IOVS Journal of Nutrition
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shepard, A. R.
Right arrow Articles by Clark, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shepard, A. R.
Right arrow Articles by Clark, A. F.
(Investigative Ophthalmology and Visual Science. 2001;42:3173-3181.)
© 2001 by The Association for Research in Vision and Ophthalmology, Inc.

Delayed Secondary Glucocorticoid Responsiveness of MYOC in Human Trabecular Meshwork Cells

Allan R. Shepard1, Nasreen Jacobson1, John H. Fingert2, Edwin M. Stone2, Val C. Sheffield3 and Abbot F. Clark1

1 From the Alcon Research, Ltd., Fort Worth, Texas; the 2 Department of Ophthalmology, University of Iowa College of Medicine, Iowa City; and the 3 Department of Pediatrics and Howard Hughes Medical Institute, University of Iowa, Iowa City.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. To characterize the glucocorticoid responsiveness of the glaucoma gene MYOC (myocilin/TIGR) in cultured human trabecular meshwork (TM) cells.

METHODS. MYOC expression in two independently derived human TM cell lines was quantified by Western immunoblot analysis of protein levels and quantitative PCR analysis of mRNA levels. Promoter activity was measured indirectly with the luciferase reporter gene in a dual luciferase reporter assay.

RESULTS. Application of the synthetic glucocorticoid dexamethasone (Dex) to cultured TM cells at 100 nM resulted in a delayed (8–16 hours) induction of myocilin. The concentration dependence (median effective concentration [EC50], ~10 nM) and reversal by the glucocorticoid antagonist, RU486, implicates the glucocorticoid receptor (GR). In an interesting observation, RU486 alone acted as a partial agonist to MYOC expression. Treatment of TM cells with the protein synthesis inhibitor cycloheximide abolished the Dex induction, suggesting an indirect effect of the GR on MYOC expression. In addition, the RNA synthesis inhibitor actinomycin D also blocked Dex induction, indicating that the Dex effect was due to increased MYOC transcription. Analysis of up to 2700 nucleotides (nt) of the MYOC gene 5'-flanking region in luciferase reporter constructs showed no Dex induction, despite the presence of multiple putative glucocorticoid response element (GRE)-like half-sites in the MYOC promoter and the presence of an intact cellular GR-mediated signaling system.

CONCLUSIONS. MYOC is a delayed secondary glucocorticoid-responsive gene. Characterization of the transcription factors that mediate the secondary response will shed new light on the pathophysiology of steroid-induced ocular hypertension and glaucoma.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Corticosteroids are widely used as anti-inflammatory agents for the treatment of ocular inflammatory conditions but have the undesired effect of producing elevated intraocular pressure in approximately 30% to 40% of the normal population and can lead to secondary glaucoma.1 2 3 4 5 An elevation in intraocular pressure and visual field loss is due to a reduction in the aqueous outflow facility.1 2 3 4 5 A consequence of corticosteroid exposure in the eye may be upregulation of MYOC (myocilin/TIGR) expression, particularly in the trabecular meshwork (TM). Evidence for MYOC upregulation by glucocorticoids comes mainly from cultured cell models.6 7 8 9 10 MYOC mutations have recently been shown to cause glaucoma.11 12 13 The correlation between increased levels of MYOC in the TM on glucocorticoid treatment and MYOC’s role in causing glaucoma suggest a role for MYOC in steroid-induced glaucoma.

The role of glucocorticoid-induced MYOC expression in the TM of steroid-responsive patients is controversial. A correlation between the in vitro effects of Dex on MYOC expression in the TM and the in vivo effects of Dex on intraocular pressure have been argued based on similarities between (1) the concentrations of Dex required for MYOC induction in the TM8 14 15 and the aqueous humor concentration of Dex in patients treated topically with Dex eyedrops16 and (2) the delayed response for Dex induction of MYOC expression and the development of elevated IOP occurring over a 2-week period in steroid-responsive patients.1 2 3 4 5 17 18 19 20 21 22 The time-frame of onset of IOP elevation and the Dex induction of MYOC expression appear consistent with a role for MYOC in steroid-induced glaucoma. Upregulation of MYOC by Dex in TM cell lines has been reported to occur only after 7 to 10 days of continuous treatment,7 8 which is much longer than that expected for a primary response gene. The binding affinity of Dex to the GR in cultured TM cells is reported to be approximately 5 nM,23 whereas the median effective concentration (EC50) of Dex induction of MYOC has been reported to be 10 times higher.8 14 15 However, a thorough demonstration of the Dex concentration requirements for MYOC induction and the time frame of induction have not been reported to date.

A central question related to the mechanism of steroid-induced glaucoma is whether the steroid induction is a primary or secondary (i.e., direct or indirect) effect and whether MYOC is a cause or effect gene. There are basically two types of glucocorticoid response mechanisms effecting gene transcription. One response is primary (i.e., without new protein synthesis) and involves the glucocorticoid receptor complex’s directly activating target gene transcription. The other response is secondary and follows a delayed time course, relative to the primary response, and is blocked by the protein synthesis inhibitor cycloheximide (CHX). An example of primary and secondary glucocorticoid-responsive genes is the C/EBP-arginase gene cascade. The CCAAT/enhancer binding protein (C/EBP-ß) is induced by Dex within 0.5 hours and in turn activates the arginase gene after a lag of 6 hours.24 25

There are several conflicting reports on glucocorticoid induction of MYOC expression in the TM. Some investigators have reported that several days are needed to induce MYOC in Dex-treated TM cells.7 8 10 However, another study showed that Dex treatment of cultured TM cells causes a marked increase in MYOC mRNA within 1 day of treatment that increases progressively with time of exposure.6 Multiple putative glucocorticoid response elements (GREs) have been reported within 5000 bp of the MYOC 5'-flanking region.7 8 26 27 However, a separate study failed to identify any classic GREs from the MYOC translation start site to 1900 bp upstream.28

One commonly promoted hypothesis is that glucocorticoid induction of MYOC expression in TM cells requires several days of unusually high levels of Dex exposure and is mediated by GREs in the promoter region. Our studies were undertaken to specifically address whether MYOC is a primary or secondary Dex responsive gene, whether the Dex effect is due to increased MYOC gene transcription or to altered stability of MYOC mRNA or protein, the effective half-maximal response dose for Dex-induced MYOC expression, and the promoter responsiveness of MYOC to Dex. To investigate these questions, we examined the endogenous MYOC response to Dex in cultured human TM cell lines, and we examined the Dex responsiveness of transfected MYOC promoter-luciferase reporter constructs in human TM cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Culture of Human TM Cells
Human TM cells were derived from human donor eyes, as previously described.29 30 31 32 Primary GTM66 cells (passages 4–7) were derived from a 92-year-old woman with glaucoma and cultured in low-glucose DMEM (HyClone Laboratories, Logan, UT) containing 10% FBS (Hyclone) and antibiotics (Life Technologies, Inc., Rockville, MD). Transformed TM533 cells (passages 15–16) were cultured in high-glucose DMEM (Life Technologies, Inc.) containing 10% FBS and antibiotics. Primary SGTM1749 cells (passage 6) were derived from a 93-year-old man with glaucoma and cultured according to the method of Stamer et al.34 Monolayer TM cells were grown to confluence before addition of Dex (Sigma, St. Louis, MO). Stock solutions of Dex (10-4 M) and RU486 (10-3 M) were prepared in ethanol, and CHX (3 mg/ml) and actinomycin D (ActD; 1 mg/ml) were prepared in water. Confluent cells in 12-well plates received doses of the appropriate drugs, and control wells received equivalent vehicle treatment.

SDS-PAGE and Western Blot Analysis
Cells were rinsed with PBS and solubilized in a commercial mammalian extraction buffer (M-Per; Pierce, Rockford, IL) supplemented with a protease inhibitor cocktail (Complete, EDTA-free; Roche Molecular Biochemicals; Indianapolis, IN) and centrifuged at 12,000g for 5 minutes. Protein concentration of the supernatant was determined with a protein assay reagent (Coomassie Plus; Pierce). Cell extracts were stored at -20°C.

Cell media or extracts were analyzed using precast polyacrylamide gels (NuPage; Invitrogen, San Diego, CA) and a gel electrophoresis system (Novex, San Diego, CA). Proteins were electroblotted to polyvinylidene fluoride (PVDF) membranes (Hybond-P; Amersham Pharmacia Biotech, Piscataway, NJ), blocked with gelatin, and probed with affinity-purified rabbit anti-MYOC antibody 129 (generated to myocilin peptide 156-171)35 and an anti-rabbit IgG secondary antibody (Amersham). Immunoreactivity was detected with an enhanced chemiluminescence detection system (ECL Plus; Amersham Pharmacia Biotech). Blots were either exposed to film (BioMax MR; Eastman Kodak, Rochester, NY) and scanned (ScanJet ADF; Hewlett Packard, Boise, ID) for figure presentation or scanned directly on a phosphorescence imager (Storm 840 Phosphorimager; Molecular Dynamics, Sunnyvale, CA) for quantitation by computer (ImageQuant software; Molecular Dynamics).

Plasmid Construction
Plasmid p-2.5MYOC.Luc was created by cloning the MYOC-2488/-18 region as a SacI (New England Biolabs, Beverly, MA) fragment from plasmid pGL3.5B-26 into the SacI site of pGL3.basic (Promega Corp., Madison, WI). pGL3.5B-26 contains a HindIII fragment of MYOC that includes 4560 bp of 5'-flanking region and 1983 bp of exon 1 inserted in an antisense orientation relative to the luciferase gene.

Plasmid p-2.8MYOC.Luc was created by inserting the luciferase gene into the plasmid pUC19.3450. pUC19.3450 contains a 5609-bp EcoRI fragment of the MYOC gene from BAC HS454G6 cloned into the pUC19 vector. The luciferase gene was isolated as an NcoI/XbaI (New England Biolabs) fragment from plasmid pGL3.basic, blunt ended with DNA polymerase (Klenow; Gibco-BRL Life Technologies), and ligated into the BstZ17 I (New England Biolabs) site of pUC19.3450. In effect, this created a luciferase expression plasmid driven by the MYOC promoter region -2778/+210.

Plasmid p-235MYOC.LUC was constructed by PCR amplification of the -235/+54 region of p-2.5MYOC.LUC with primers 5'-GGCATAACGCGTGATAGGAACTATTATTGGGG-3' (MluI site italic) and 5'-CGCATTCTCGAGGGTGAGGCTTCCTCTGGAAA-3' (XhoI site italic; Research Genetics, Huntsville, AL) and the a DNA polymerase system (Platinum Taq, Life Technologies). The PCR product was purified and digested with MluI (New England Biolabs) and XhoI (Promega Corp.). Digested DNA was purified from an agarose gel by gel extraction (QIAquick; Qiagen Inc., Valencia, CA) and finally ligated into a similarly digested pGL3.basic vector. Sequence integrity of the amplified -235/+54 region was confirmed by cycle sequencing (Division of Molecular Transport, Department of Internal Medicine, University of Texas Southwestern Medical Center). Proper cloning of all plasmids was confirmed by restriction analysis.

Plasmid pGRE.Luc (Clontech, Palo Alto, CA) contains three copies of the GRE enhancer fused to a TATA-like promoter region from the HSV-TK promoter and drives expression of the firefly luciferase reporter gene. Plasmid pRL-SV40 (Promega) contains the SV40 early enhancer–promoter region driving expression of the Renilla luciferase reporter gene.

Electrotransfection
Transformed human TM5 cells35 were transfected with plasmid DNA using the long-duration electroporation procedure of Bodwell et al.36 Essentially, TM5 cells were harvested at approximately 90% confluence by trypsin-EDTA treatment and resuspended at 3.3 x 107 to 1 x 108 cells/ml in ice cold PERM buffer (10 mM piperazine-N,N'-bis(2-ethanesulfonic acid) [PIPES], 137 mM NaCl, 5.6 mM glucose, 2.7 mM KCl, 2.7 mM EGTA, 1 mM Na-adenosine triphosphate [ATP]; pH 7.4). Fifty microliters HBS (20 mM HEPES, 142 mM NaCl, 5.4 mM KCl, 1.3 mM Na2HPO4, 6 mM glucose; pH 7.4) containing 10 µg plasmid DNA was added to 300 µl suspended TM5 cells on ice. Cells were subsequently electroporated in a 0.4-cm cuvette (Bio-Rad, Hercules, CA) with a gene pulser (Gene Pulser II; Bio-Rad) set at 170 V and a capacitance extender (Capacitance Extender Plus; Bio-Rad) set at 2500 to 3200 µF to achieve a time constant of 135 to 140 msec. After electroporation, cells were resuspended in 1 ml complete medium and distributed to a 24-well plate at 1.6 x 106 cells/well. The medium was changed after 24 hours and cells were harvested after 48 hours. Cells were rinsed with PBS and extracted in 100 µl buffer (M-Per; Pierce) supplemented with a protease inhibitor cocktail (Complete, EDTA-free; Roche Molecular Biochemicals) followed by centrifugation at 12,000g for 5 minutes. Protein concentration of the supernatant was determined with a protein assay reagent (Coomassie Plus; Pierce). Cell extracts were stored at -20°C.

Luciferase Assay
A reporter assay system (Dual-Luciferase Reporter Assay System; Promega) was used according to the manufacturer’s instructions to assay cell extracts. Luciferase activity was measured in a luminometer (model TD-20/20; Turner Designs, Sunnyvale, CA).

RNA Isolation and First-Strand cDNA Preparation
Total RNA was isolated from TM cells using extraction reagent (TRIzol; Life Technologies), according to the manufacturer’s instructions. First-strand cDNA was generated from 1 µg total RNA using random hexamers and reverse transcription reagents (TaqMan; PE Biosystems, Foster City, CA) according to the manufacturer’s instructions. The 100-µl reaction was subsequently diluted 10-fold to achieve an effective cDNA concentration of 1 ng/µl.

Quantitative PCR
Quantitative PCR (QPCR) was performed using a sequence-detection system (ABI Prism 7700; PE Biosystems). MYOC amplification was performed with primer pair GCCCATCTGGCTATCTCAGG and CTCAGCGTGAGAGGCTCTCC at 100 nM and probe 6FAM-ACTAGTTCTCCACATCCGGTGTCTCCCTCT-TAMRA (TaqMan; PE Biosystems) at 900 nM. The MYOC primer/probe set generates an 82-bp PCR product from nt 692-773 of the open reading frame, and the probe spans exons two and three. Specificity of the MYOC primer pairs was assessed by amplification and sequencing of the PCR product as described. Predeveloped 18S ribosomal RNA reagents (TaqMan; PE Biosystems) were used as a normalization control in each reaction according to the manufacturer’s recommendations. 18S rRNA was chosen as a normalization control based on its relative abundance in eukaryotic cells and the absence of fluctuation of 18S by tissue type and metabolic state.37 38 MYOC or 18S rRNA reactions consisted of 1x TaqMan Universal PCR Master Mix (PE Biosystems), appropriate primer-probe concentrations, and 2.5 ng cDNA in a final volume of 25 µl. Thermal cycling conditions consisted of 50°C for 2 minutes and 95°C for 10 minutes followed by 40 cycles at 95° for 15 seconds and 60°C for 1 minute. Quantification of relative RNA concentrations was achieved, by using the relative standard curve method (as described in PE Biosystems User Bulletin 2; http://docs.appliedbiosystems.com/pebiodocs/043,03859.pdf). First-strand cDNA for generating the relative standard curve was derived from total RNA from a glaucomatous TM cell line (GTM97), as described earlier. QPCR data are presented as mean ± SD. Statistical comparisons were made by Student’s t-test with a paired, two-tailed distribution. P < 0.05 was considered statistically significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
To determine the time-course of myocilin induction in cultured TM cell lines, we treated cells with 100 nM Dex for times ranging from 1 to 96 hours and followed the response by measuring myocilin protein levels using Western blot analysis. Dex stimulation of GTM66 cells (Figs. 1A 1B) or SGTM1749 cells (Figs. 1C 1D) resulted in a delayed (8–16 hours) induction of myocilin. Similar results were seen in additional experiments (n = 3).



View larger version (41K):
[in this window]
[in a new window]
  		Figure 1. Time-course of Dex-induced myocilin protein expression. Representative Western blots analyses are shown of native cell-associated myocilin levels (arrow) in (A) GTM66 cells treated with 100 nM Dex for 0, 1, 4, 8, 24, or 48 hours or (C) SGTM1749 cells treated with 100 nM Dex for 0, 16, 24, 48, 72, or 96 hours. (B, D) Quantification of (A, C).

 
Dose responsiveness of MYOC expression in cultured TM cell lines was determined by treating cells for 24 to 48 hours with Dex doses ranging from 0.1 nM to 1 µm and measuring the response by either Western blot or QPCR analysis. An EC50 of approximately 10 nM Dex was determined for MYOC mRNA induction in GTM66 cells (Fig. 2E) . 18S rRNA levels normalized to total RNA varied by 12% or less in nontreated and treated cells, and in all cases in which minus-reverse transcriptase and minus-template controls were included in QPCR, the level of amplification was insignificant (data not shown). Similar, but less accurate, EC50 levels were determined for myocilin protein in GTM66 (Figs. 2A 2B) and SGTM1749 (Figs. 2C 2D) cells.



View larger version (24K):
[in this window]
[in a new window]
  		Figure 2. Dose–response analyses of Dex-induced myocilin protein and mRNA expression. Representative Western blot analyses are shown of native cell-associated myocilin levels (arrow) in (A) GTM66 or (C) SGTM1749 cells treated with 10-10 to 10-6 M Dex for 48 hours. (B, D) Quantification of (A, C). (E) Quantitative PCR analysis of MYOC mRNA levels in GTM66 cells treated for 48 hours with 10-10 to 10-6 M Dex (n = 3).

 
The antiglucocorticoid-antiprogestin RU486 was added to GTM66 cell media at 1 µm with or without 100 nM Dex for 16 days (Fig. 3) . Dex alone gave a 4.3-fold protein induction (Figs. 3A 3B) and 69-fold mRNA response (Fig. 3C) . RU486 was an effective antagonist for the Dex-mediated induction of myocilin and MYOC mRNA (Figs. 3A 3B 3C) . RU486 alone caused a 3.2-fold increase in MYOC protein levels (Figs. 3A 3B) and a 14-fold increase in MYOC mRNA levels (Fig. 3C) . Thus, RU486 was able to act as a partial agonist for MYOC expression.



View larger version (37K):
[in this window]
[in a new window]
  		Figure 3. Effects of the glucocorticoid antagonist RU486 on MYOC expression. (A) Western blot analysis of native cell–associated myocilin levels (arrow) in GTM66 cells treated with 10-6 M RU486 with or without 10-7 M Dex for 16 days. (B) Quantification of (A). (C) Quantitative PCR analysis of MYOC mRNA levels. *P < 0.05, relative to control (n = 3).

 
The accumulation of MYOC mRNA in Dex-treated TM cells may be due to an increase in its rate of synthesis, a decrease in its rate of degradation, or a combination of both. To test these possibilities, we pretreated GTM66 cells with 5 µg/ml ActD for 1 hour and continued the incubation for an additional 24 hours, with or without the addition of 100 nM Dex. ActD alone had little effect on control MYOC expression but completely prevented the Dex-induced accumulation of MYOC mRNA (Fig. 4A) . Thus, it seems likely that the rate of MYOC transcription is increased by Dex.



View larger version (15K):
[in this window]
[in a new window]
  		Figure 4. Effects of protein and mRNA synthesis inhibitors on MYOC expression. Quantitative PCR analysis of MYOC mRNA levels in GTM66 cells treated for (A) 25 hours with 10 µg/ml CHX with or without 24 hours with 10-7 M Dex or (B) 25 hours with 5 µg/ml ActD with or without 24 hours with 10-7 M Dex. *P < 0.05 Dex relative to either Dex+CHX or Dex+ActD (n = 3).

 
To determine whether the Dex stimulation of MYOC transcription requires de novo protein synthesis, we treated TM cells with the protein synthesis inhibitor CHX. GTM66 cells were pretreated with 10 µg/ml CHX for 1 hour and the incubation continued for an additional 24 hours with or without 100 nM Dex. CHX alone had little effect on control MYOC expression but completely prevented the Dex-induced accumulation of MYOC mRNA (Fig. 4B) . This result suggested that Dex-stimulation of MYOC mRNA expression requires ongoing protein synthesis.

To determine whether the Dex induction of MYOC transcription is mediated by the proximal promoter, we tested several lengths of 5'-flanking region for glucocorticoid responsiveness. MYOC promoter regions were numbered relative to the putative transcription start site7 and included nt -2488/-18, -2778/+210, and -235/+54 (Fig. 5A) . Promoter fragments were coupled to the firefly luciferase reporter gene and transfected into transformed TM5 cells. TM5 cells were used because of their ease of culturing and electrotransfectability. Twenty-four hours after electroporation, Dex was added at 10-11 to 10-7 M, and cells were harvested 48 hours later. Cell extracts were measured for firefly luciferase activity and normalized to cotransfected Renilla luciferase activity. As a positive control, we included a plasmid containing three copies of the GRE enhancer fused to the HSV-TK promoter (pGRE.Luc; Clontech). pGRE.Luc was active in TM5 cells and responded to Dex in a dose-dependent manner with an EC50 of 4.4 nM (Fig. 5B) , suggesting that TM5 cells have an intact Dex-GR signaling system. Several MYOC promoter fragments (Fig. 5A) were tested and found to be unresponsive to Dex (Fig. 5B) . Basal promoter activity (with no Dex) of p-235MYOC.Luc, p-2.5MYOC.Luc, p-2.8MYOC.Luc, and pGRE.Luc were 16-fold, 1-fold, 5-fold, and 20-fold above p.Luc background (Fig. 5B) , respectively. Attempts to examine these MYOC promoter constructs in primary TM cell cultures were unsuccessful because of low transfection efficiencies.



View larger version (15K):
[in this window]
[in a new window]
  		Figure 5. MYOC promoter–reporter gene analysis in transiently transfected TM cells. (A) MYOC promoter–luciferase constructs. Solid and open arrows: transcription and translation start sites, respectively. (B) Luciferase assay quantifying MYOC promoter activity from various MYOC–luciferase constructs transfected into TM5 cells treated with various doses of Dex. Positive and negative controls included a synthetic GRE fused to a minimal promoter (pGRE.Luc) and an empty vector (pLuc).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
A central question addressed in this study was whether MYOC is a primary or secondary glucocorticoid-responsive gene. Previous reports have indicated that prolonged treatment of TM cells on the order of days with Dex is required for MYOC induction.7 8 We examined the time-course of Dex induction in two different TM cell lines and showed a delayed response of 8 to 16 hours before myocilin induction was evident (Fig. 1) . This period of delay is typical for an indirectly responsive glucocorticoid-activated gene (e.g., arginase25 ) and is in agreement with Tamm et al., who found Dex induction of MYOC mRNA within 1 day of treatment.6 Primary response genes such as C/EBP-ß respond to Dex as early as 30 minutes.24

By definition, a secondary response gene should require new protein synthesis from the primary response gene or genes for its activation (Fig. 6) . Glucocorticoid-responsive cells have sufficient unactivated GR present to directly and sufficiently activate primary response genes without requiring new protein synthesis.39 Treatment of TM cells with the protein synthesis inhibitor CHX completely blocked Dex stimulation of MYOC mRNA (Fig. 4B) , further suggesting that MYOC is a secondary glucocorticoid-response gene. CHX blockage of Dex-induced MYOC expression in TM cells was also noted by Nguyen et al.7 Induction of both MYOC mRNA and protein expression by Dex indicates that the Dex response is not due to the inactivation of a myocilin-degrading protease.



View larger version (19K):
[in this window]
[in a new window]
  		Figure 6. Schematic of a possible mechanism explaining the delayed secondary glucocorticoid responsiveness of MYOC gene expression. Dex binds to and activates the GR, which binds to the glucocorticoid response element (GRE) of an unknown gene (gene X). The protein encoded by gene X binds to the response element (RE) in the MYOC gene, leading to the induction of myocilin. ActD blocks transcription, and CHX blocks translation.

 
A second question was whether the Dex effect on MYOC is due to increased MYOC gene transcription or decreased mRNA turnover. We examined this by treating TM cells with the RNA synthesis inhibitor ActD and measuring relative MYOC transcript levels by quantitative PCR (Fig. 4A) . Treatment with ActD completely eliminated the Dex effect, suggesting that MYOC upregulation by Dex is due to increased gene transcription and not increased mRNA stability.

A third question addressed in our studies was whether the Dex effect on MYOC is through a classic GR-mediated pathway or involves an unusual induction pathway. Typical GR-mediated events require an effective half-maximal dose of 5 nM Dex.23 We determined an EC50 of approximately 10 nM for Dex-stimulated MYOC mRNA induction (Fig. 2C) . The 10-nM EC50 found for MYOC is similar to that for other Dex-GR complex–mediated responses.30 39 40 41 Our results disagree with those of Polansky15 who reported a 10-fold higher half-maximal Dex dose than that required for Dex binding to GR.15 A possible explanation for this discrepancy is that the EC50 determination made by Polansky is based on only three data points with a maximum Dex dosage of 100 nM, whereas our results are based on six data points with a maximal 1 µM Dex dosage.

We examined the effect of the glucocorticoid antagonist RU486 on the Dex-mediated induction of MYOC. RU486 nearly abolished the Dex effect on MYOC (Figs. 3B 3C) , suggesting GR antagonism of Dex by RU486. An interesting finding was that RU486 by itself induced MYOC mRNA (Fig. 3C) and protein (Figs. 3A 3B) expression. Partial agonist activity of steroid receptor antagonists, such as tamoxifen and RU486, are known to be tissue and cell-type dependent. The RU486 agonist activity with MYOC in GTM66 cells may be similar to that with mouse mammary tumor virus activation in human osteosarcoma cells.42 In this case, it was shown that the RU486-bound GR is able to remodel chromatin and associate with chromatin-remodeling proteins. The submaximal response of RU486 relative to Dex (Figs. 3B 3C) is consistent with the RU486-bound GR’s being unable to recruit receptor coactivator proteins. Paradoxically, RU486 alone has been shown to lower IOP modestly in rabbit eyes,43 44 suggesting that it has glucocorticoid antagonist activity in vivo.

The final question addressed was whether the MYOC promoter directly mediates the Dex effect. We limited our examination of the MYOC promoter to the proximal promoter region (up to 2.8 kb), including various lengths of 5' untranslated region and MYOC coding region (up to 148 bp). Using the luciferase dual-reporter assay system we detected the highest basal activity for the p-235MYOC.Luc construct relative to the negative control p.Luc (Fig. 5B) . In agreement with our results, Shimizu et al.45 identified the sequence from -216 to +32 as conferring basal promoter activity to the MYOC gene, and Tomarev et al.46 found the -234/+54 and -1062/+54 MYOC promoter fragments to be significantly active. It should be noted that we were unable to generate upregulation of luciferase activity with Dex treatment with any of the MYOC promoter constructs examined (Fig. 5B) . The absence of steroid responsiveness of the two longer MYOC promoter constructs may be due to shortcomings in their construction. The -2488/-18 promoter fragment was created from a SacI restriction fragment and, as a result, part of the transcription start site was truncated, which may explain the near-background activity level. The -2778/+210 promoter fragment effectively expresses a fusion protein with the reporter, which may compromise reporter activity; however, this is probably active because of the higher than background reporter activity. Nonetheless, our data agree with Kirstein et al.47 who failed to find a functional GRE in the human MYOC region -1065/+67 in transiently transfected, transformed murine TM cells and primary human TM cells.

Another possible explanation of our results is that TM5 cells are deficient in GR-signaling; therefore, we included a positive control containing a synthetic GRE coupled to a minimal promoter (pGRE.Luc, Fig. 5A ). pGRE.Luc was active and responded to Dex in a dose-dependent manner with an EC50 of 4.4 nM, thus providing evidence for an intact GR-signaling system in TM5 cells. We were unable to detect endogenous MYOC mRNA, with or without Dex, by quantitative PCR in the TM5 cells used in these studies, even with extended 10- to 14-day incubations (data not shown). This indicates that an intact GR signaling system is insufficient to activate endogenous MYOC or the MYOC promoter constructs examined in TM5 cells. Additional MYOC promoter elements and/or transcription factors are probably necessary for Dex stimulation and may be located at relatively long distances from the transcription start site.48 Future experiments will attempt to examine MYOC promoter–luciferase reporter constructs in MYOC-expressing primary TM cells. Analysis of the MYOC coding and promoter regions failed to find any association of mutations in steroid-induced ocular hypertension and in patients with steroid-induced glaucoma.49 50

Previous reports have indicated four GREs and two nGREs within the proximal 2.5-kb promoter region.7 Kubota et al.26 identified a putative GRE (TGTTCT) at -258/-253 (relative to the translation start site) which overlapped with the palindromic sequence (TTCTTTTTAAAAAGAA). In contrast, Fingert et al.,28 identified no classic GREs (AGAACAnnnTGTTCT) up to 1900 nt upstream of the translation start site, and we identified none within 5000 bp of the 5'-flanking region and all of exon 1. Some genes are regulated by GRE half-sites,51 52 53 54 and several GRE half-sites with one or two mismatches were identified by Fingert et al. in the 1900 bp upstream of the putative translation start site.28 However, our current evidence regarding TM5 cells does not support functionality for any of these elements.

Secondary glucocorticoid-activated transcription factor binding sites may be involved in the glucocorticoid responsiveness of MYOC as, for example, with primary C/EBP activation of secondary arginase gene expression.25 Alternatively, it is possible that the unusual and heterogenous arrangement of potential GR-binding GRE half sites located in the MYOC promoter may be responsible for the delayed secondary glucocorticoid response similar to that seen in the rat {alpha}2u-globulin gene.53 However, it is unlikely that the GRE half sites present in the 2.8-kb of 5'-flanking region described herein are sufficient to respond to glucocorticoids. Another secondary glucocorticoid response gene, rat {alpha}1-acid glycoprotein (AGP), contains a GRE (ACAXXXTGTTCT) that binds GR, is CHX sensitive, and is required for the secondary response.55 Of interest, the MYOC promoter contains a highly homologous sequence at -4458/-4469 (tCACAATGTTCT).

A sequence variant within a 200-bp fragment of the 5-kb MYOC promoter has been reported to bind a glucocorticoid-induced DNA binding protein in TM cells and to segregate with steroid responders versus nonresponders.56 However, neither the exact nucleotide sequence of this polymorphism nor the character of this binding protein was described by the investigators. Whether this polymorphism is truly indicative of steroid responsiveness remains to be seen. An extensive study of the MYOC coding sequence and 1 kb of the MYOC promoter failed to find any polymorphisms that were prominent in steroid-responsive human patients or monkeys.49 50

Our results showing a delayed secondary glucocorticoid response on MYOC transcription indicate a GR-mediated event. At least two possibilities may explain the delayed secondary responsiveness: GR activates a primary response gene whose gene product in turn secondarily activates MYOC (Fig. 6) or GR binds directly to the MYOC promoter’s yet to be identified delayed secondary GREs.53 55 Understanding the mechanism for glucocorticoid-induced MYOC gene transcription will shed new light on our understanding of steroid-induced glaucoma and on the regulation of expression of this glaucoma gene.


   Footnotes
 
Supported by National Eye Institute Grant EY-10564 (VCS, EMS) and Alcon Research, Ltd.

Submitted for publication February 8, 2001; revised July 30, 2001; accepted September 5, 2001.

Commercial relationships policy: E (ARS, NJ, AFC); F (EMS); N (JHF, VCS).

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Abbot F. Clark, Glaucoma Research R2-41, Alcon Research, Ltd., 6201 South Freeway, Fort Worth, TX 76134-2099. abe.clark{at}alconlabs.com


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Becker, B, Mills, DW (1963) Corticosteroids and intraocular pressure Arch Ophthalmol 70,500-507
  2. Armaly, MF (1963) Effect of corticosteroids on intraocular and fluid dynamics Arch Ophthalmol 70,482-491
  3. Kass, MA, Johnson, T. (1989) Corticosteroid-induced glaucoma Ritch, R Shields, MB Krupin, T eds. The Glaucomas ,1161-1168 CV Mosby St. Louis.
  4. Bernstein, NH, Schwartz, B. (1962) Effects of long-term systemic steroids on ocular pressure and tonographic values Arch Ophthalmol 68,742-753
  5. Hovland, KR, Ellis, PP (1967) Ocular changes in renal transplant patients Am J Ophthalmol 63,283-289[Medline][Order article via Infotrieve]
  6. Tamm, ER, Russell, P, Epstein, DL, Johnson, DH, Piatigorsky, J. (1999) Modulation of myocilin/TIGR expression in human trabecular meshwork Invest Ophthalmol Vis Sci 40,2577-2582[Abstract/Free Full Text]
  7. Nguyen, TD, Chen, P, Huang, WD, Chen, H, Johnson, D, Polansky, JR (1998) Gene structure and properties of TIGR, an olfactomedin-related glycoprotein cloned from glucocorticoid-induced trabecular meshwork cells J Biol Chem 273,6341-6350[Abstract/Free Full Text]
  8. Polansky, JR, Fauss, DJ, Chen, P, et al (1997) Cellular pharmacology and molecular biology of the trabecular meshwork inducible glucocorticoid response gene product Ophthalmologica 211,126-139[Medline][Order article via Infotrieve]
  9. Wang, X, Johnson, DH (2000) mRNA in situ hybridization of TIGR/MYOC in human trabecular meshwork Invest Ophthalmol Vis Sci 41,1724-1729[Abstract/Free Full Text]
  10. O’Brien, TE, Metheney, CD, Polansky, JR (1999) Immunofluorescence method for quantifying the trabecular meshwork glucocorticoid response (TIGR) protein in trabecular meshwork and Schlemm’s canal cells Curr Eye Res 19,517-524[Medline][Order article via Infotrieve]
  11. Alward, WL, Fingert, JH, Coote, MA, et al (1998) Clinical features associated with mutations in the chromosome 1 open-angle glaucoma gene (GLC1A) [see comments] N Engl J Med 338,1022-1027[Abstract/Free Full Text]
  12. Fingert, JH, Heon, E, Liebmann, JM, et al (1999) Analysis of myocilin mutations in 1703 glaucoma patients from five different populations Hum Mol Genet 8,899-905[Abstract/Free Full Text]
  13. Stone, EM, Fingert, JH, Alward, WLM, et al (1997) Identification of a gene that causes primary open angle glaucoma (see comments) Science 275,668-670[Abstract/Free Full Text]
  14. Polansky, JR, Kurtz, RM, Fauss, DJ, Kim, RY, Bloom, E. (1991) In vitro correlates of glucocorticoid effects on intraocular pressure Krieglestein, GK eds. Glaucoma Update IV ,20-29 Springer-Verlag Berlin.
  15. Polansky, JR (1993) HTM cell culture model for steroid effects on IOP: Overview Lütjen-Drecoll, E eds. Basic Aspects of Glaucoma Research III ,307-318 Schattauer Stuttgart.
  16. McGhee, CN, Watson, DG, Midgley, JM, Noble, MJ, Dutton, GN, Fern, AI (1990) Penetration of synthetic corticosteroids into human aqueous humour Eye 4,526-530
  17. Francois, J. (1954) Cortisone et tension oculaire Ann Ocul 187,805-816
  18. Goldmann, H. (1962) Cortisone glaucoma Arch Ophthalmol 68,621-626
  19. Armaly, MF (1963) The effects of corticosteroids on intraocular pressure and fluid dynamics. II: the effect of dexamethasone in the glaucomatous eye Arch Ophthalmol 70,492-499
  20. Becker, B, Hahn, KA (1964) Topical corticosteroids and heredity in glaucoma Am J Ophthalmol 57,543-551[Medline][Order article via Infotrieve]
  21. Paterson, G. (1966) Studies on the response to topical dexamethasone of glaucoma relatives Trans Ophthalmol Soc UK 85,295-305
  22. Bartlett, JD, Woolley, TW, Adams, CM (1993) Identification of high intraocular pressure responders to topical ophthalmic corticosteroids J Ocul Pharmacol 9,35-45[Medline][Order article via Infotrieve]
  23. Weinreb, RN, Bloom, E, Baxter, JD, et al (1981) Detection of glucocorticoid receptors in cultured human trabecular cells Invest Ophthalmol Vis Sci 21,403-407[Abstract/Free Full Text]
  24. Matsuno, F, Chowdhury, S, Gotoh, T, et al (1996) Induction of the C/EBP beta gene by dexamethasone and glucagon in primary-cultured rat hepatocytes J Biochem (Tokyo) 119,524-532[Abstract/Free Full Text]
  25. Gotoh, T, Chowdhury, S, Takiguchi, M, Mori, M. (1997) The glucocorticoid-responsive gene cascade: activation of the rat arginase gene through induction of C/EBPbeta J Biol Chem 272,3694-3698[Abstract/Free Full Text]
  26. Kubota, R, Kudoh, J, Mashima, Y, et al (1998) Genomic organization of the human myocilin gene (MYOC) responsible for primary open angle glaucoma (GLC1A) Biochem Biophys Res Commun 242,396-400[Medline][Order article via Infotrieve]
  27. Adam, MF, Belmouden, A, Binisti, P, et al (1997) Recurrent mutations in a single exon encoding the evolutionarily conserved olfactomedin-homology domain of TIGR in familial open-angle glaucoma Hum Mol Genet 6,2091-2097[Abstract/Free Full Text]
  28. Fingert, JH, Ying, L, Swiderski, RE, et al (1998) Characterization and comparison of the human and mouse GLC1A glaucoma genes Genome Res 8,377-384[Abstract/Free Full Text]
  29. Wilson, K, McCartney, MD, Miggans, ST, Clark, AF (1993) Dexamethasone induced ultrastructural changes in cultured human trabecular meshwork cells Curr Eye Res 12,783-793[Medline][Order article via Infotrieve]
  30. Clark, AF, Wilson, K, McCartney, MD, Miggans, ST, Kunkle, M, Howe, W. (1994) Glucocorticoid-induced formation of cross-linked actin networks in cultured human trabecular meshwork cells Invest Ophthalmol Vis Sci 35,281-294[Abstract/Free Full Text]
  31. Steely, HT, Browder, SL, Julian, MB, Miggans, ST, Wilson, KL, Clark, AF (1992) The effects of dexamethasone on fibronectin expression in cultured human trabecular meshwork cells Invest Ophthalmol Vis Sci 33,2242-2250[Abstract/Free Full Text]
  32. Dickerson, JE, Jr, Steely, HT, Jr, English-Wright, SL, Clark, AF (1998) The effect of dexamethasone on integrin and laminin expression in cultured human trabecular meshwork cells Exp Eye Res 66,731-738[Medline][Order article via Infotrieve]
  33. Pang, IH, Shade, DL, Clark, AF, Steely, HT, DeSantis, L. (1994) Preliminary characterization of a transformed cell strain derived from human trabecular meshwork Curr Eye Res 13,51-63[Medline][Order article via Infotrieve]
  34. Stamer, DW, Roberts, BC, Epstein, DL, Allingham, RR (2000) Isolation of primary open-angle glaucomatous trabecular meshwork cells from whole eye tissue Curr Eye Res 20,347-350[Medline][Order article via Infotrieve]
  35. Jacobson, N, Andrews, M, Shepard, AR, et al (2001) Non-secretion of mutant proteins of the glaucoma gene myocilin in cultured trabecular meshwork cells and in aqueous humor Hum Mol Genet 10,117-125[Abstract/Free Full Text]
  36. Bodwell, J, Swiff, F, Richardson, J. (1999) Long duration electroporation for achieving high level expression of glucocorticoid receptors in mammalian cell lines J Steroid Biochem Mol Biol 68,77-82[Medline][Order article via Infotrieve]
  37. Finnegan, MC, Goepel, JR, Hancock, BW, Goyns, MH (1993) Investigation of the expression of housekeeping genes in non-Hodgkin’s lymphoma Leuk Lymphoma 10,387-393[Medline][Order article via Infotrieve]
  38. Savonet, V, Maenhaut, C, Miot, F, Pirson, I. (1997) Pitfalls in the use of several "housekeeping" genes as standards for quantitation of mRNA: the example of thyroid cells Anal Biochem 247,165-167[Medline][Order article via Infotrieve]
  39. Ringold, GM, Yamamoto, KR, Tomkins, GM, Bishop, M, Varmus, HE (1975) Dexamethasone-mediated induction of mouse mammary tumor virus RNA: a system for studying glucocorticoid action Cell 6,299-305[Medline][Order article via Infotrieve]
  40. Baumann, H, Firestone, GL, Burgess, TL, Gross, KW, Yamamoto, KR, Held, WA (1983) Dexamethasone regulation of alpha 1-acid glycoprotein and other acute phase reactants in rat liver and hepatoma cells J Biol Chem 258,563-570[Free Full Text]
  41. Lemberger, T, Staels, B, Saladin, R, Desvergne, B, Auwerx, J, Wahli, W. (1994) Regulation of the peroxisome proliferator-activated receptor alpha gene by glucocorticoids J Biol Chem 269,24527-24530[Abstract/Free Full Text]
  42. Fryer, CJ, Kinyamu, HK, Rogatsky, I, Garabedian, MJ, Archer, TK (2000) Selective activation of the glucocorticoid receptor by steroid antagonists in human breast cancer and osteosarcoma cells J Biol Chem 275,17771-17777[Abstract/Free Full Text]
  43. Green, K, Phillips, CI, Gore, SM, Elijah, RD, Bowman, KA, Cullen, P. (1985) Ocular fluid dynamics response to topical RU486, a steroid blocker Curr Eye Res 4,605-612[Medline][Order article via Infotrieve]
  44. Tsukahara, S, Sasaki, T, Phillips, CI, Gore, SM (1986) Subconjunctival suspension of RU486 lowers intraocular pressure in normal rabbits Br J Ophthalmol 70,451-455[Abstract/Free Full Text]
  45. Shimizu, S, Higashi, M, Thompson, DA, Richards, JE (1999) Promoter analysis of the TIGR/MYOC gene [ARVO Abstract] Invest Ophthalmol Vis Sci 40(4),S77Abstract nr 414
  46. Tomarev, SI, Mertts, M, Garfield, S, Tanemoto, K. (1999) Mouse and human MYOC/TIGR genes: analysis of the promoter activity and properties of the encoded proteins [ARVO Abstract] Invest Ophthalmol Vis Sci 40(4),S597Abstract nr 3133
  47. Kirstein, L, Cvekl, A, Chauhan, BK, Tamm, ER (2000) Regulation of human myocilin/TIGR gene transcription in trabecular meshwork cells and astrocytes: role of upstream stimulatory factor Genes Cells 5,661-676[Abstract]
  48. Chandler, VL, Maler, BA, Yamamoto, KR (1983) DNA sequences bound specifically by glucocorticoid receptor in vitro render a heterologous promoter hormone responsive in vivo Cell 33,489-499[Medline][Order article via Infotrieve]
  49. Fingert, JH, Clark, AF, Craig, JE, et al (2001) Evaluation of the myocilin (MYOC) glaucoma gene in monkey and human steroid-induced ocular hypertension Invest Ophthalmol Vis Sci 42,145-152[Abstract/Free Full Text]
  50. Kee, C, Ahn, BH (1997) TIGR gene in primary open-angle glaucoma and steroid-induced glaucoma Korean J Ophthalmol 11,75-78[Medline][Order article via Infotrieve]
  51. Yamamoto, KR (1985) Steroid receptor regulated transcription of specific genes and gene networks Annu Rev Genet 19,209-252[Medline][Order article via Infotrieve]
  52. Payvar, F, DeFranco, D, Firestone, GL, et al (1983) Sequence-specific binding of glucocorticoid receptor to MTV DNA at sites within and upstream of the transcribed region Cell 35,381-392[Medline][Order article via Infotrieve]
  53. Chan, GC, Hess, P, Meenakshi, T, Carlstedt-Duke, J, Gustafsson, JA, Payvar, F. (1991) Delayed secondary glucocorticoid response elements: unusual nucleotide motifs specify glucocorticoid receptor binding to transcribed regions of alpha 2u-globulin DNA J Biol Chem 266,22634-22644[Abstract/Free Full Text]
  54. Nordeen, SK, Suh, BJ, Kuhnel, B, Hutchison, CD (1990) Structural determinants of a glucocorticoid receptor recognition element Mol Endocrinol 4,1866-1873[Medline][Order article via Infotrieve]
  55. Klein, ES, DiLorenzo, D, Posseckert, G, Beato, M, Ringold, GM (1988) Sequences downstream of the glucocorticoid regulatory element mediate cycloheximide inhibition of steroid induced expression from the rat alpha 1-acid glycoprotein promoter: evidence for a labile transcription factor Mol Endocrinol 2,1343-1351[Medline][Order article via Infotrieve]
  56. Chen, H, Kitazawa, Y, Kawase, K, Shirato, S, Polansky, JR, Nguyen, TD (1999) Identification of a promoter sequence variant in steroid responders and evidence for a glucocorticoid-induced DNA binding protein of the TIGR gene in TM cells [ARVO Abstract] Invest Ophthalmol Vis Sci 40(4),S505Abstract nr 2666



This article has been cited by other articles:


Home page
 Hum Mol GenetHome page
A. R. Shepard, N. Jacobson, J. C. Millar, I.-H. Pang, H. T. Steely, C. C. Searby, V. C. Sheffield, E. M. Stone, and A. F. Clark
Glaucoma-causing myocilin mutants require the Peroxisomal targeting signal-1 receptor (PTS1R) to elevate intraocular pressure
Hum. Mol. Genet., March 15, 2007; 16(6): 609 - 617.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
M. P. Fautsch, C. K. Bahler, A. M. Vrabel, K. G. Howell, N. Loewen, W. L. Teo, E. M. Poeschla, and D. H. Johnson
Perfusion of His-Tagged Eukaryotic Myocilin Increases Outflow Resistance in Human Anterior Segments in the Presence of Aqueous Humor
Invest. Ophthalmol. Vis. Sci., January 1, 2006; 47(1): 213 - 221.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
X. Zhang, A. F. Clark, and T. Yorio
Regulation of Glucocorticoid Responsiveness in Glaucomatous Trabecular Meshwork Cells by Glucocorticoid Receptor-{beta}
Invest. Ophthalmol. Vis. Sci., December 1, 2005; 46(12): 4607 - 4616.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
O. Grinchuk, Z. Kozmik, X. Wu, and S. Tomarev
The Optimedin Gene Is a Downstream Target of Pax6
J. Biol. Chem., October 21, 2005; 280(42): 35228 - 35237.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
D. B. Gould, L. Miceli-Libby, O. V. Savinova, M. Torrado, S. I. Tomarev, R. S. Smith, and S. W. M. John
Genetically Increasing Myoc Expression Supports a Necessary Pathologic Role of Abnormal Proteins in Glaucoma
Mol. Cell. Biol., October 15, 2004; 24(20): 9019 - 9025.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
X. Zhang, A. F. Clark, and T. Yorio
Interactions of Endothelin-1 with Dexamethasone in Primary Cultured Human Trabecular Meshwork Cells
Invest. Ophthalmol. Vis. Sci., December 1, 2003; 44(12): 5301 - 5308.
[Abstract] [Full Text] [PDF]

Home page
 Arch OphthalmolHome page
D. S. P. Fan, C. B. O. Yu, T. Y. H. Chiu, C. Y. Wong, J. S. K. Ng, C. P. Pang, and D. S. C. Lam
Ocular-Hypertensive and Anti-inflammatory Response to Rimexolone Therapy in Children
Arch Ophthalmol, December 1, 2003; 121(12): 1716 - 1721.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shepard, A. R.
Right arrow Articles by Clark, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shepard, A. R.
Right arrow Articles by Clark, A. F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS