IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakamura, T.
Right arrow Articles by Kinoshita, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakamura, T.
Right arrow Articles by Kinoshita, S.
(Investigative Ophthalmology and Visual Science. 2001;42:549-556.)
© 2001 by The Association for Research in Vision and Ophthalmology, Inc.

Elevated Expression of Transglutaminase 1 and Keratinization-Related Proteins in Conjunctiva in Severe Ocular Surface Disease

Takahiro Nakamura1, Kohji Nishida1, Atsuyoshi Dota1, Masato Matsuki2, Kiyofumi Yamanishi2 and Shigeru Kinoshita1

1 From the Departments of Ophthalmology and 2 Dermatology, Kyoto Prefectural University of Medicine, Japan.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. In severe ocular surface diseases, pathologic keratinization of the ordinarily nonkeratinized corneal and conjunctival mucosal epithelia results in severe visual loss. The expression in conjunctivalized corneas of various proteins known to play important roles in the physiological keratinization process in human epidermis was examined to better understand the mechanism of keratinization.

METHODS. Conjunctiva covering the cornea was examined in 12 eyes with ocular surface disease in the chronic cicatricial phase. These comprised four Stevens–Johnson syndrome, four ocular cicatricial pemphigoid, and four chemical injuries. Normal conjunctivas from four age-matched individuals served as controls. Semiquantitative reverse transcription–polymerase chain reaction (RT-PCR) was used to investigate transglutaminase 1 gene expression and immunohistochemistry to study the expression of transglutaminase 1 protein along with other keratinization-related proteins (involucrin, loricrin, filaggrin, and cytokeratins 1 and 10) and cytokeratin pairs 4/13 and 3/12.

RESULTS. Semiquantitative RT-PCR showed that transglutaminase 1 mRNA expression was upregulated in keratinized conjunctiva compared with normal. Also, in this tissue, immunohistochemistry demonstrated elevated levels of transglutaminase 1, involucrin, filaggrin, and the cytokeratin pair 1/10. Levels of loricrin and cytokeratin pairs 4/13 and 3/12, however, remained the same.

CONCLUSIONS. Various keratinization-related proteins, transglutaminase 1 included, are most likely involved in the pathogenesis of cicatrizing ocular surface diseases.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Severe ocular surface diseases such as Stevens–Johnson syndrome (SJS) and ocular cicatricial pemphigoid (OCP) are among the most challenging entities facing the clinician today.1 2 3 4 5 6 Conventional management is generally unsatisfactory, and long-term ocular consequences are devastating. During the chronic cicatricial phase, most patients with ocular surface disease and those with severe chemical injuries experience numerous ocular surface problems, including symblepharon, entropion, ectropion, trichiasis, xerophthalmia, persistent epithelial defect, persistent conjunctival inflammation, corneal vascularization (conjunctivalization), and pathologic keratinization. Some of these can be managed by the use of antibiotics, corticosteroids, immunosuppressants, and/or artificial tears. The pathologic keratinization of the ordinarily nonkeratinized corneal and conjunctival epithelium, however, is a serious and potentially debilitating problem that is difficult to manage pharmacologically.

The pathologic transition of nonkeratinized stratified epithelium (either secretory or nonsecretory) into nonsecretory keratinized epithelium is termed squamous metaplasia7 8 9 10 and is a process involving abnormal epithelial differentiation. In the human eye, squamous metaplasia is accompanied by the loss of goblet cells, an increase in cellular stratification, an enlargement of superficial cells, and keratinization.11 12 13 Squamous metaplasia has been described in a variety of ocular surface disorders including SJS, OCP, chemical injury, dry eye, Sjögren syndrome, and vitamin A deficiency9 10 11 12 13 14 15 ; however, despite numerous efforts, little is known about its pathogenesis.

Our group recently reported that transglutaminase 1 (keratinocyte transglutaminase; TGase 1) gene expression accompanies pathologic keratinization in severe SJS.16 In situ hybridization showed that TGase 1 mRNA is not expressed in normal ocular surface epithelia. It is expressed during the terminal differentiation of keratinocytes, where it helps form a cornified cell envelope,17 18 a structure that retards water loss through the epidermis and protects the internal milieu of the body against external mechanical stimuli, chemical injury, and biologic invasion. TGase 1 is an enzyme that catalyzes the formation of covalent cross-links between protein substrates, such as involucrin19 and loricrin,20 and plays an important role in the formation of the stratum corneum in skin.21 22

It has also been reported that squamous metaplasia secondary to alterations in the microenvironment is associated with changes in cytokeratin expression in several mucosae.23 24 25 Cytokeratins play an important structural and protective role in maintaining the integrity of the epithelium of the anterior segment of the eye.26 27 28 29 In vivo, cytokeratin filament systems are composed of type 1 (neutral-basic) and type 2 (acidic) obligate heterodimers that exist as specific pairs.29 Defined subsets of individual cytokeratin pairs are characteristically expressed depending on epithelial cell and tissue type, level of differentiation, or disease state. In the human epidermis, especially in the cornified cell layers, the most highly expressed cytokeratins are keratin 1 and keratin 10.30 31 In skin, it is believed that filaggrin, a protein derived from a precursor present in keratohyalin granules, causes these cytokeratins to aggregate.32

In this study, to further identify the proteins involved with pathologic keratinization in ocular surface diseases, we examined the expression of TGase 1, involucrin, loricrin, filaggrin, and several cytokeratins in 12 pathologic specimens.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Preparation of Human Samples
Several lines of evidence indicate that the conjunctival epithelium invades and resurfaces the cornea in ocular surface diseases (limbal stem cell deficiency) such as SJS, OCP, and alkali injury.33 34 With proper informed consent in accordance with the tenets of the Declaration of Helsinki for research involving human subjects and on approval by the Institutional Review Board of the Kyoto Prefectural University of Medicine, we obtained conjunctivas that covered corneas from 12 patients with SJS, OCP, or alkali injury (four of each) at the time of lamellar keratoplasty to improve vision (Table 1) . All eyes were in the chronic cicatricial phase, and the corneal surfaces were totally covered by conjunctival tissue. Again with proper informed consent, normal human bulbar conjunctiva was obtained during cataract surgery from four age-matched patients with no history of ocular surface disease. Conjunctivas for RNA isolation were frozen in liquid nitrogen immediately after removal and stored with reagent (Trizol; Gibco, Grand Island, NY) at -80°C until use. Conjunctivas for immunohistochemistry were snap frozen in liquid nitrogen, and embedded in optimal temperature cutting compound (Tissue-Tek II; Miles, Elkhart, IN).


View this table:
[in this window]
[in a new window]
  		Table 1. Patients’ Profile

 
RNA Isolation and Semiquantitative RT-PCR of TGase 1
Total RNA was isolated from the keratinized conjunctivas by the use of reagent (Trizol; Gibco) in accordance with the manufacturer’s protocol. To investigate relative levels of TGase 1 mRNA expression in diseased conjunctiva, semiquantitative reverse transcription–polymerase chain reaction (RT-PCR) was performed.35 The human G3PDH gene was used as the internal control. Primer sequences used were ACCACAGTCCATGCCATCAC (sense) and TCCACCACCCTGTTGCTGTA (antisense). cDNA was generated by mixing the extracted RNA after ethanol precipitation (1 µg/µl per sample) with a random hexamer primer (Takara Biomedicals, Tokyo, Japan) and incubating at 65°C for 5 minutes, while chilling the samples on ice. The mixture was then subjected to reverse-transcription in 25 mM MgCl2, 100 mM Tris-HCl (pH 8.3), 500mM KCl, 40 U/µl RNase inhibitor (Takara Biomedicals), 10 mM dNTP mixture, and 5 U/µl reverse transcriptase (AMV-XL, final volume, 20 µl; Takara Biomedicals). The mixture was incubated at 30°C for 10 minutes and at 42°C for 30 minutes, heated to 99°C for 5 minutes, and then stored at -20°C until use. A 10-µl aliquot (half of the total volume) of the same RT product (per sample) was used for PCR amplification. Oligonucleotide primers to the nontandem repeat regions of TGase1 were designed from published36 or GenBank sequences CCTTCTGGGCTCGCTGCTGTGG (sense) and CCACGAGAGCCGCCAAGACCAG (antisense). PCR amplifications were performed as previously described,37 with conditions optimized for the TGase1 gene using the RT product from total conjunctival RNA. The linear range of the amplification reaction for TGase 1 and G3PDH was determined by checking amplification after each cycle from cycles 23 to 30 for TGase 1 and from 21 to 31 for G3PDH. This showed that the 27th cycle was in the midlinear phase for TGase 1 and G3PDH. All PCR amplifications started with denaturation at 95°C for 3 minutes and ended with a final elongation at 72°C for 10 minutes. The parameters for PCR amplification were as follows: 27 cycles of denaturation at 95°C for 1 minute, annealing at 55°C for 1 minute, and extension at 72°C for 1 minute. A 5-µl aliquot of the reaction mixture was then electrophoresed on a 2% agarose gel (Seakem; FMC, Rockland, ME) containing ethidium bromide to evaluate amplification and fragment size. The amount of amplified product was quantified for each sample using a computing densitometer (420OE scanner; PDI, NY) and software (Quantity One; PDI, NY). The final amount of PCR product was expressed as the ratio of the TGase1 gene amplified to that of the G3PDH gene, to account for any differences in beginning amounts of RNA.

Immunohistochemistry
Most primary antibodies were purchased: involucrin (Novocastra, Newcastle-on-Tyne, UK), loricrin (Berkeley Biologicals, Berkeley, CA), filaggrin (Harbor BioProducts, Stoughton, MA), cytokeratin 1 (YLEM, Roma, Italy), cytokeratin 10 (Biomeda, Foster City, CA), cytokeratin 3 (Progen Biotechnik, Heidelberg, Germany), cytokeratin 4 (ICN Pharmaceuticals, Costa Mesa, CA), and cytokeratin 13 (American Research Products, Kensington, MD). Anti-TGase 1 and anti-cytokeratin 12 antibodies were kindly provided by Takashi Hiiragi (Department of Cell Biology, Kyoto University, Japan)38 and Michelle A. Kurpakus (Department of Anatomy and Cell Biology, Wayne State University, Detroit, MI), respectively.39

For indirect immunohistochemical studies of TGase 1 and other keratinization-related proteins (involucrin, loricrin, filaggrin, and cytokeratins 1 and 10), cryostat sections (7-µm thick) were placed on gelatin-coated slides, air dried, and rehydrated in phosphate-buffered saline (PBS) at room temperature for 15 minutes. We also observed keratins 4 and 13 (nonkeratinized, stratified) and keratins 3 and 12 (cornea-specific). To block nonspecific binding, the tissues were incubated with 1% bovine serum albumin (BSA) at room temperature for 30 minutes. Subsequently, the sections were incubated at room temperature for 1 hour with the primary antibody (Table 2) and then washed three times in PBS containing 0.15% Triton X-100 (PBST) for 15 minutes. For negative controls, the primary antibody was omitted. After they were stained with the primary antibody, the sections were then incubated at room temperature for 1 hour with suitable secondary antibodies: fluorescein isothiocyanate (FITC)–conjugated donkey anti-mouse IgG (Jackson ImmunoResearch, West Grove, PA), FITC-conjugated donkey anti-rabbit IgG (Vector, Burlingame, CA), and Cy3-conjugated donkey anti-rat IgG (Jackson ImmunoResearch). After several washings with PBS, the sections were coverslipped using anti-fading mounting medium (90% glycerol diluted in PBS), and the slides were examined by confocal microscopy (Fluoview; Olympus, Tokyo, Japan). For double immunostaining, the same procedure was used, except that the primary antibodies consisted of a mixture of mouse anti-filaggrin and rat anti-TGase 1 monoclonal antibodies. In these experiments, the secondary antibodies were FITC–conjugated donkey anti-mouse IgG and Cy3-conjugated donkey anti-rat IgG.


View this table:
[in this window]
[in a new window]
  		Table 2. Primary Antibodies and Source

 

   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Semiquantitative RT-PCR of TGase 1
To compare the expression of TGase 1 mRNA within experimental groups, the linear phase of amplification of each cDNA was found so that gene expression could be semiquantitatively compared. For TGase 1 and the control housekeeping gene (G3PDH), the linear phase of amplification was established at 27 cycles. In normal human conjunctivas, TGase 1 mRNA was detected either slightly or not at all. However, an increase of TGase 1 mRNA expression was observed in diseased conjunctivas (SJS, OCP, and alkali injury; Fig. 1A ). Densitometric comparisons of TGase 1 mRNA with G3PDH mRNA were obtained in each of these groups (Fig. 1B) . The ratios of TGase 1 and G3PDH mRNA in the ocular surface diseases studied were higher than those of normal conjunctiva. These differences were statistically significant (Dunnett test; P < 0.001; asterisks, Fig 1B ). In addition, these results were confirmed by sequence analysis of the bands using a PCR direct-sequencing technique.



View larger version (21K):
[in this window]
[in a new window]
  		Figure 1. Semiquantitative analysis of TGase 1 mRNA expression. (A) Representative RT-PCR experiments. (B) Densitometric analysis. A statistically significant increase of TGase 1 mRNA expression was observed in the diseased ocular surface compared with normal. Ratios of TGase1 to G3PDH mRNA were higher in diseased tissues than in normal conjunctiva (**P < 0.001; Dunnett test). Lane M, molecular weight marker; lane 1, normal conjunctiva; lane 2, Stevens–Johnson syndrome; lane 3, ocular cicatricial pemphigoid; lane 4, alkali injury (n = 4, mean ± SEM).

 
Immunohistochemistry of TGase 1, Involucrin, and Loricrin
In ocular surface disease, pathologic keratinization is accompanied by an increase in epithelial stratification and enlargement of the superficial epithelial cells (Fig. 2B ).7 8 9 10 Moreover, the conjunctivalized ocular surface cells have nuclei, whereas cornified cells are always anuclear in normal human epidermis. Control sections, incubated with the secondary antibody only, exhibited no discernible specific immunoreactivity over the entire region. The immunoreactivity observed in each specimen was compared against these control samples. It revealed the presence of TGase 1 in diseased conjunctival epithelium, predominantly in the cell membrane (Fig. 3B ). This expression was observed in the superficial and intermediate layers; the basal cells were not immunoreactive. In contrast to its expression in keratinized epithelia, TGase 1 was not expressed, or was expressed at very low levels, in normal conjunctival epithelium (Fig. 3A) .



View larger version (58K):
[in this window]
[in a new window]
  		Figure 2. Conjunctival tissue stained with hematoxylin and eosin. (A) Normal bulbar conjunctiva. (B) Conjunctiva covering cornea in a patient with Stevens–Johnson syndrome (patient SJS2), showing an increase in epithelial stratification and enlargement of superficial cells. Superficial cells have nuclei, unlike cells in the epidermis. Original magnification, x40.

 


View larger version (83K):
[in this window]
[in a new window]
  		Figure 3. Representative immunohistochemical analysis of TGase 1 (A, B), involucrin (C, D), loricrin (E, F) and filaggrin (G, H) from normal subjects (A, C, E, G) and patients with ocular surface disease (B, patient SJS2; D, SJS3; F, Alkali3; H, SJS2). TGase 1 was expressed only slightly or not at all in normal conjunctiva (A), whereas TGase 1 was strongly expressed in SJS (B). Its expression was observed in the cell membrane in nearly all cell layers except the basal cell layer. Involucrin was expressed in superficial layers in normal conjunctiva (C) and was upregulated in superficial and intermediate layers in SJS (D). Loricrin was expressed in both normal (E) and ocular surface disease (F), and staining patterns were similar. Double immunohistochemical staining of filaggrin (FITC) and TGase 1 (Cy3) (G, H). These proteins were not expressed in normal conjunctiva (G) but were expressed in SJS (H). A granular staining pattern of filaggrin was observed in the cytoplasm. Arrows and arrowheads: basement membrane zone and apical cell membrane, respectively. Scale bar, 100 µm.

 
Immunohistochemistry also documented the presence of involucrin in keratinized conjunctival epithelia (Fig. 3D) . The positive immunoreactivity was intense in the superficial and intermediate layers, and again, the basal cell layers were not discernibly immunostained. Involucrin was expressed only in superficial layers of the normal conjunctival epithelium (Fig. 3C) . However, the intensity of the immunoreactivity varied between samples, with positive immunostaining seen in two of four normal conjunctivas. Loricrin was found on immunohistochemistry in all layers of both diseased and normal conjunctival epithelium (Figs. 4E 4F ), and in these tissues the staining patterns were similar. The immunohistochemical findings are summarized in Table 3 .



View larger version (102K):
[in this window]
[in a new window]
  		Figure 4. Representative immunohistochemical analysis of cytokeratins 1 and 10 from normal subjects (A, C) and patients with ocular surface disease (B, patient SJS2; D, SJS2). Cytokeratins 1 (A, B) and 10 (C, D) were not expressed in normal conjunctiva (A, C) but were expressed in keratinized conjunctiva (B, D). Arrows and arrowheads: basement membrane zone and apical cell membrane, respectively. Scale bar, 100 µm.

 

View this table:
[in this window]
[in a new window]
  		Table 3. Distribution and Intensity of Expression of TGase 1 and Keratinization-Related Proteins

 
Changes in the Cytokeratin and Filaggrin Expression Patterns
Immunohistochemistry documented the presence of keratins (1 and 10, 4 and 13, and 3) in the diseased conjunctival epithelia examined in this study (Figs. 4 5) . Keratins 1 and 10 were expressed in the superficial and intermediate layers with no discernible immunostaining in the basal cell layers (Figs. 4B 4D) . In contrast, keratins 1 and 10 were not expressed in any layers of the normal conjunctival epithelium (Figs. 4A 4C) . Keratins 4 and 13 were expressed in both keratinized ocular surface epithelia and normal epithelia in all layers (Figs. 5A through 5D) . It has been reported that cornea-specific keratin 3 is expressed in the superficial layers of the normal conjunctival epithelium and in all layers of the corneal epithelium,40 whereas keratin 12 is expressed in all layers of the corneal epithelium but not in any layers of the conjunctival epithelium.41 Our results are consistent with this. We found keratin 3 in all layers of the normal corneal epithelia (data not shown), and in superficial epithelial layers both in the diseased and normal conjunctiva (Figs. 5E 5F) . Keratin 12 was expressed similarly in all layers of the normal corneal epithelium, but no keratin 12 immunostaining was found in any diseased tissue examined in these studies (data not shown). The staining patterns of keratins 3 and 12 in the keratinized diseased epithelium were similar to those in normal conjunctival epithelium. Double staining documented the presence of filaggrin in the superficial and intermediate layers of the keratinized epithelium, but not in the basal cell layer, and a granular staining pattern was evident in the cytoplasm (Fig. 3H) . This protein was not expressed in normal conjunctival epithelia (Fig. 3G) .



View larger version (91K):
[in this window]
[in a new window]
  		Figure 5. Representative immunohistochemical analysis of cytokeratins 4, 13, and 3 from normal subjects (A, C, E, respectively) and patients with ocular surface disease (B, patient OCP2; D, SJS2; F, Alkali1). Cytokeratins 4 (A, B) and 13 (C, D) were expressed in both normal (A, C) and diseased tissue (B, D). Cytokeratin 3 was expressed only in superficial layers in normal (E) and diseased tissue (F). Arrows and arrowheads: basement membrane zone and apical cell membrane, respectively. Scale bar, 100 µm.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
TGase 1, a membrane-bound isozyme of the TGase family, is an enzyme coded for by a gene sublocalized to chromosome 14q11.2.42 It catalyzes {gamma}-glutamyl lysine cross-links of proteins to form the cornified cell envelope at the periphery of cornified cells.17 TGase 1 is present in the epidermis of skin,17 18 43 predominantly in the upper spinous and granular layers beneath the stratum corneum and, along with TGase 3,44 is involved with the physiological keratinization of epidermis. Indeed, experiments in knockout mice have revealed that TGase 1 is essential for the distribution of cell envelope precursor proteins, such as involucrin and loricrin and that the function of TGase 1 cannot be compensated for by TGase 3 or other TGase isozymes.36 45 In this respect, we regard TGase 1 as a representative marker of keratinization.

Our previous report using in situ hybridization suggested that a link between TGase 1 gene expression and conjunctival epithelial cell keratinization may exist in SJS.16 To further investigate this, we undertook a semiquantitative RT-PCR study and found that TGase 1 mRNA expression was indeed upregulated in keratinized conjunctival epithelium compared with normal conjunctival epithelium (Fig. 1) . Immunohistochemical data clearly demonstrated the upregulation of TGase 1 in diseased ocular surface epithelia, whereas the protein is not, or is only slightly, expressed in normal conjunctival epithelium (Figs. 3A 3B) .16 46 In our previous report, TGase 1 mRNA in SJS conjunctival epithelium was invariably located in a band of epithelial cells located either in or above the suprabasal region.16 The distribution of TGase 1 protein is similar to that of TGase 1 mRNA, thus reinforcing our opinion that the pathologic keratinization of keratinized conjunctival epithelia is largely due to the upregulated expression of TGase 1.

The cornified cell envelope is formed during the terminal differentiation of epidermis through cross-linking of specific proteins, such as involucrin19 and loricrin.20 The appearance of this envelope in the upper layers of the epidermis reflects the normal physiological keratinization process. Our immunohistochemistry demonstrated the overexpression of involucrin in diseased ocular surface epithelia (Figs. 3C 3D) . Involucrin in normal conjunctival epithelium, by contrast, was expressed only in the superficial cell layers, with a variable intensity of expression depending on the sample. Several groups have investigated the expression of involucrin in normal human conjunctiva: Banks and Green,47 for example, reported that it is not present in the deepest epithelial cells but appears in the course of outward migration. Others have reported that normal bulbar conjunctiva adjacent to the limbus contains involucrin in only the three superficial cell layers and that the fornix conjunctiva contains no involucrin.48 Moreover, Krenzer and Freddo49 recently reported the general absence of involucrin in human bulbar conjunctiva. Our observation of sporadic involucrin-positive immunostaining has been reported in other mucous epithelia,47 50 where it has been suggested that the sporadic expression is the result of focal inflammatory responses to environmental stresses.49 50 We postulate that sporadic expression of involucrin in normal conjunctiva may also be due to environmental stresses and that upregulation of involucrin in diseased ocular surface epithelia is associated with the pathologic keratinization process. Our data indicate that loricrin is present in normal and keratinized epithelia (Figs. 3E 3F) . Loricrin is the major protein of the cornified cell envelope of terminally differentiated epidermal keratinocytes. It is also expressed in other types of mucosal epithelia, such as oral, esophageal, and vaginal.51 In view of this, we postulate that loricrin may be involved in the terminal differentiation of stratified squamous epithelia, including conjunctival epithelium, in addition to being involved with epidermal terminal differentiation. Possible roles in pathologic keratinization are unclear.

Another finding of this study is change in cytokeratin expression in keratinized conjunctival epithelium compared with normal. Cytokeratins play an important structural and protective role in maintaining the integrity of epithelial cells.26 27 28 29 The cytokeratin family is composed of specific type 1 (neutral-acidic) and type 2 (basic) members.29 It has been suggested that the presence of specific keratin pairs contribute to the physical characteristics of the epithelium in question. In this study, immunohistochemistry demonstrated that keratins 1 and 10, which are involved in the physiological keratinization process in the upper layers of the epidermis, were strongly expressed in diseased conjunctival epithelium, but not in normal conjunctival epithelium (Fig. 4) . Tseng et al.15 have reported that keratins 1 and 10 are expressed in keratinized corneal and conjunctival epithelia in vitamin A–deficient rabbits. Our results are consistent with theirs. We found that keratins 4 and 13, which were observed in nonkeratinized stratified epithelia, was expressed in both normal and keratinized ocular surface epithelia (Figs. 5A through 5D) . Keratins 3 and 12, which are a cornea-specific keratin pair, were not expressed in either normal or keratinized conjunctiva, except that keratin 3 was expressed only in superficial layers of normal and keratinized conjunctiva (Figs. 5E 5F) . Furthermore, the expression of filaggrin,32 which is thought to aggregate keratin filaments in the lower layers of the stratum corneum, was also upregulated in keratinized conjunctival epithelia (Figs. 3G 3H) . A previous study indicated that filaggrin is not expressed in the normal conjunctival epithelium,49 and our data are consistent with this. They indicate that upregulations of the keratin pair 1 and 10 and filaggrin are characteristics of the pathologic keratinization process in diseased conjunctival epithelium.

What might cause the unusual expression of TGase 1 and keratinization-related proteins in the ocular surface diseases we examined? Our previous report indicated that the number of proliferating epithelial cells in Stevens–Johnson syndrome conjunctiva, which were immunoreactive with a monoclonal antibody Ki-67, was much greater than normal.16 We have not performed experiments regarding apoptosis in the ocular surface disease conjunctiva but suggest that epithelial hyperproliferation may lead to the pathologic keratinization of ocular surface epithelia. Our previous report also demonstrated the presence of TGase 1 mRNA in SJS-affected conjunctival epithelium, and found that the signal was often particularly strong in the suprabasal epithelium near high concentrations of subepithelial inflammatory cells.16 Other investigators have speculated that conjunctival inflammation may influence goblet cell loss in ocular surface diseases such as SJS.13 Moreover, Saunders and Jetten52 reported that TGase 1 expression is upregulated by the inflammatory cytokine IFN{gamma} in cultured keratinocytes. Recently, we found that substantial inflammatory cell infiltration and surrounding cytokine expression (IFN{gamma} included) is a feature of the chronic phase of SJS.53 Based on available information, we speculate that the genes for TGase 1 and other keratinization-related proteins may be expressed because of inflammatory activity, resulting in conjunctival keratinization in severe ocular surface disease. We also suspect that severe tear deficiency may be involved, because the ocular surface, made up of stratified nonkeratinizing cell layers, is covered by tear film, which lubricates, hydrates, and protects the underlying epithelium. Squamous metaplasia has been described in numerous ocular surface disorders, including dry eye disorders,9 10 in which the aqueous layer of the tear film is deficient, as well as in disorders such as SJS and OCP, in which the mucous layer is deficient.12 In view of this, we further hypothesize that TGase 1 and keratinization-related protein gene expression may also be due to severe tear deficiency. To test this, we are now observing the expression of TGase 1 and keratinization-related proteins in several dry eye conditions.

Features shared by the pathologic keratinization of diseased ocular surfaces and the physiological keratinization of the epidermis include the upregulation of TGase 1, involucrin, filaggrin, and the keratin pair 1 and 10. The distribution of these proteins is different, however. In keratinized conjunctiva, TGase 1 and the other proteins are expressed in nearly all cell layers except for the basal cells, whereas in the human epidermis they are expressed predominantly in the spinous and granular layers beneath the stratum corneum. We suggest that the pathologic keratinization process in diseased, keratinized conjunctival epithelia may be based on the upregulation of TGase 1 and different expression patterns of keratinization-related proteins. Increased understanding of the process of pathologic keratinization of the ocular surface will enable us to manage these debilitating diseases more effectively.


   Acknowledgements
 
The authors thank Andrew J. Quantock, Department of Optometry and Vision Science, Cardiff University, United Kingdom, for critical reading and comments on the manuscript.


   Footnotes
 
Supported by Grants-in-Aid for Scientific Research from the Japanese Ministry of Health and Welfare and the Japanese Ministry of Education, a research grant from Kyoto Foundation for the Promotion of Medical Science, and the Intramural Research Fund of Kyoto Prefectural University of Medicine.

Submitted for publication July 7, 2000; revised October 4, 2000; accepted October 16, 2000.

Commercial relationships policy: N.

Corresponding author: Kohji Nishida, Department of Ophthalmology, Kyoto Prefectural University of Medicine, Kawaramachi Hirokoji, Kamigyo-ku, Kyoto 602-0841, Japan. knishida{at}ophth.kpu-m.ac.jp


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Foster, CS, Wilson, LA, Ekins, MB (1982) Immunosuppressive therapy for processive ocular cicatricial pemphigoid Ophthalmology 89,340-353[Medline][Order article via Infotrieve]
  2. Tsai, RJF, Tseng, SCG (1994) Human allograft limbal transplantation for corneal surface reconstruction Cornea 13,389-400[Medline][Order article via Infotrieve]
  3. Tseng, SC, Prabhasawat, P, Barton, K, Gray, T, Meller, D. (1998) Amniotic membrane transplantation with or without limbal allografts for corneal surface reconstruction in patients with limbal stem cell deficiency Arch Ophthalmol 116,431-441[Abstract/Free Full Text]
  4. Auguste, GYC, George, JF, Michael, K. (1998) Management of conjunctival cicatrizing diseases and severe ocular surface dysfunction Surv Ophthalmol 43,19-46[Medline][Order article via Infotrieve]
  5. Tsubota, K, Satake, Y, Kaido, M, et al (1999) Treatment of severe ocular surface disorders with corneal epithelial stem-cell transplantation N Engl J Med 340,1697-1703[Abstract/Free Full Text]
  6. Koizumi N, Inatomi T, Suzuki T, Sotozono C, Kinoshita S. Cultivated corneal epithelial transplantation for ocular surface reconstruction in acute phase Stevens–Johnson syndrome. Arch Ophthalmol. In press.
  7. Beitch, I. (1970) The induction of keratinization in the corneal epithelium: a comparison of the dry eye and vitamin A-deficient eye Invest Ophthalmol 9,827-843[Abstract/Free Full Text]
  8. Collin, HB, Donshik, PC, Foster, CS, et al (1978) Keratinization of the bulbar conjunctival epithelium in superior limbic keratoconjunctivitis in humans: an electron microscopic study Acta Ophthalmol 56,531-543
  9. Nelson, JD, Havener, VR, Cameron, D. (1983) Cellulose acetate impression of the ocular surface Arch Ophthalmol 101,1869-1872[Abstract]
  10. Tseng, SCG (1985) Staging of conjunctival squamous metaplasia by impression cytology Ophthalmology 92,728-733[Medline][Order article via Infotrieve]
  11. Friend, J, Kiorpes, TC, Thoft, RA (1983) Conjunctival goblet cell frequency after alkali injury is not accurately reflected by aqueous tear mucin content Invest Ophthalmol Vis Sci 24,612-618[Abstract/Free Full Text]
  12. Kinoshita, S, Kiorpes, TC, Friend, J, et al (1984) Goblet cell density in ocular surface disease Arch Ophthalmol 102,1049-1051[Abstract]
  13. Tseng, SCG, Hirst, LW, Maumenee, AE, et al (1984) Possible mechanism for the loss of goblet cells in mucin-deficient disorders Ophthalmology 91,545-552[Medline][Order article via Infotrieve]
  14. Pflugfelder, SC, Huang, AJW, Feuer, W, et al (1990) Conjunctival cytological features of primary Sjögren’s syndrome Ophthalmology 97,985-991[Medline][Order article via Infotrieve]
  15. Tseng, SCG, Hatchell, D, Tierney, N, Huang, AJ, Sun, T-T. (1984) Expression of keratin markers by rabbit corneal, conjunctival, and esophageal epithelia during vitamin A deficiency J Cell Biol 99,2279-2286[Abstract/Free Full Text]
  16. Nishida, K, Yamanishi, K, Yamada, K, et al (1999) Epithelial hyperproliferation and transglutaminase 1 gene expression in Stevens-Johnson syndrome conjunctiva Am J Pathol 154,331-336[Abstract/Free Full Text]
  17. Thacher, SM, Rice, RH (1985) Keratinocyte-specific transglutaminase of cultured human epidermal cells: relation to cross-linked envelope formation and terminal differentiation Cell 40,685-695[Medline][Order article via Infotrieve]
  18. Wanda, TS, Scott, MT, Shelley, SG, et al (1992) Type 1 keratinocyte transglutaminase: expression in human skin and psoriasis J Invest Dermatol 99,27-34[Medline][Order article via Infotrieve]
  19. Peter, MS, Lyuben, NM (1997) Direct evidence that involucrin is a major early isopeptide cross-linked component of the keratinocyte cornified cell envelope J Biol Chem 272,2021-2030[Abstract/Free Full Text]
  20. Candi, E, Melino, G, Mei, G, et al (1995) Biochemical, structural, and transglutaminase substrate properties of human loricrin, the major epidermal cornified cell envelope protein J Biol Chem 270,26382-26390[Abstract/Free Full Text]
  21. Michal, J, Martha, NS, Alasdair, CS (1998) Cornified cell envelope assembly: a model based on electron microscopic determinations of thickness and projected density J Cell Sci 111,1051-1060[Abstract]
  22. Akiyama, M, Smith, LT, Yoneda, K, et al (1999) Periderm cells form cornified cell envelope in their regression process during human epidermal development J Invest Dermatol 112,903-909[Medline][Order article via Infotrieve]
  23. Banks, SS, Harris, CC (1984) Aberrant expression of keratin proteins and cross-linked envelopes in human esophageal carcinomas Cancer Res 44,1153-1159[Abstract/Free Full Text]
  24. Gigi, LO, Geiger, B, Levy, R, et al (1986) Cytokeratin expression in squamous metaplasia of the human uterine cervix Differentiation 31,191-205[Medline][Order article via Infotrieve]
  25. Smedts, F, Ramaekers, F, Robben, H, et al (1990) Changing patterns of keratin expression during progression of cervical intraepithelial neoplasia Am J Pathol 136,657-668[Abstract]
  26. Franke, WW, Schiller, DL, Moll, R, et al (1981) Diversity of cytokeratins: differentiation specific expression of cytokeratin polypeptides in epithelial cells and tissues J Mol Biol 153,933-959[Medline][Order article via Infotrieve]
  27. Tseng, SCG, Jarvinen, MJ, Nelson, WG, Huang, JW, Woodcock, MJ, Sun, T-T. (1982) Correlation of specific keratins with different types of epithelial differentiation: monoclonal antibody studies Cell 30,361-372[Medline][Order article via Infotrieve]
  28. Sun, T-T, Eichner, R, Nelson, W, et al (1983) Keratin classes: monoclonal markers for different types of epithelial differentiation J Invest Dermatol 81,109-115
  29. Eichner, R, Bonitz, P, Sun, T-T. (1985) Classification of epidermal keratins according to their immunoreactivity, isoelectric point, and mode of expression J Cell Biol 98,1388-1396[Abstract/Free Full Text]
  30. Ming, ME, Daryanani, HA, Roberts, LP, Baden, HP, Kvedar, JC (1994) Binding of keratin intermediate filaments (K10) to the cornified envelope in mouse epidermis: implications for barrier function J Invest Dermatol 103,780-784[Medline][Order article via Infotrieve]
  31. Candi, E, Tarcsa, E, Digiovanna, JJ, et al (1998) A highly conserved lysine residue on the head domain of type II keratins is essential for the attachment of keratin intermediate filaments to the cornified cell envelope through isopeptide crosslinking by transglutaminases Proc Natl Acad Sci USA 95,2067-2072[Abstract/Free Full Text]
  32. Resing, RA, Walsh, KA, Dale, BA (1984) Identification of two intermediates during processing of profilaggrin to filaggrin in neonatal mouse epidermis J Cell Biol 99,1372-1378[Abstract/Free Full Text]
  33. Kinoshita, S, Kiritoshi, A, Ohji, M, Ohashi, Y, Manabe, R. (1986) Disappearance of palisades of Vogt in ocular surface disease Jpn J Clin Ophthalmol 40,363-366
  34. Chen, JJ, Tseng, SCG (1990) Corneal epithelial wound healing in partial limbal deficiency Invest Ophthalmol Vis Sci 31,1301-1314[Abstract/Free Full Text]
  35. Nakayama, H, Yokoi, H, Fujita, J. (1992) Quantification of mRNA by nonradioactive RT-PCR and CCD imaging system Nucleic Acids Res 20,4939[Free Full Text]
  36. Matsuki, M, Yamashita, F, Ishida–Yamamoto, A, et al (1998) Defective stratum corneum and early neonatal death in mice lacking the gene for transglutaminase 1 Proc Natl Acad Sci USA 95,1044-1049[Abstract/Free Full Text]
  37. Nishida, K, Kawasaki, S, Adachi, W, Kinoshita, S. (1996) Apolipoprotein J expression in human ocular surface epithelium Invest Ophthalmol Vis Sci 37,2285-2292[Abstract/Free Full Text]
  38. Hiiragi, T, Sasaki, H, Nagafuchi, A, et al (1999) Transglutaminase type 1 and its cross-linking activity are concentrated at adherens junction in simple epithelial cells J Biol Chem 274,34148-34154[Abstract/Free Full Text]
  39. Kurpakus, MA, Maniaci, MT, Esco, M. (1994) Expression of keratins K12, K4 and K14 during development of ocular surface epithelium Curr Eye Res 13,805-814[Medline][Order article via Infotrieve]
  40. Schermer, A, Galvin, S, Sun, T-T. (1986) Differentiation-related expression of a major 64K corneal keratin in vivo and in culture suggests limbal location of corneal epithelial stem cells J Cell Biol 103,49-62[Abstract/Free Full Text]
  41. Willie, WC, Mei, MM, Winston, WYK, Chia-Yang, L, Tseng, SCG (1994) Conjunctival epithelial cells do not transdifferentiate in organotypic cultures: expression of K12 keratin is restricted to corneal epithelium Curr Eye Res 13,765-778[Medline][Order article via Infotrieve]
  42. Yamanishi, K, Inazawa, J, Liew, FM, et al (1992) Structure of the gene for human transglutaminase 1 J Biol Chem 267,17858-17863[Abstract/Free Full Text]
  43. Nonomura, K, Yamanishi, K, Hosokawa, Y, et al (1993) Localization of transglutaminase 1 mRNA in normal psoriatic epidermis by non-radioactive in situ hybridization Br J Dermatol 128,23-28[Medline][Order article via Infotrieve]
  44. Kim, IG, Gorman, JJ, Park, SC, Steinert, PM (1993) The deduced sequence of the novel protransglutaminaseE (TGase 3) of human and mouse J Biol Chem 270,12682-12690
  45. Yamada, K, Matsuki, M, Morishima, Y, et al (1997) Activation of the human transglutaminase 1 promoter in transgenic mice: terminal differentiation-specific expression of the TGM1-lacZ transgene in keratinized stratified squamous epithelia Hum Mol Genet 6,2223-2231[Abstract/Free Full Text]
  46. Raghunath, M, Cankay, R, Kubitscheck, U, et al (1999) Transglutaminase activity in the eye: cross-linking in epithelia and connective tissue structures Invest Ophthalmol Vis Sci 40,2780-2787[Abstract/Free Full Text]
  47. Banks, SS, Green, H. (1981) Involucrin synthesis and tissue assembly by keratinocytes in natural and cultured human epithelia J Biol Chem 90,732-737
  48. Holbach, L, Hofmann, C, Volcker, HE, Naumann, GO (1986) Immunocytochemical detection of involucrin in precancerous and cancerous non-pigmented conjunctival tumors Klin Monatsbl Augenheilkd 189,128-132[Medline][Order article via Infotrieve]
  49. Krenzer, KL, Freddo, TF (1997) Cytokeratin expression in normal human bulbar conjunctiva obtained by impression cytology Invest Ophthalmol Vis Sci 38,142-152[Abstract/Free Full Text]
  50. Wild, GA, Mischke, D. (1986) Variation and frequency of cytokeratin polypeptides patterns in human squamous non-keratinizing epithelium Exp Cell Res 162,114-126[Medline][Order article via Infotrieve]
  51. Hohl, D, Ruf, OB, de Viragh,, et al (1993) Expression patterns of loricrin in various species and tissues Differentiation 54,25-34[Medline][Order article via Infotrieve]
  52. Saunders, NA, Jetten, AM (1994) Control of growth regulatory and differentiation-specific genes in human epidermal keratinocytes by interferon-{gamma} J Biol Chem 269,2016-2022[Abstract/Free Full Text]
  53. Kawasaki, S, Nishida, K, Sotozono, C, Quantock, AJ, Kinishita, S. (2000) Conjunctival inflammation in the chronic phase of Stevens-Johnson syndrome Br J Ophthalmol 84,1191-1193[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 IOVSHome page
W. Li, Y. Hayashida, Y.-T. Chen, H. He, D. Y. Tseng, M. Alonso, S.-Y. Chen, X. Xi, and S. C. G. Tseng
Air Exposure Induced Squamous Metaplasia of Human Limbal Epithelium
Invest. Ophthalmol. Vis. Sci., January 1, 2008; 49(1): 154 - 162.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
S. G. Priglinger, C. S. Alge, T. C. Kreutzer, A. S. Neubauer, C. Haritoglou, A. Kampik, and U. Welge-Luessen
Keratinocyte Transglutaminase in Proliferative Vitreoretinopathy
Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 4990 - 4997.
[Abstract] [Full Text] [PDF]

Home page
 Arch OphthalmolHome page
L. P. K. Ang, T. Nakamura, T. Inatomi, C. Sotozono, N. Koizumi, N. Yokoi, and S. Kinoshita
Autologous serum-derived cultivated oral epithelial transplants for severe ocular surface disease.
Arch Ophthalmol, November 1, 2006; 124(11): 1543 - 1551.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
L. Tong, Z. Chen, C. S. De Paiva, R. Beuerman, D.-Q. Li, and S. C. Pflugfelder
Transglutaminase Participates in UVB-Induced Cell Death Pathways in Human Corneal Epithelial Cells.
Invest. Ophthalmol. Vis. Sci., October 1, 2006; 47(10): 4295 - 4301.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
L. Tong, R. M. Corrales, Z. Chen, A. L. Villarreal, C. S. De Paiva, R. Beuerman, D.-Q. Li, and S. C. Pflugfelder
Expression and Regulation of Cornified Envelope Proteins in Human Corneal Epithelium
Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 1938 - 1946.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
T. Nakamura, L. P. K. Ang, H. Rigby, E. Sekiyama, T. Inatomi, C. Sotozono, N. J. Fullwood, and S. Kinoshita
The use of autologous serum in the development of corneal and oral epithelial equivalents in patients with stevens-johnson syndrome.
Invest. Ophthalmol. Vis. Sci., March 1, 2006; 47(3): 909 - 916.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Y. Hori, S. J. Spurr-Michaud, C. L. Russo, P. Argueso, and I. K. Gipson
Effect of Retinoic Acid on Gene Expression in Human Conjunctival Epithelium: Secretory Phospholipase A2 Mediates Retinoic Acid Induction of MUC16
Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4050 - 4061.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
T. Nakamura, F. Ishikawa, K.-h. Sonoda, T. Hisatomi, H. Qiao, J. Yamada, M. Fukata, T. Ishibashi, M. Harada, and S. Kinoshita
Characterization and Distribution of Bone Marrow-Derived Cells in Mouse Cornea
Invest. Ophthalmol. Vis. Sci., February 1, 2005; 46(2): 497 - 503.
[Abstract] [Full Text] [PDF]

Home page
 Br. J. Ophthalmol.Home page
T Nakamura, T Inatomi, C Sotozono, T Amemiya, N Kanamura, and S Kinoshita
Transplantation of cultivated autologous oral mucosal epithelial cells in patients with severe ocular surface disorders
Br. J. Ophthalmol., October 1, 2004; 88(10): 1280 - 1284.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
T. Nakamura, M. Yoshitani, H. Rigby, N. J. Fullwood, W. Ito, T. Inatomi, C. Sotozono, T. Nakamura, Y. Shimizu, and S. Kinoshita
Sterilized, Freeze-Dried Amniotic Membrane: A Useful Substrate for Ocular Surface Reconstruction
Invest. Ophthalmol. Vis. Sci., January 1, 2004; 45(1): 93 - 99.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
P. Argueso, A. Tisdale, U. Mandel, E. Letko, C. S. Foster, and I. K. Gipson
The Cell-Layer- and Cell-Type-Specific Distribution of GalNAc-Transferases in the Ocular Surface Epithelia Is Altered during Keratinization
Invest. Ophthalmol. Vis. Sci., January 1, 2003; 44(1): 86 - 92.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
T. Nakamura, K.-I. Endo, L. J. Cooper, N. J. Fullwood, N. Tanifuji, M. Tsuzuki, N. Koizumi, T. Inatomi, Y. Sano, and S. Kinoshita
The Successful Culture and Autologous Transplantation of Rabbit Oral Mucosal Epithelial Cells on Amniotic Membrane
Invest. Ophthalmol. Vis. Sci., January 1, 2003; 44(1): 106 - 116.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
N. Koizumi, L. J. Cooper, N. J. Fullwood, T. Nakamura, K. Inoki, M. Tsuzuki, and S. Kinoshita
An Evaluation of Cultivated Corneal Limbal Epithelial Cells, Using Cell-Suspension Culture
Invest. Ophthalmol. Vis. Sci., July 1, 2002; 43(7): 2114 - 2121.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
T. Nakamura, K. Nishida, A. Dota, and S. Kinoshita
Changes in Conjunctival Clusterin Expression in Severe Ocular Surface Disease
Invest. Ophthalmol. Vis. Sci., June 1, 2002; 43(6): 1702 - 1707.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal