| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 From the Department of Cell Biology 2 Immunology, The Scripps Research Institute, La Jolla, California 3 Jules Stein Eye Institute at University of California, Los Angeles.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
METHODS. The members of the ERK pathway in the lens were examined by Western
blotting, immunohistochemical staining, and kinase assay. A
gain-of-function approach was used to perturb the ERK pathway in the
lenses of transgenic mice via expression of a constitutively active
mutant of the mitogen-activated protein kinase kinase 1 (MEK1(E)), the
direct upstream kinase of the ERK1 and ERK2 kinases, under the
A-crystallin promoter.
RESULTS. The presence of an active ERK pathway was found in lens epithelial cells and in differentiating fibers. Transgenic mice that expressed MEK1(E) developed postnatal cataracts as well as macrophthalmia. Distinct morphologic alterations, such as lens enlargement, swelling fiber cells, enlarged extracellular space, and vacuole formation, were observed in the lenses of these transgenic mice. A significant increase in the glucose transporter 1 (GLUT1) level, as well as in the glucose level, was detected in the lens.
CONCLUSIONS. The MAP kinase pathway is involved in the regulation of glucose metabolism and balance in the mouse lens. Moreover, the alteration of MAP kinase activity in the lens is sufficient to cause cataract formation with enlarged extracellular space and vacuoles in the differentiating fibers. This transgenic mouse may provide a useful model for understanding the mechanism(s) for some aspects of human cataracts.
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cataracts are the opacification of the lens that causes impaired vision, and they are still the major cause of blindness in humans. Although cataracts appear mostly in elderly populations as an effect of aging or environmental and nutritional stresses, lens opacities may develop rapidly as a consequence of metabolic diseases, such as diabetes.4 Many studies have attempted to understand diabetic cataracts through the use of a variety of animal or cell models, generated by special dietary administration of different sugars or other chemical reagents with various methods.5 6 7 The limitation of these approaches is that they cannot determine whether the initiation event for the alteration of glucose metabolism in the lens is due solely to an elevated intracellular glucose level or whether it is the result of some other event occurring simultaneously, such as an activation of intracellular signaling pathways.8 9 In particular, it is known that an elevated glucose level in the blood precedes the appearance of diabetic cataracts in human patients.6
There is evidence that the mitogen-activated protein (MAP) kinase plays an essential role in controlling cell proliferation, differentiation, and many other cellular responses in a variety of biological systems.10 The ERK pathway is normally referred to as the classic MAP kinase pathway,10 11 and it has been reported to be activated by UV radiation, oxidants, high glucose levels, shock, and cytokines.12 13 There is evidence suggesting that some of these environmental stresses are the risk factors for causing human senile or diabetic cataracts.5 6 7 Thus, we have hypothesized that MAP kinase pathways play a role in normal lens development and in pathologic responses to environmental stresses. Furthermore, the MAP kinases are likely to be the downstream signaling members of the growth factors.
Perturbation of the FGF signaling pathway via overexpression of
FGFs14
15
16
or dominant-negative
receptors17
18
resulted in microphthalmia with alterations
in lens epithelial cells and fiber cells in mice. However, the
intracellular signaling pathways that mediate these growth factors in
the lens are not well understood.19
To explore the role of
the ERK pathway in the lens and to try to mimic a chronic activation of
it under environmental stresses during a lifetime, we have selected a
gain-of-function approach through an expression in transgenic mice of a
constitutively active mutant MEK1(E) kinase, driven to the lens by the
A-crystallin promoter. The MEK1(E) kinase is the direct upstream
kinase of the ERK1 and ERK2 kinases.
The present report demonstrates that the expression of MEK1(E) in transgenic mice is associated with severe impairment of the glucose level and/or glucose transport in the lens. This metabolic stress is associated with macrophthalmia and lens opacities that are similar to some aspects of human cataracts.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Generation of Transgenic Mice
The constructs that express a constitutively active form of
kinases under the control of the A-crystallin gene
promoter20
21
were generated and injected into
fertilized embryos of the inbred C57BL/6J strain to produce the
transgenic founder mice (F0).
Rat MEK1(E) cDNAs that encode constitutively active kinases were
provided by Jiahuai Han. MEK1(E) cDNA encodes a constitutively active
form of MEK1 by replacement of both serine residues (Ser-218 and
Ser-222) with glutamic acid residues to mimic phosphorylation in the
activated form.22
The MEK1(E) cDNA (1.2 kb) was subcloned
into the CPV2 expression vector provided by Paul Overbeek at Baylor
College of Medicine.23
A 2.5-kb fragment containing an
A-promoter-MEK1(E)-SV40pA region was used to generate the transgenic
mice.
A PCR method was used to detect the transgene from mouse tail DNA. The 5' primer is an oligo Ap (CCCAGAGGCTCCTGTCTGAC 1917–1936 bp of GenBank accession no. S79462). The 3' primer for MEK1(E) is an oligo K1p (TGTGCTCCATGCAGATGCTG 436–417 of GenBank accession no. D14591). A 550-bp PCR fragment was detected from the tail DNA of CPV2-MEK1 transgenic mice by using this pair of primers, as indicated in Figure 1A .
|
Antibodies against MEK1, MEK2, ERK1, ERK2, GLUT1, GLUT3, and CIC-3 were
purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The
antibodies against the phosphorylated forms of ERK1/2, p38, and JNK1/2
were purchased from New England Biolabs (Beverly, MA). The antibodies
against phospho-tyrosine were purchased from Signal Transduction.
Antibodies against 3 connexin (Cx46),
8 connexin (Cx50), MP26, and MP20 were rabbit
polyclonal antibodies.
Kinase Assay
Lens homogenized samples were prepared from the decapsulated
lenses and examined for their kinase activities. Nonradioactive kinase
activity assay kits for ERK1 and ERK2 kinases were purchased from New
England Biolabs, Inc. The experimental procedures were performed
according to the protocol provided by the manufacturer. Active ERKs
phosphorylated an Elk-1 fusion protein in the presence of ATP and
kinase buffer. Phosphorylation of Elk at Ser383 was measured through
Western blot analysis, using a phospho-Elk-1 (Ser383) antibody
provided in the kit.
Histologic Analysis and Immunohistochemical Staining
The hematoxylin and eosin–stained sections were prepared from
these mouse eyes by standard methods.24
Similarly,
standard methods were used for the antibody staining of the frozen lens
sections.24
A laser-confocal microscope (model 1024;
BioRad, Hercules, CA) was used to collect the staining results.
Transmission Electron Microscopic Analysis
Mouse lenses were fixed in 2.5% gluteraldehyde with 0.075 M of
cacodylate buffer, pH 7.2, overnight at 4°C. The fixative was changed
daily for a total fixation time of 5 days at 4°C. After extensive
washes in 0.1 M cacodylate buffer, lenses were post-fixed in 1%
OsO4 for 1 hour at room temperature, stained with
0.5% tannic acid/0.05 M cacodylate buffer for 1 hour, and neutralized
with 1% Na2SO4 in 0.1 M
cacodylate buffer for 15 minutes. Lenses were then stained en bloc with
1% uranyl acetate/10% ethanol for 15 minutes and further dehydrated
in a standard ethanol series with two changes of 95% and 100%.
Ethanol was exchanged with HPMA and lenses were infiltrated overnight
in a 1:1 ratio of HPMA/LX112 (Ladd Scientific, Burlington, VT) mixture
while rotating. Lenses were embedded in LX112 after one change of 100%
LX112 for 4 hours and polymerized for 24 to 36 hours at 60°C. Sample
blocks were sectioned at 70 to 80 nm. Each grid was contrasted with
uranyl acetate and lead citrate before transmission electron
microscopic (TEM) inspection.
Measurement of Lens Glucose Concentration
Two lenses from one mouse were deproteinized by homogenization
with 150 µl of perchloric acid solution (6%
HClO4), followed by centrifugation at 13,000 rpm
for 10 minutes at 4°C. The supernatants were neutralized with 35 µl
of 2 M K2CO3 followed by
centrifugation at 13,000 rpm for 10 minutes at 4°C. One hundred
microliters of the neutralized supernatant per sample was used for
assaying the glucose amount according to the procedure provided by the
manufacture (diagnostic glucose [HK] 10 kit; Sigma, St. Louis, MO).
The lens glucose concentration was calculated from the glucose amount
(per lens) and its volume. Because the mouse lens is almost like a
sphere, we calculated the lens volume, 1/6
D3, as if it were a sphere, using
the equatorial diameter (D).
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
MEK2, ERK1, and ERK2 proteins, as well as the phosphorylated (active) forms of ERK1 and ERK2, were detected in the homogenates of the total lens and lens cortex by Western blotting (Fig. 1A , lanes 1 and 2). The ERK2 protein was found in the lens nuclear homogenate, but no phosphorylated forms of ERK2, ERK1 and MEK2 were detected (Fig. 1A , lane 3). The endogenous MEK1 was undetectable in these homogenates through Western blotting, using an anti-MEK1 antibody that recognized both MEK1 and active mutant MEK1(E) proteins (see Fig. 6 , the MEK1(E) panel).
|
Generation and Characterization of the MEK1(E) Transgenic Mice
Six MEK1(E) transgenic founder mice were generated (Fig. 2A
). These founder mice were mated with wild-type
C57BL/6J mice to generate F1 transgenic mice. F2 mice were generated
from either an inter-cross between the F1 transgenic mice or an
inter-cross between the F1 transgenic mice and F1 wild-type mice. The
F1 and F2 mice from three independent founder lines, 7, 20, and 14,
were used for various analyses.
|
Moreover, the MEK1(E) protein was detected in the differentiating fibers by immunohistochemical staining, using an anti-MEK1 antibody (Fig. 2Cb) . This is the same anti-MEK1 antibody used for detecting the endogenous MEK1 in the lens epithelial cells in Figure 1C and for the Western blotting. The positive signal in the epithelial cells of the MEK1(E) transgenic mice (indicated by an arrow in the Fig. 2Cb ) is relatively lower than that of the wild-type control (shown in 1B), and this is due to the fact that a very intense and diffuse fluorescent signal of the transgene product MEK1(E) was detected in the cytosol of adjacent fiber cells.
These results indicate that the presence of MEK1(E) causes both an elevation in ERK kinase activity and an alteration in the phospho-tyrosine proteins in the mouse lenses.
Postnatal Development of Cataracts and Macrophthalmia in MEK1(E)
Transgenic Mice
In comparison to the lenses of their wild-type littermates, all
the transgenic mice postnatally developed macrophthalmia with
cataracts. The offspring of the transgenic mouse lines 7 and 20 were
used for the phenotypic analysis.
The increase in the size of the eyeball (Fig. 3C ) and the development of enlarged cataractous lenses (Figs. 3A 3B) can be observed by direct visual examination. Vacuole formation in the lens cortex varied among individual transgenic mice. Disrupted fibers were observed only in the lens cortex of the MEK1(E) transgenic lenses (Fig. 3D) . No dramatic lens morphologic changes were detected in 1-day-old transgenic lenses when compared with the wild-type lenses (Figs. 4A 4B ), although a few swollen fibers with no vacuoles were observed in the 1-day-old transgenic lenses (data not shown). However, in a 5-week-old transgenic lens, a number of cytoplasmic vacuoles, or enlarged intercellular spaces, were observed in cortical regions (Fig. 4D) . These vacuoles first appeared in the bow regions of the equator and then spread to the anterior side (Fig. 4F) . Furthermore, both enlarged extracellular space and vacuoles were detected in MEK1(E) lens fibers by TEM analysis (Fig. 5) . No obvious morphologic changes in the lens epithelial cells were observed in the transgenic mice (data not shown). In the 3- to 4-week-old transgenic mice, the other tissues of the eye, including the retina and the cornea, did not show obvious pathologic features aside from an enlargement, which was true of the whole eyeball. No swollen fibers or vacuoles appeared in the lens sections of the wild-type littermates (Figs. 4C 4E) .
|
|
|
|
|
Water-soluble homogenates were prepared from the lenses of both
transgenic and wild-type mice at the ages of 2 weeks, 4 weeks, and 2.5
months and were then studied by gel filtration analysis. No obvious
changes in the distribution of -, ß-, and 
-crystallins were
found in the samples from transgenic lenses of 2- to 4-week-old mice
when compared with that of wild-type mice at the same age. A
representative result is shown (Fig. 6E)
. However, a significant loss
of -crystallin was found in the sample of 2.5-month-old transgenic
lenses with nuclear cataracts (Fig. 6F)
.
Selective Upregulation of GLUT1 and an Elevated Glucose Level in
MEK1(E) Transgenic Lenses
We have found that lens-specific expression of the MEK1(E)
led to an approximately twofold increase in the phosphorylated ERK1 and
ERK2 kinase (pERK), as well as in their kinase activities (measured via
pELK-1; Fig. 7A
). These results were determined by densitometric measurements from
more than three sets of experiments. No detectable changes in the other
MAP kinases, such as the MEK2 kinase, the phosphorylated form of p38
kinase, or the phosphorylated form of c-Jun N-terminal kinase 1
(pJNK1), were found in the MEK1(E) lens homogenates by Western blotting
(Fig. 7A)
. Similarly, there were no detectable changes in the levels of
several major lens membrane proteins, including MP26, MP20, connexin
3 and 8, and the
chloride channel CIC3 (Fig. 7A)
. However, we have found that there was
at least a fourfold increase in the glucose transporter 1 (GLUT1)
protein level in the decapsulated MEK1(E) lens homogenates when
compared with that in the wild-type controls. This was determined
through a densitometric analysis from Western blot results of six sets
of experiments. This increase in the GLUT1 level was also detected in
lens samples of 2-week-old MEK1(E) mice (data not shown). No detectable
change in the glucose transporter 3 (GLUT3) protein level was observed
(Fig. 7A)
. There was a more than 80% increase in the glucose level in
the MEK1(E) lenses when compared with that in the wild-type mice (Fig. 7B)
.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
It is noteworthy that active forms of ERK1 and ERK2 were found in both
the lens epithelial cells and in the differentiating fiber cells,
suggesting that mitogen-activated protein kinases operate in a lens
domain where the maintenance of the electrochemical gradient across the
lens is actively regulated. In this study, we have selected a
constitutively active mutant of MEK1(E) instead of an active mutant of
MEK2 to activate the ERK pathway in the lens. This is for three
reasons: (1) MEK1 and MEK2 are equivalent in terms of the activation of
ERKs; (2) we can distinguish the transgene MEK1(E) from the endogenous
MEK2 in the lens fibers by Western blotting; and (3) the endogenous
MEK1 in the lens fibers is undetectable by Western blotting. It is
striking that, in transgenic mice expressing MEK1(E) that was driven to
the lens by the A-crystallin promoter, cataracts and macrophthalmia
developed. It is therefore likely that the lens-specific expression of
MEK1(E) and/or an elevated ERK pathway activity selectively alters
properties of downstream targets, including glucose metabolism and, in
turn, the cataract formation of the lens. Given the fact that the ERK
pathway plays an essential role in controlling cell proliferation and
differentiation, it is surprising that a disruption of secondary fiber
cells is the predominant defect in the MEK1(E) transgenic lenses. The
fact that there were no obvious changes in the lens epithelial cells
might be due to the absence of the MEK1(E) transgene product, because
the A-crystallin promoter has been reported to be inactive in the
epithelial cells.15
Currently, we do not know why we did
not observe any obvious defects in the primary fibers, where transgenes
should be expressed. Because we were unable to distinguish MEK1(E) from
endogenous MEK1 in these cells with anti-MEK1 antibodies, further
studies will be required for any interpretations about the primary
fibers of MEK1(E) lenses.
The question remains, however, whether the actual mechanism generating intra-cytoplasmic vacuoles and enlarged intercellular spaces is restricted to the cortical lens region. We assumed that water is retained in the lens cortical region in parallel with an increase in the pressure via an elevated level of ions and other osmolytes. The presence of extensive swelling of cytoplasmic membrane compartments and intercellular spaces would reflect dramatic changes in the function of specific membrane transporters in the cortical fibers of the transgenic lenses. It is likely that this transporter is one of the downstream targets of the ERK pathway, which regulates the balance in the cortical fibers of the lens. Several published articles have shown that similar cataracts were observed in lenses after they were treated with chloride channel blocker 5-nitro-2-(3-phenylpropylamin) benzoate (NPPB) and tamoxifen.31 32 Although there were no changes in the protein level of chloride channel CIC3 or in the water channel protein MP2633 in the MEK1(E) lens fibers, we still do not know whether their functions are normal. It has been reported that the MEK1 kinase may have an ERK-independent downstream pathway,34 although we have no evidence as of yet to show this novel pathway in the lens.
Glucose Transporter and Cataractogenesis
Diabetic cataract formation is associated with swelling fibers and
vacuole formation in the lens cortex, which subsequently cause nuclear
cataracts.6
Cataract formation in the MEK1(E) transgenic
mice, to a certain degree, resembled some of the lens pathologic
processes in diabetic cataractogenesis.
Our hypothesis is that the selective upregulation of GLUT1 partly
contributes to the lens phenotype of the MEK1(E) transgenic mice. An
elevated GLUT1 level could cause an increase in the influx of glucose
into the lens (the glucose level is 
1 mM)35
from the
aqueous or vitreous humor (15–30 mM).36
Subsequently,
an altered glucose metabolism in the lens cells can lead to an increase
in the sorbitol level via the reaction catalyzed by aldose
reductase,37
38
nonenzymatic modification of lens
proteins,6
and oxidative stress.7
All these
changes eventually induce cataract formation.
It was recently reported that GLUT1 is expressed and located in the epithelial cells and in the newly differentiating fiber cells.39 It has also been reported that the rate-limiting factor for the influx of glucose into the cells is dependent on the level of the glucose transporter in the plasma membrane in vivo and in vitro.40 An overexpression of GLUT1 in the muscle cells of transgenic mice caused an increase in the influx of glucose into these cells.41 Certain specific cis-elements in the GLUT1 gene promoter were responsible for the stimulation of the ERK pathway.42 Activation of the ERK pathway can stimulate expression of the GLUT1 gene in cardiac myocytes43 and adipose tissue.44 Therefore, it is likely that glucose transport and metabolism are regulated by the ERK pathway in the lens.
We may then hypothesize that the ERK pathway is involved in cataract formation. The high glucose levels not only cause an increase in the influx of glucose into the lens cells but also activate the ERK pathway. An elevated intracellular glucose level via activated ERK pathways is one of the factors for subsequent cataract formation. Certainly, the other downstream targets of the ERK pathways may also contribute to cataract formation in MEK1(E) transgenic mice. We are in the process of identifying these other downstream targets of the ERK pathway in the lens.
Regulation of Eye Size
The phenotype of the MEK1(E) transgenic mice, macrophthalmia with
cataractous lenses, is unique. Dozens of different transgenic mice have
been reported to develop various eye and/or lens phenotypes by using
the same A-crystallin promoter to express many different genes,
including FGF, FGF receptor,45
and myo-inositol
transporter.46
However, although some did develop
microphthalmia, neither these transgenic mice nor gene knockout
mice47
48
have been reported to develop macrophthalmia.
The factors that control the growth of the eyeball are largely unknown.49 There are human genetic diseases linked to macrophthalmia.50 A recently published article suggests that an enlarged eye could be the result of an increase in the embryonic eye field.51 However, the phenotype of the MEK1(E) transgenic mice suggest that the size of the eye may be postnatally regulated by the size of the lens. Therefore, there are at least two distinct mechanisms that control the growth of the eyeball.
In summary, we believe that the MEK1(E) transgenic mice may be useful for studying not only the molecular mechanism that controls cataract formation but also the mechanisms that control the size of the entire eye.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Submitted for publication May 10, 2000; revised October 27, 2000; accepted November 10, 2000.
Commercial relationships policy: N.
Corresponding author: Xiaohua Gong, Department of Cell Biology, MB6, The Scripps Institute, 10550 N. Torrey Pines Road, La Jolla, CA 92037. gong{at}scripps.edu
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  T. I. Shakespeare, C. Sellitto, L. Li, C. Rubinos, X. Gong, M. Srinivas, and T. W. White Interaction between Connexin50 and Mitogen-activated Protein Kinase Signaling in Lens Homeostasis Mol. Biol. Cell, May 15, 2009; 20(10): 2582 - 2592. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Corcelle, M. Nebout, S. Bekri, N. Gauthier, P. Hofman, P. Poujeol, P. Fenichel, and B. Mograbi Disruption of Autophagy at the Maturation Step by the Carcinogen Lindane Is Associated with the Sustained Mitogen-Activated Protein Kinase/Extracellular Signal-Regulated Kinase Activity. Cancer Res., July 1, 2006; 66(13): 6861 - 6870. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Rodriguez-Viciana, O. Tetsu, W. E. Tidyman, A. L. Estep, B. A. Conger, M. S. Cruz, F. McCormick, and K. A. Rauen Germline Mutations in Genes Within the MAPK Pathway Cause Cardio-facio-cutaneous Syndrome Science, March 3, 2006; 311(5765): 1287 - 1290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. W.-C. Li, J.-P. Liu, Y.-W. Mao, H. Xiang, J. Wang, W.-Y. Ma, Z. Dong, H. M. Pike, R. E. Brown, and J. C. Reed Calcium-activated RAF/MEK/ERK Signaling Pathway Mediates p53-dependent Apoptosis and Is Abrogated by {alpha}B-Crystallin through Inhibition of RAS Activation Mol. Biol. Cell, September 1, 2005; 16(9): 4437 - 4453. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, H. Feng, X.-Q. Huang, H. Xiang, Y.-W. Mao, J.-P. Liu, Q. Yan, W.-B. Liu, Y. Liu, M. Deng, et al. Human Telomerase Reverse Transcriptase Immortalizes Bovine Lens Epithelial Cells and Suppresses Differentiation through Regulation of the ERK Signaling Pathway J. Biol. Chem., June 17, 2005; 280(24): 22776 - 22787. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Chandrasekher and D. Sailaja Phosphatidylinositol 3-Kinase (PI-3K)/Akt but Not PI-3K/p70 S6 Kinase Signaling Mediates IGF-1-Promoted Lens Epithelial Cell Survival Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3577 - 3588. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Sellitto, L. Li, and T. W. White Connexin50 Is Essential for Normal Postnatal Lens Cell Proliferation Invest. Ophthalmol. Vis. Sci., September 1, 2004; 45(9): 3196 - 3202. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Golestaneh, J. Fan, R. N. Fariss, W.-K. Lo, P. S. Zelenka, and A. B. Chepelinsky Lens Major Intrinsic Protein (MIP)/Aquaporin 0 Expression in Rat Lens Epithelia Explants Requires Fibroblast Growth Factor-induced ERK and JNK Signaling J. Biol. Chem., July 23, 2004; 279(30): 31813 - 31822. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Zhou and A. S. Menko Coordinate Signaling by Src and p38 Kinases in the Induction of Cortical Cataracts Invest. Ophthalmol. Vis. Sci., July 1, 2004; 45(7): 2314 - 2323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Maidment, G. Duncan, S. Tamiya, D. J. Collison, L. Wang, and I. M. Wormstone Regional Differences in Tyrosine Kinase Receptor Signaling Components Determine Differential Growth Patterns in the Human Lens Invest. Ophthalmol. Vis. Sci., May 1, 2004; 45(5): 1427 - 1435. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. W.-C. Li, J.-P. Liu, J. Wang, Y.-W. Mao, and L.-H. Hou Expression and Activity of the Signaling Molecules for Mitogen-Activated Protein Kinase Pathways in Human, Bovine, and Rat Lenses Invest. Ophthalmol. Vis. Sci., December 1, 2003; 44(12): 5277 - 5286. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. R. Merriman-Smith, A. Krushinsky, J. Kistler, and P. J. Donaldson Expression Patterns for Glucose Transporters GLUT1 and GLUT3 in the Normal Rat Lens and in Models of Diabetic Cataract Invest. Ophthalmol. Vis. Sci., August 1, 2003; 44(8): 3458 - 3466. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. S. Zatechka Jr, P. F. Kador, S. Garcia-Castineiras, and M. F. Lou Diabetes Can Alter the Signal Transduction Pathways in the Lens of Rats Diabetes, April 1, 2003; 52(4): 1014 - 1022. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Wang, M. Zhao, J. V. Forrester, and C. D. McCaig Electric Fields and MAP Kinase Signaling Can Regulate Early Wound Healing in Lens Epithelium Invest. Ophthalmol. Vis. Sci., January 1, 2003; 44(1): 244 - 249. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Chang, X. Wang, N. L. Hawes, R. Ojakian, M. T. Davisson, W.-K. Lo, and X. Gong A Gja8 (Cx50) point mutation causes an alteration of {alpha}3 connexin (Cx46) in semi-dominant cataracts of Lop10 mice Hum. Mol. Genet., March 1, 2002; 11(5): 507 - 513. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
