:


Home page
 IOVSHome page
C. Cursiefen, S. Masli, T. F. Ng, M. R. Dana, P. Bornstein, J. Lawler, and J. W. Streilein
Roles of Thrombospondin-1 and -2 in Regulating Corneal and Iris Angiogenesis
Invest. Ophthalmol. Vis. Sci., April 1, 2004; 45(4): 1117 - 1124.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, J. J.
Right arrow Articles by Wilson, S. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, J. J.
Right arrow Articles by Wilson, S. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS