| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 From the Departments of Veterinary and Biomedical Sciences and 2 Biochemistry, University of Nebraska-Lincoln; and 3 Department of Ophthalmology, University of Nebraska Medical Center, Omaha.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
METHODS. The human lens TTase gene was cloned by using RT-PCR and verified by sequence and RNase protection assay. TTase overexpressed in Escherichia coli was isolated and purified to homogeneity by column chromatography and identified by Western blot analysis. The activity was assayed with a synthetic substrate hydroxyethyl disulfide. Its function in dethiolating and reactivating other key metabolic enzymes was studied by using pure glutathione S-transferase (GST) and glutathione peroxidase (GPx) from commercial source and also with the cell extract of rabbit lens epithelial cells preexposed to H2O2.
RESULTS. The cloned human lens TTase gene showed identical sequence to the TTase gene from other human tissues. The RNase protection assay displayed a single transcript from the total RNA of human lens epithelial cells. The purified RHLT had a molecular weight of 11.8 kDa and reacted positively with anti-pig liver TTase. It displayed similar structural, functional, and kinetic characteristics to those of TTases from other sources. It was shown that RHLT effectively regenerated the activities of GST and GPx, after each was inactivated by S-thiolation with cystine in vitro. Furthermore, RHLT was able to restore the activity of the oxidatively inactivated glyceraldehyde-3-phosphate dehydrogenase (G-3PD) in H2O2-exposed rabbit lens epithelial cells.
CONCLUSIONS. The human lens TTase gene has been cloned for the first time. Its gene product showed the characteristics which support our speculation that TTase may play a major role in maintaining the homeostasis of lens protein thiols thus protecting against oxidative stress.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
TTase is classified generally as TDOR enzyme because it has thiol groups in the active center and participates in catalyzing disulfide reductions of low-molecular-weight disulfides and protein–thiol mixed disulfides, assisted by glutathione.2 17 A characteristic structural feature of these enzymes is the presence of an active site, -Cys-Pro-Tyr (Phe)-Cys-, which is conserved in many organisms,1 2 and the pair of cysteine residues in the center, being easily interchangeable between reduced (dithiol) and oxidized state (intramolecular disulfide), exerts a reducing power for substrates containing S–S bond and exchanges disulfide to its corresponding thiols. Therefore, it is believed that TTase may play an important role in the maintenance of sulfhydryl homeostasis and regulation of enzyme activities.1 2 18
Although TTase has been studied extensively in many tissues, only recently has it been detected in the lens19 and other ocular tissues.20 Eye lens is a protein-rich tissue with high sulfhydryl (SH) groups that are extremely vulnerable to oxidative damage. The demonstration of TTase in the lens has great implication, because oxidation is speculated to be one of the main factors for age-related cataracts in humans.21 22 23 The formation of mixed disulfides between nonprotein thiols and protein SH groups (protein S-thiolation) is an early event in the lens under oxidative stress.24 25 26 Protein-S-S-glutathione (PSSG) and protein-S-S-cysteine (PSSC) are the products of such protein modifications that have been implicated as intermediates for protein–protein disulfide (PSSP) crosslinks. These changes in the lens may lead to protein insolubility, transparency loss, and cataract formation.27 Hence, maintenance of the redox status of the lens organ is vital for preserving its transparency and physiological function. To prevent lens proteins from aggregation, the thiol groups of the proteins must be protected from oxidation, and the S-thiolated proteins must be restored to their normal, reduced state by effectively cleaving the protein–thiol mixed disulfides.
Cui and Lou25 and Padgaonkar et al.28 reported that if the oxidant was removed from the environment of an oxidant preexposed lens, the elevated protein–thiol mixed disulfides in the lens could spontaneously diminish to a low level, as found in an undisturbed normal lens. These observations along with the fact that lens epithelial cells could also recover from oxidative stress–induced protein S-thiolation29 suggest that there may be a repair system in the lens to abate this oxidative damage. TTase has been speculated to participate in such repair because much of the oxidative damage is attributed to functional modification of sulfhydryl group of proteins by disulfide bond formation. TTase thus may act as a cellular repair enzyme by catalyzing the reduction of disulfide bonds in these S-thiolated proteins or enzymes.
To prove that lens TTase has a repair function for S-thiolated proteins or enzymes, it is essential to use purified TTase for various enzyme kinetics and functional studies. Because of the relatively low ratio of TTase protein to total proteins in the lens, it was difficult to obtain lens TTase in high purity.19 For this reason, we chose an alternative approach by using recombinant human lens TTase (RHLT) for the study. This article describes the cloning and sequence analysis of the human lens TTase gene, its overexpression in Escherichia coli, and the purification and characterization of RHLT. The function of RHLT in regenerating activities of several key metabolic enzymes that are inactivated by S-thiolation during oxidative stress is also described.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
[32P]UTP was from ICN Biomedicals, Inc. (Costa Mesa, CA). Agarose, Taq DNA polymerase, EcoRI, NdeI, and isopropyl-ß-D-thiolgalactoside (IPTG) were all purchased from Gibco-BRL (Grand Island, NY). Eukaryotic TA cloning kit (unidirectional) and cDNA cycle kit were from Invitrogen (Carlsbad, CA). Riboprobe in vitro transcription systems and ß-actin primers were from Promega Corp. (Madison, WI). Q1Afilter plasmid midi kit, Q1Aquick nucleotide removal kit, and Q1Aquick gel extraction kit were obtained from Qiagen, Inc. (Valencia, CA). BugBuster protein extraction reagent and pET System were from Novagen, Inc. (Madison, WI). RNase protection assay kit was from Torrey Pines Biolabs, Inc. (San Diego, CA). Immunoblot assay kit, nitrocellulose membrane, electrophoresis protein standards, isoelectric focusing (IEF) standards, and ampholyties were purchased from Bio-Rad Laboratories (Richmond, CA). All other chemicals and reagents were of analytical grade.
Human lens epithelial cell line, HLE B3, was a gift from Usha Andley of Washington University (St. Louis, MO). Anti-pig liver thioltransferase was a gift from William Wells of Michigan State University (East Lansing, MI). Rabbit lens epithelial cell line N/N1003A was a gift from John Reddan of Oakland University (Rochester, MI).
Total RNA Isolation
The human lens epithelial cells (B3) were grown in MEM medium
with 20% FBS containing gentamicin in a humidified
CO2 incubator. Total RNA was extracted form fresh
cells with an RNA isolation kit and measured for absorbance at 260 and
280 nm. The purity of RNA was further analyzed on formaldehyde agarose
gel.
Cloning of Human Lens TTase
Human lens TTase cDNA was isolated by RT-PCR technique. Primers
were designed on the basis of the human placenta TTase gene
sequence (GenBank accession number x76648) and obtained from
Integrated DNA Technologies, Inc. (Coralville, IA): forward primer
(sense): 5'-pGCATGGCTCAAGAGTTTGTG-3'; reverse primer (antisense):
5'-TTCCTATGAGATCTGTGGTTACTG-3'.
The first cDNA strand was generated using cDNA cycle kit (Invitrogen), following the instruction manual. An aliquot of total RNA from above (11.5 µl or 5 µg) was mixed with 1 µl of random primers. The mixture was heated in a 65°C incubator for 10 minutes and chilled on ice, followed by addition of the following reagents: 1 µl of RNase inhibitor, 4 µl of 5x RT buffer, 1 µl of 100 mM dNTPs, 1 µl of 80 mM sodium pyrophosphate, and 0.5 µl of AMV reverse transcriptase. The reaction was conducted in a 42°C water bath for 60 minutes. An aliquot (2 µl) of the reverse transcriptase reaction mixture was used as a template for PCR. The amplification was performed in a total volume of 50 µl containing 5 µl of 10x PCR buffer, 1.5 µl of 50 µM MgCl2, 1 µl of 100 mM dNTPs, 1 µM of each primer, and 1 unit of Taq DNA polymerase (Gibco-BRL). The reaction was performed for 30 cycles, with 45 seconds at 94°C, 1 minute at 55°C, and 2 minutes at 72°C followed by an additional 5 minutes at 72°C and was maintained at 4°C. The RT-PCR products were analyzed on 1% agarose gel. ß-Actin amplified with primers from Promega was used as internal control.
PCR products were purified and cloned in pCR3.1-uni vector and the plasmid DNA transformation was prepared and sequenced at the DNA Sequencing Facility (Iowa State University). The sequence was compared with published TTase sequences.
RNase Protection Assay
To synthesize the probe for the RNase protection assay,
recombinant plasmids containing the human lens TTase cDNA in
pCR3.1-uni vector in both directions—pCR3.1-uni/HLT-F3B and
pCR3.1-uni/HLT-Rev—were each purified by using QIAfilter
midi-kit. Linear plasmids were obtained by digestion with
EcoRI followed by recovery from agarose gel. Both
[32P]UTP–labeled antisense RNA and sense RNA
probes were synthesized using Riboprobe in vitro transcription kit, and
the labeled probes were purified by using the QIAquick nucleotide
removal kit. The specific activity of the labeled probes was determined
using the Pharmacia Wallac 1410 Liquid Scintillation Counter. The probe
with 1.0 x 105 dpm was used for each assay.
The RNase protection assay was performed using a kit from Torrey Pines Biolabs, Inc., following the instruction manual. In brief, 12 µg of the total RNA from HLE B3 cells was hybridized with either antisense RNA probe or sense RNA probe for 25 minutes at 90°C. The hybridization solutions were incubated with RNase A/T1 at room temperature for 30 minutes. The protected RNA was precipitated and separated on 6% sequencing gel by electrophoresis, and the gel was then exposed to x-ray film for 4 days.
Overexpression of RHLT in E. coli
pET expression system from Novagen (Madison, WI) was used to
express the human lens TTase in E. coli. To obtain the
protein product without the extra residues in the N-terminal end, PCR
technique was used to introduce the NdeI site into the 5'
end of the human lens TTase fragment with modified forward
primer (5'-pGCATATGGCTCAAGAGTTTG TG-3') and the original reverse
primer, using sequenced insert in pCR3.1-uni vector as the template.
The above PCR product was again cloned into pCR3.1-uni vector, and its sequence was confirmed by sequencing. The positive plasmid was purified, and its insert was recloned into pET23a(+) between NdeI and EcoRI sites. After sequencing, the positive clone was used for high-level expression in BL21 (DE3) by IPTG induction. By following the instruction manual from the pET System (kit) provided by Novagen, one single colony of E. coli with the inserted plasmid containing human lens TTase cDNA was inoculated in 40 ml LB medium with 100 µg/ml ampicillin and grown overnight. Ten milliliters of the overnight grown cells was placed in 1 liter of LB media containing 100 µg/ml ampicillin and grown for 6 hours until the cell density reached an absorbance (600 nm) level of 0.4 to 0.6. IPTG (0.5 mM) was added, and the culture was grown for 0, 0.5, 1, 2, 3, 4, 6, and 8 hours. The cells were collected by centrifugation at 13,000 rpm for 30 seconds, and the pellet was resuspended in 300 µl of Bugbuster reagent (Novagen) and incubated for 10 minutes before centrifuging again at 13,000 rpm for 8 minutes. The supernatants were saved for protein measurement, TTase activity assay, and other experiments. The BL21 (DE3) cells without plasmid served as controls.
Purification of RHLT
An FPLC system (LKB/Pharmacia, Piscataway, NJ) equipped with a
UV detector and a fraction collector was used for the following
chromatographic procedures. All operations were done at 4°C, unless
otherwise mentioned. An aliquot of the above cell extract (3.5 ml) was
loaded onto a Sephadex G-75 column (2.5 x 120 cm),
preequilibrated with 10 mM, pH 7.4, potassium phosphate buffer, and
eluted with the same buffer. Fractions with TTase activity were pooled
and concentrated with Amicon YM 3 (Amicon Inc., Beverly, MA). This
partially purified enzyme was then loaded onto a QA-Sepharose FF column
(1.6 x 17 cm) and eluted with 10 mM, pH 5.8, potassium phosphate
buffer. The fractions with TTase activity were again pooled,
concentrated with Centreprep 3 (Amicon Inc.), and then stored at
-80°C for additional studies.
Assay for TTase
The standard assay for TTase followed the method of Mieyal et
al.,9
which was modified by Raghavachari and
Lou.19
Briefly, the reaction mixture contained 0.2 mM
NADPH, 0.5 mM GSH, 0.1 M potassium phosphate buffer (pH 7.4), 0.4 units
of GR, and an aliquot of either crude, partially purified, or purified
RHLT in a total volume of 1 ml. The reaction was carried out at 30°C
and initiated after a 5-minute preincubation with 2 mM HEDS. The
decrease in absorbance of NADPH at 340 nm was monitored for 5 minutes,
using spectrophotometer (model DU 640; Beckman, Fullerton, CA). The
slope of the linear portion of the time course for A340 nm absorption
loss in control (TTase free) was subtracted from the slope of the
samples (containing TTase) and was used to determine TTase activity.
One unit of TTase activity is defined as 1 µmol of NADPH
oxidized/min. (i.e., A340 nm for NADPH = 6.2
mM-1 cm-1, which is the
molar extinction coefficient of NADPH) under these standard assay
conditions.
Protein Assays
Protein concentration was determined with BCA
method31
following the manufacturer’s protocol (Pierce
Chemical Co., Rockford, IL) with bovine serum albumin as the standard.
SDS-PAGE, Immunoblotting, and N-terminal Amino Acid Sequencing
Electrophoresis of partially purified and purified RHLT on
vertical polyacrylamide slab gels was performed in the presence of SDS
by the method of Laemmeli.32
The resolving gel was
homogeneous at 12% of acrylamide and the stacking gel was 4.3% of
acrylamide. The electrophoresis was performed at 120 V for 80 minutes.
Broad molecular weight standard from Bio-Rad (Hercules, CA) was used
for this assay. The protein bands were stained and visualized by
Coomassie Brilliant Blue R-250.
Western blot analysis was performed by the method of Towbin et al.33 The purified RHLT was first subjected to electrophoresis with 12% SDS-PAGE and then electroblotted at 100 V/h onto a nitrocellulose sheet. Anti-pig liver TTase (1:1000 dilution) was used as the first antibody for the formation of immune complex of enzyme-antibody. Positive immune reaction was detected using alkaline phosphatase conjugated goat anti-rabbit IgG.34
The N-terminal amino acid sequencing of the purified enzyme was done by the Protein Sequencing Core Facility at the University of Nebraska (Lincoln, NE).
Isoelectric Focusing
Mini-isoelectric focusing (IEF) apparatus (model 111) from
Bio-Rad (Richmond, CA) was used to determine the isoelectric point (pI)
of RHLT following the instructions provided by the manufacturer. A pH
gradient of 3 to 10 was used. Samples were run at 100 V for 15 minutes,
200 V for 15 minutes, and then 450 V for 60 minutes. The gel was then
stained with Coomassie Brilliant Blue R-250.
Kinetic Studies
Studies for substrate concentration dependence were carried out
as in the standard assay for HEDS, S-sulfocysteine, and
cystine. Substrate concentrations in the range of 0.02 to 1.65 mM was
assayed with 0.02 units of RHLT. The apparent
Km and
Vmax values were calculated based on
the Lineweaver-Burk plot.35
The effect of GSH on TTase assay was carried out by using GSH concentrations between 0.05 to 0.75 mM in the absence and presence of RHLT.
Effect of IAA on RHLT Activity
Aliquot of reduced 0.02 units of RHLT (pretreated with 0.5 mM
DTT) was incubated with 30 µM IAA in 50 µl of 0.1 M potassium
phosphate buffer, pH 7.4, for various time intervals (between 0 and 30
minutes) before the mixture was used for RHLT assay. For protection
studies, the same amount of reduced RHLT as above was preincubated with
either 2.5 mM S-sulfocysteine or 0.5 mM GSH for 10 minutes
at room temperature and then incubated for various time intervals with
30 µM IAA in the same buffer as above. The unreacted TTase was
immediately assayed for activity.
Effect of H2O2 on RHLT Activity
Purified RHLT was reduced with 4 mM DTT at room temperature for
30 minutes and filtered through PD-10 column (Pharmacia Biotech AB,
Uppsala, Sweden) to remove DTT. An aliquot of reduced RHLT (0.02 units)
in 10 mM, pH 7.4, potassium phosphate buffer was preincubated with
various concentrations of
H2O2 (0.05–1.5 mM) in a
total volume of 6 µl for 5 minutes at 25°C. Ten microliters of
catalase (2 µg) was added at the end of the reaction for 5 minutes to
detoxify the remaining H2O2
at the same temperature. The final RHLT activity was determined as
described above for TTase standard assay. To examine if
H2O2-treated RHLT could be
reactivated by reducing agents, RHLT (0.2 units) was incubated with
0.33 mM H2O2 in 120 µl of
10 mM potassium phosphate buffer, pH 7.4, for 5 minutes at 25°C. The
oxidation was stopped by adding 2 µg catalase. The sample was then
divided into six portions, and each portion was mixed with 0.1 mM
phosphate buffer, 5 mM DTT, 0.5 mM GSH, 5 mM GSH,
thioredoxin–thioredoxin reductase plus NADPH (designated as theTRx-TR
system) and TRx alone, respectively, and incubated at 25°C
for 20 minutes. The final volume for each of the regenerating reaction
mixture was 40 µl. Ten microliters of each of the sample was used for
TTase assay. The concentrations of NADPH, TRx, and TR in the TRx–TR
system were 0.25 mM, 10 µM, and 0.8 µM, respectively. TRx-TR system
without H2O2-inactivated
RHLT was used as a control.
Studies of RHLT Function
The function of RHLT was studied by using sulfhydryl-sensitive
enzymes as models. The enzymes studied below were chosen because they
are key metabolic or oxidative defense enzymes in the lens.
Regeneration of In Vitro Cysteine-Thiolated GST by RHLT.
GST activity was determined based on the method described by Habig et
al.36
To ensure the enzyme was totally reduced, GST (150
mU) was treated with 1 mM DTT at room temperature for 30 minutes in 0.1
M Tris-HCl buffer, pH 8.0, containing 0.1 mM EDTA. DTT was then removed
with a PD-10 column, equilibrated, and washed with the same buffer. The
reduced GST (15 mU) was then S-thiolated with cysteine (PSSC formation)
by incubating with 1 mM cystine in 50 µl of the above buffer for 20
minutes at room temperature, and the excess cystine was removed by
PD-10 column. For dethiolating the modified GST, 1 mM GSH, 0.3 mM
NADPH, and 0.6 units of GR with or without 0.1 units of the purified
RHLT were added into the above S-thiolated GST mixture (0.2 ml). The
final solution was then incubated at 30°C for 5 to 30 minutes and
used for GST assay. In another experiment, the modified GST was
dethiolated with 1 mM, 2.5 mM, and 5.0 mM GSH, with and without the
presence of RHLT at 30°C for 20 minutes.
Regeneration of In Vitro Cysteine-Thiolated GPx by RHLT.
Procedures for cystine inactivation and subsequent RHLT reactivation of
GPx were the same as for GST above, except that S-thiolation of GPx was
achieved by using 10 mM potassium phosphate buffer, pH 7.4, and the
inactivation reaction was conducted for 30 minutes. In another
experiment, the dethiolation was done by using physiological
concentrations of GSH (1, 2.5, and 5.0 mM), with and without the
presence of RHLT. The GPx activity was determined following the method
by Spector et al.37
Regeneration of Oxidatively Damaged G-3PD in Rabbit Lens
Epithelial Cells by RHLT.
Rabbit lens epithelial cells from line N/N1003A was used for this
experiment following previously described procedures.29
In
brief, confluent cells (0.8 million) grown in MEM plus 20% rabbit
serum were incubated overnight in MEM with 1% rabbit serum and then in
serum-free MEM for 30 minutes before a bolus of 0.5 mM
H2O2 was added. After 15 minutes, the cells
were harvested and used for G-3PD assay. Aliquots of the cell extract
were filtered with a PD-10 column to remove small-molecular-weight
components and then used for RHLT regeneration studies, following the
procedure described above. The dethiolation of inactivated G-3PD was
carried out with 1 mM GSH with and without RHLT. In another experiment,
GSH at 1.0 and 5.0 mM was used in the presence and absence of RHLT to
clarify the dethiolating function of RHLT. G-3PD activity was analyzed
on the basis of the method described by Bergmeyer et al.38
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
RNase Protection Assay
To verify if the TTase cDNA fragment obtained from
RT-PCR can indeed express TTase in human lens epithelial cells, a RNase
protection assay was performed. Both the
[
-32P]UTP–labeled antisense and sense
TTase RNA were obtained by using in vitro transcription
reaction, with plasmids containing the human lens TTase
fragment in the opposite direction, as a template. As shown in Figure 2
, after removal of the excess radioisotope, both probes gave one band of
389 bp (based on sequence). The total RNA from lens epithelial cells
only protected antisense TTase RNA probe with a size of 341
bp (based on sequence) but did not protect any part of the sense
TTase RNA probe. These results indicate that the cloned
fragment was exactly the same transcript as that in the human lens
epithelial cells.
|
The TTase fragment released by NdeI and EcoRI from pCR3.1-HLTT was subcloned into pET23a(+) expression vector. Positive clones named pET23a(+)-HLTT were confirmed for the presence and orientation of the insert by restriction enzyme analysis, sequencing, and analyzing its gene product.
BL21(DE3) cells transformed with pET23a(+)-HLTT upon induction by 0.4 mM IPTG up to 8 hours showed a 40-fold increase in TTase activity (data not shown).
Purification of RHLT
RHLT-expressed in E. coli had a specific activity of
29.45 units/mg protein, which was nearly 30,000-fold higher than that
of bovine lens TTase.19
RHLT was well separated from other
proteins by using a Sephadex G-75 gel filtration column. This partially
purified RHLT was further purified by QA-Sepharose FF column
chromatography in which TTase activity was found in the flow-through,
whereas most of the other proteins were still bound onto the resin.
SDS-PAGE analysis showed a single protein band at molecular weight of
11.8 kDa (Fig. 3A
), which reacted positively with anti-pig liver TTase (Fig. 3B)
. The
enzyme was purified up to threefold with 16% yield and a specific
activity of 91 units/mg.
|
The purified RHLT could be inhibited (data not shown) by substrates (HEDS, S-sulfocysteine or L-cystine) with concentrations higher than 0.25 mM, similar to the observation of TTase from other tissues.8 39 40 The Km values for HEDS, S-sulfocysteine, and L-cystine were calculated to be 0.60, 0.71, and 0.25 mM, respectively, and were similar to those obtained from TTase of human red blood cells (RBCs).40 The catalytic efficiency (Vmax/Km) of RHLT was different for the three substrates. RHLT displayed the highest efficiency for cystine, followed by HEDS and S-sulfocysteine. These results are summarized in Table 1 .
|
|
RHLT was partially inactivated when treated with H2O2 in vitro. The activity loss was 25% at 0.1 mM, 63% at 0.5 mM H2O2, and maintained at 65% to 70% even after H2O2 was increased to 1.5 mM. Less than half of inactivation was observed if the enzyme was first suspended in a larger volume of buffer solution before H2O2 treatment. The activity could be almost fully regenerated by treating with high concentrations of reducing agents, DTT or GSH. But it can also be restored effectively by the TRx–TR system (Table 2) . For proper control, the TRx–TR system was tested for dethiolase activity with the same substrate but found to be negative. The H2O2-treated RHLT showed no apparent protein change on SDS-PAGE (data not shown), but IEF showed the same pI value as the oxidized enzyme when it was treated with HEDS, indicating that the H2O2-treated RHLT likely had become more basic by forming intramolecular disulfides.
|
|
Regeneration of GPx Activity by RHLT.
A similar experiment was conducted for GPx (Fig. 5B)
, in which
S-thiolation inactivated GPx to 50% of its original level after
incubating with 1 mM cystine for 30 minutes. Addition of RHLT into the
reaction mixture restored GPx to 90% of its initial activity within 30
minutes. In contrast, only approximately 70% of the activity could be
regenerated by simple GSH reduction.
Physiological concentration of GSH was also used to enhance the reactivation with and without the presence of RHLT. It was found that the increasing levels of GSH at 1, 2.5, and 5.0 mM could enhance the recovery to 176%, 257%, and 347% above the damaged enzyme activity. However, the presence of RHLT could correspondingly restore more of the GPx activity to 250%, 333%, and 440% over the cystine-inactivated enzyme activity (data not shown).
Regeneration of G-3PD Activity in Rabbit Epithelial Cells by
RHLT.
The highly oxidative, stress-sensitive G-3PD in rabbit lens epithelial
cells showed nearly 80% loss in activity within 15 minutes after the
cells were exposed to a bolus of 0.5 mM
H2O2.29
The
activity was recovered up to threefold when RHLT was added to the
reaction mixture (Fig. 6)
. DTT effectively reactivated G-3PD, but GSH showed little effect under
the same conditions. In a separate experiment when physiological level
of GSH was used with and without the presence of RHLT, again, the
activity of G-3PD restored more when RHLT enzyme was present. The
restoration was from 7.5% to 19% and 30% at GSH concentrations of
1.0 and 5.0 mM, respectively. With the presence of RHLT, the recovery
was increased from 6% to 39% and 56%, respectively (data not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The IAA-sensitive nature of RHLT is also similar to other TTases, indicating that the enzyme requires free thiols in the active center for activity. Inhibition by IAA could be easily protected after the enzyme was preincubated with S-sulfocysteine but not with GSH. This substrate protection can be considered as a mixed disulfide formation between TTase and S-sulfocysteine or intramolecular disulfide,2 39 thereby preventing irreversible SH alkylation by IAA. The partial inactivation of RHLT by H2O2 and its reactivation by reductants or by TRx–TR system indicates that the disulfide and free thiol interchange had occurred within the active site of the enzyme. This property has also been observed in nonocular TTases.42 RHLT appears to tolerate H2O2 quite well in comparison to other enzymes,29 because it still retained 30% to 40% activity even at concentrations 0.5 mM and higher. This apparent H2O2-resistant nature was observed more so in vivo with lens epithelial cells, in which TTase activity remained active in the H2O2-exposed cells even after 3 hours.29 Preliminary studies indicated that cellular TTase was induced when lens cells were exposed to H2O2,43 which may explain the sustained activity of TTase during oxidative stress. The fact that the TRx–TR system, another enzyme in the TDOR family known for its ability to reduce protein–protein disulfides,44 45 protected RHLT from in vitro oxidation may further explain the resistance of TTase to H2O2 inactivation in vivo.29
Although the wide distribution of TTase is well known, its physiological role is still not established.2 Because TTase can catalyze the reduction of protein–thiol mixed disulfides and low-molecular-weight disulfides in the presence of GSH,46 47 it has been implicated to play a role in many biological processes, from reductive denaturation of insulin, homeostatic maintenance of intracellular thiols, and modulation of enzyme and receptor activities to gene expression.1 2 17 The successful cloning and overexpression of the human lens TTase gene allowed us to obtain homogeneous RHLT for functional studies.
The total amount of PSSG and PSSC in a normal lens from animals and humans has been consistently lower than 5% of the free GSH pool,48 but the concentration can be elevated precipitously in experimental lenses exposed to oxidative stress27 or in lenses extracted from cataract patients.49 The interesting finding that elevated PSSG in a lens preexposed to an oxidant could spontaneously return to its normal level once the oxidant was removed25 26 28 50 prompted our speculation that TTase may involve in situ to control the rise of intracellular pool of S-thiolated proteins and to refrain the proteins from disulfide formation so that a proper lens function can be preserved.27 In the previous articles,19 51 54 we have suggested that TTase is one of the primary cellular antioxidants and a repair agent for the lens to combat oxidative stress, based on the results that lens TTase could effectively dethiolate modified lens crystallin proteins in vitro.51 These results suggest that TTase can protect lens proteins from permanent damage by dethiolating protein–thiol mixed disulfides to restore protein SH groups.
The present study provided further proof that lens TTase may also protect key metabolic enzymes from permanent oxidative damage. RHLT showed an ability to regenerate oxidant-inactivated enzyme activities of GPx, an important lens oxidation defense enzyme, and GST, a key xenobiotic detoxifying enzyme in the lens. Both enzymes were inactivated by cystine thiolation to form enzyme-cysteine mixed disulfide (PSSC). Interestingly GST could not be inactivated by GSH thiolation, as reported by Terada et al.52 and by Mieyal et al.2 Our observation parallelled these findings (result not shown). The reactivation of S-thiolated GST, GPx, or G-3PD could only be efficiently achieved by the catalytic function of RHLT and not by simple GSH reduction, even when physiological levels of GSH (1.0–5.0 mM) were used. The ability of RHLT to dethiolate PSSC in modified GST or GPx is in agreement with the finding of Terada et al.52 for placental TTase. This is in contrast to the reports from Mieyal’s laboratory,2 53 in that RBC TTase showed a distinct preference for PSSG over PSSC. We also found that lens TTase preferentially dethiolated crystallin-S-S-glutathione, but it also showed some catalytic activity toward crystallin-S-S-cysteine when an radiolabel assay was performed.51 54 Further studies are needed to clarify this discrepancy.
The strongest evidence for the repair/protection function of TTase is that RHLT could reactivate the oxidatively damaged enzyme in situ, including cellular G-3PD, which is a key metabolic enzyme for lens ATP generation in the glycolytic pathway. The restoration of enzyme activity by RHLT dethiolation in vitro suggests that G-3PD in the rabbit lens epithelial cells preexposed to H2O2 was likely damaged by forming protein–thiol mixed disulfide. The current results enhanced our speculation in the previous report29 that the spontaneous recovery of cellular G-3PD at the end of 3 hours, after the cells detoxified the bolus H2O2 (0.5 mM), may be attributed to the in situ repairing or dethiolating function of the oxidant-resistant TTase in the same cells. This speculation is in agreement with the report of the H2O2-treated human endothelial cells, in which a major S-thiolated protein was identified as G-3PD.55
These and our previous studies indicate that lens TTase not only could dethiolate S-thiolated proteins, but also could regenerate enzyme activities by dethiolating the S-thiolated enzymes in the lens. The possible physiological function of TTase in the lens can therefore be considered as maintenance of the homeostasis of cellular thiol/disulfide equilibrium, thus protecting the lens from permanent oxidative damage by repairing the thiolated proteins or enzymes.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
3 Present affiliation: Department of Microbiology,
University of Virginia Health Science Center, Charlottesville.
4 Present affiliation: Department of Oncology, McArdle
Laboratory for Cancer Research, University of Wisconsin, Madison.
Presented at the annual meeting of the Association for Research in Vision and Ophthalmology, Fort Lauderdale, Florida, May, 1998.
Supported by National Institutes of Health Grant RO1-10595 (MFL).
Submitted for publication April 4, 2000; revised July 11, and September 21, 2000; accepted November 30, 2000.
Commercial relationships policy: N.
Corresponding author: Marjorie F. Lou, Veterinary and Biomedical Sciences, University of Nebraska-Lincoln, 134 VBS, Lincoln, NE 68583-0905. mlou1{at}unl.edu
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  S. Lofgren, M. R. Fernando, K.-Y. Xing, Y. Wang, C. A. Kuszynski, Y.-S. Ho, and M. F. Lou Effect of Thioltransferase (Glutaredoxin) Deletion on Cellular Sensitivity to Oxidative Stress and Cell Proliferation in Lens Epithelial Cells of Thioltransferase Knockout Mouse Invest. Ophthalmol. Vis. Sci., October 1, 2008; 49(10): 4497 - 4505. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. I. Hashemy, C. Johansson, C. Berndt, C. H. Lillig, and A. Holmgren Oxidation and S-Nitrosylation of Cysteines in Human Cytosolic and Mitochondrial Glutaredoxins: EFFECTS ON STRUCTURE AND ACTIVITY J. Biol. Chem., May 11, 2007; 282(19): 14428 - 14436. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Moon, M. R. Fernando, and M. F. Lou Induction of Thioltransferase and Thioredoxin/Thioredoxin Reductase Systems in Cultured Porcine Lenses under Oxidative Stress Invest. Ophthalmol. Vis. Sci., October 1, 2005; 46(10): 3783 - 3789. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Johansson, C. H. Lillig, and A. Holmgren Human Mitochondrial Glutaredoxin Reduces S-Glutathionylated Proteins with High Affinity Accepting Electrons from Either Glutathione or Thioredoxin Reductase J. Biol. Chem., February 27, 2004; 279(9): 7537 - 7543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Fernando, M. Satake, V. M. Monnier, and M. F. Lou Thioltranferase Mediated Ascorbate Recycling in Human Lens Epithelial Cells Invest. Ophthalmol. Vis. Sci., January 1, 2004; 45(1): 230 - 237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yegorova, A. Liu, and M. F. Lou Human Lens Thioredoxin: Molecular Cloning and Functional Characterization Invest. Ophthalmol. Vis. Sci., August 1, 2003; 44(8): 3263 - 3271. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Krysan and M. F. Lou Regulation of Human Thioltransferase (hTTase) Gene by AP-1 Transcription Factor under Oxidative Stress Invest. Ophthalmol. Vis. Sci., June 1, 2002; 43(6): 1876 - 1883. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. N. Gladyshev, A. Liu, S. V. Novoselov, K. Krysan, Q.-A. Sun, V. M. Kryukov, G. V. Kryukov, and M. F. Lou Identification and Characterization of a New Mammalian Glutaredoxin (Thioltransferase), Grx2 J. Biol. Chem., August 3, 2001; 276(32): 30374 - 30380. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, GSH + RHLT; 
, GSH alone.
, inactivated GST + GSH; 
,
inactivated GST + GSH and RHLT. (B) Regeneration of
cystine-inactivated GPx. 