IOVS Journal of Cell Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ishihama, H.
Right arrow Articles by Muramatsu, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ishihama, H.
Right arrow Articles by Muramatsu, T.
(Investigative Ophthalmology and Visual Science. 2001;42:1172-1178.)
© 2001 by The Association for Research in Vision and Ophthalmology, Inc.

Colocalization of Neuropilin-1 and Flk-1 in Retinal Neovascularization in a Mouse Model of Retinopathy

Hidenori Ishihama1,2, Masaharu Ohbayashi3, Nobuyuki Kurosawa1, Takashi Kitsukawa4, Onrai Matsuura1,5, Yozo Miyake2 and Takashi Muramatsu1

1 From the Departments of Biochemistry, 2 Ophthalmology, and 5 Pediatrics, Nagoya University School of Medicine; 3 Photon Medical Research Center, Hamamatsu University School of Medicine; and the 4 Laboratory of Speciation Mechanisms 1, National Institute for Basic Biology, Okazaki, Japan.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. To investigate the mechanisms of the development of retinal neovascularization, the localizations of vascular endothelial (VEGF) receptors Flk-1 and neuropilin (NP)-1 mRNAs were examined.

METHODS. The model of retinopathy of prematurity (ROP) was produced by ischemia-induced ocular neovascularization, by exposing postnatal day-7 mice to 75% oxygen for 5 days and then returning them to room air for 5 days. Retinal neovascularization was visualized by injection of fluorescein-dextran. Expression of Flk-1 and NP-1 mRNAs were examined by in situ hybridization with flatmount and serial sections of the retina. The localization of NP-1 was also confirmed by immunohistochemistry. Blood vessel patterns were characterized by immunohistochemical localization of von Willebrand factor (vWF).

RESULTS. Flatmount in situ hybridization showed intense expression of NP-1 and Flk-1 mRNAs colocalized in the area of neovascularization. In situ hybridization of serial sections of the retina revealed that expression of Flk-1 and NP-1 was restricted to neovascularized vessels of the retina from ROP mice.

CONCLUSIONS. The restricted expression of Flk-1 and NP-1 on neovascularized vessels suggests that these molecules may play important roles in retinal neovascularization. This is the first report of the colocalization of NP-1 and Flk-1 on neovascularized vessels of the retina from ROP mice.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Retinopathy of prematurity (ROP) is seen almost exclusively in premature infants with oxygen supplementation during the postnatal period and is a major cause of blindness in newborns.1 Damage to retinal blood vessels results in closure of retinal capillaries, and retinal ischemia occurs.2 These conditions induce intense proliferation of the vascular endothelium and glial cells at the junction of avascular and vascularized portions of the retina.2 The new vessels break through the inner surface membrane of the retina and grow into the outer surface of the vitreous cavity, resulting in formation of a retrolental fibrovascular membrane that is the cause of severe vision loss in patients with ROP.2

Retinal ischemia results in release of one or more angiogenic factors that stimulate neovascularization. Vascular endothelial growth factor (VEGF) has a variety of effects on vascular endothelium, acting as a mitogen, chemotactic factor, and regulator of vascular permeability.3 4 5 The importance of VEGF in the pathogenesis of retinal neovascularization suggests that retinal neovascularization is caused by release of vasoformation factor in response to hypoxia.6 7 Indeed, the expression of VEGF mRNA has been shown to be stimulated by hypoxia.8 9 10 VEGF has been implicated in the pathogenesis of retinal vasculogenesis and in the development of retinal neovascularization in ischemic retinopathies.11 Thus, VEGF signaling is an excellent target, not only for anti-tumor angiogenesis, but also for treatment of proliferative diabetic retinopathy and other retinal vascular diseases. Given the importance in the involvement of VEGF signaling in ocular diseases, the spatial and temporal patterns of VEGF mRNA and protein expression have been well studied.11 12 However, little is known about the involvement of its receptors in retinal neovascularization.2

The interactions of VEGF with their receptors provide the signals for cell migration, proliferation, and differentiation, but these signals are complex.13 14 Five isoforms of human VEGF, differing in biologic properties, are produced by alternative splicing from a single VEGF gene.13 The various VEGF isoforms bind two type 1 transmembrane protein-tyrosine kinase receptors, Flt-115 and Flk-1.16 Flt-1 and Flk-1 are expressed in endothelial cells but have somewhat different functions. Gene knockout experiments of these molecules indicate that Flk-1 plays central roles in endothelial cell proliferation and differentiation,17 whereas Flt-1 regulates cell migration.18 Recent studies have revealed that NP-1, a semaphorin receptor for chemorepulsive axon guidance,19 20 21 22 23 24 plays an important role in VEGF signaling by binding to VEGF165 and enhances its binding to Flk-1.25 NP-2, which is closely related to NP-1, may also be involved in VEGF signaling.26 27 Furthermore, heparan sulfate proteoglycans mediate the storage or release of VEGF145, VEGF165, and VEGF189 in response to tissue damage.13

To understand the mechanisms underlying retinal neovascularization and to develop better drugs or therapeutic regimens to block abnormal endothelial cell proliferation, we focused on two molecules, Flk-1 and NP-1.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mouse Model
This study was performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. To produce retinal neovascularization, litters of 7-day-old C57BL/6J mice with nursing dams were exposed to 75% oxygen for 5 days and then returned to room air at P12 for 5 days, as described previously.12 28 Mice of the same age kept in room air were used as control animals. To examine the retinal vasculature, mice were deeply anesthetized with pentobarbital sodium and perfused through the left ventricle with a 50-mg/ml solution of high-molecular-weight fluorescein-dextran, as described previously.12 28

In Situ Hybridization
cDNA fragments of mouse NP-1 (619 bp) and mouse Flk-1 (285 bp) were generated from mouse brain total RNA by reverse transcription–polymerase chain reaction (RT-PCR). The primers used were TCAGGACCATACAGGAGATGG and TGACATCCCATTGTGCCAAC for NP-1 and GTGATCCCAGATGACAGCCA and GGTGAGCTGCAGTGTGGTCC for Flk-1. The amplified DNA fragments were subcloned into the EcoRV site of a vector (pBlueScript SK+; Stratagene, La Jolla, CA) and sequenced. Digoxygenin-labeled RNA probes in either antisense or sense orientation were synthesized using T3 or T7 RNA polymerase, as reported previously.29

Mice were deeply anesthetized with pentobarbital sodium and the eyes enucleated, embedded in optimal-temperature cutting compound (OCT; Miles, Elkhart, IN), and frozen in dry ice-acetone. Four-micrometer sections were placed on aminopropyltriethoxysilane-coated slides and air dried for 30 minutes. The sections were postfixed in 4% paraformaldehyde for 20 minutes and treated as described previously.29 Hybridization was performed at 72°C. Flatmounted retina in situ hybridization was performed by a method described previously.29

Immunohistochemistry
For immunostaining of blood vessels, sections were postfixed with acetone for 10 minutes and treated with 100% methanol containing 0.03% hydrogen peroxide to inactivate endogenous peroxidase. The sections were incubated with horseradish peroxidase (HRP)-conjugated anti-von Willebrand factor (vWF) polyclonal antibody (Dako, Kyoto, Japan) for 1 hour at room temperature followed by three washes with phosphate-buffered saline (PBS). For immunostaining of NP-1, sections were incubated with anti-mouse NP-1 polyclonal antibody22 (a kind gift from Hajime Fujisawa; 1:500 dilution of stock solution [1 mg/ml] with 1% bovine serum albumin in Tris-buffer [pH 7.4]) overnight at 4°C, washed with PBS, and then incubated with HRP-labeled goat-anti-rabbit IgG (Histofine Simplestain kit; Nichirei, Tokyo, Japan) for 30 minutes at room temperature. Immunoreactivity was visualized with diaminobenzidine (DAB). Serial sections were stained with anti-vWF antibody, anti-NP-1 antibody or nonimmune rabbit IgG as a control. The specimens were observed with a microscope equipped with a Nomarski differential interference-contrast system (Olympus, Tokyo, Japan).

RT-PCR Analysis
Five neovascularized and five control retinas were isolated the mice, and total RNA was prepared by the acid guanidinium isothiocyanate-phenol-chloroform extraction method. Semiquantitative RT-PCR was performed as reported previously.30 The PCR profile consisted of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 40 seconds; 35 cycles for NP-1, 30 cycles for Flk-1, and 25 cycles for glyceraldehye-3-phosphate dehydrogenase (G3P). The primers used for the amplification of NP-1 and Flk-1 were the same as described earlier. The primers for G3P amplification were GACCACAGTCCATGCCATCAC and GTAGCCGTATTCATTGTCATACC.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To examine the possibility of the involvement of VEGF receptors (VEGFRs) on neovascularization in the ROP retina, the levels of Flk-1 and NP-1 mRNA expression were analyzed by RT-PCR. The levels of expression of these two genes in the retina were comparable between normal and ROP mice (Fig. 1) . This result suggested that the expression of VEGFRs was not grossly affected by hypoxia. To examine the expression of Flk-1 and NP-1 in the ROP retina in more detail, flatmount in situ hybridization was performed (Figs. 2 3) . Exposure of postnatal day (P)7 mice to 75% oxygen for 5 days followed by return to room air resulted in retinal neovascularization. The pattern of vascular development and neovascularization could be seen readily in retinal flatmounts after fluorescein-dextran perfusion (Figs . 2, 3). The vessels of the normal retina extended from the optic nerve to the periphery and formed a fine radial branching pattern in the superficial retinal layer. However, in the ROP retina, neovascular tufts occurred in the midperiphery at the junctional area between the perfused and nonperfused retina.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 1. Expression of NP-1 and Flk-1 mRNAs in normal and neovascularized retina. Total RNA was isolated from whole retinas of normal and ROP mice, and the expression levels of NP-1 and Flk-1 mRNAs were quantified by semiquantitative RT-PCR. G3P mRNA was amplified as an internal control for the integrity of the RNA. The amounts of NP-1 and Flk-1 mRNAs in the whole retina were similar between the control (C) and neovascularized (N) retinas.

 


View larger version (171K):
[in this window]
[in a new window]
 
Figure 2. Aberrant and restricted expression of NP-1 mRNA in neovascularized retina. In situ hybridization for NP-1 mRNA was performed in fluorescein-dextran–perfused flatmount retina preparations of ROP (A through F) and normal mice (G through J). Blood vessels were visualized with fluorescein-dextran by fluorescein angiography (A, D, G, and J). Hybridization with antisense probe in the ROP retina showed intense signals in the ROP retina (B) but not in the normal control retina (H). Control hybridization with sense probe did not show any signals (E and K). Fluorescein angiographs were changed to pseudocolor and merged with the results of in situ hybridization (C, F, I, and L). Bar, 300 µm.

 


View larger version (167K):
[in this window]
[in a new window]
 
Figure 3. Aberrant and restricted expression of Flk-1 mRNA in the neovascularized retina. In situ hybridization for Flk-1 mRNA was performed in fluorescein-dextran–perfused flatmount retina preparations from ROP (A through F) and normal mice (G through J). Blood vessels were visualized with fluorescein-dextran by fluorescein angiography (A, D, G, and J). Hybridization with antisense probe in the ROP retina showed intense signals in the ROP retina (B), but not in the normal control retina (H). Control hybridization with sense probe showed only background signals (E and K). Fluorescein angiographs were changed to pseudocolor and merged with the results of in situ hybridization (C, F, I, and L). Bar, 300 µm.

 
Hybridization of flatmounted ROP retina with antisense RNA probe for NP-1 elicited an intense signal in the area of neovascularization (Fig. 2B) . NP-1 mRNA expression in other regions including normal vessels was below the level of detection by in situ hybridization. In the normal retina, no strong signals for NP-1 mRNA were detected (Fig. 2H) . Sense probe for NP-1 revealed signals at low background levels throughout the retinas (Figs. 2E 2K) . Intense signal for Flk-1 mRNA was also detected in the area corresponding to neovascularization of the flatmounted retina from ROP mice, whereas signals in other regions including normal vessels were below the level of detection (Fig. 3B) . as previously reported in a cat model.2 No strong signals for Flk-1 mRNA were detected in the control retina (Fig. 3H) . Hybridization with a sense probe showed signals only at low background levels in both ROP and normal retinas (Figs. 3E 3K) .

To determine whether expression of NP-1 and Flk-1 mRNAs is colocalized in neovascular vessels, serial sections were prepared for in situ hybridization (Fig. 4) . The localization of neovascularized and normal vessels was determined by immunohistochemical staining of vWF (Figs. 4A 4F) . Neovascularized vessels were identified in a tuft- or lumplike pattern extended into the vitreous cavity. Intense signals for NP-1 and Flk-1 mRNA expression were detected in neovascularized vessels of the ROP retina, but not in normal vessels of either the ROP or normal retina (Figs. 4B 4D) . Sense probe hybridization controls for NP-1 and Flk-1 demonstrated uniformly low backgrounds in the inner nuclear layer and outer nuclear layer (Figs. 4C 4E 4H 4J) .



View larger version (144K):
[in this window]
[in a new window]
 
Figure 4. In situ hybridization of serial sections showing the colocalization of NP-1 and Flk-1 mRNA expression in neovascularized vessels. Serial sections from ROP (A through E) or normal retina (F through J) were hybridized with anti-vWF antibody (A, F), antisense RNA probe for NP-1 (B, G), sense probe for NP-1 (C, H), antisense probe for Flk-1 (D, I), and sense probe for Flk-1 (E, J). Normal blood vessels were located between the inner nuclear layer and ganglion cell layer, whereas neovascularized vessels extended into the vitreous cavity in a lumplike pattern (A, F). Intense signals for NP-1 and Flk-1 mRNAs were observed in neovascularized vessels, but not in normal vessels of the ROP retina (A, D). No signals were observed with either the antisense or sense probes for NP-1 or Flk-1 mRNA in sections from the normal retina. Bar, 100 µm.

 
NP-1 protein expression in neovascularized vessels was further confirmed on sections of the retina. Strong immunoreactivity against NP-1 was detected in neovascularized vessels, but not in normal vessels of the ROP retina (Figs. 5A 5B ), consistent with the results of the in situ hybridization studies. No apparent signals of NP-1 protein expression were detected on any vessels of the normal mouse retina (Figs. 5C 5D) .



View larger version (91K):
[in this window]
[in a new window]
 
Figure 5. Immunohistochemical localization of NP-1 in neovascularized vessels. Serial sections were treated with the antibody against vWF (A, C) or NP-1 (B, D). Arrows: neovascularized vessels; arrowheads: normal vessels. Strong immunoreactivity for NP-1 was observed in neovascularized vessels of ROP retina (A, B) but not in the normal retina (C, D). Very weak signals were observed in the ganglion cell layer and inner nuclear layer of the neovascularized (B) and normal retinas (D). Bar, 100 µm.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we demonstrated that VEGFR Flk-1 and coreceptor NP-1 were expressed in spatial and temporal association with retinal neovascularization. The intense Flk-1 and NP-1 mRNA signals were completely colocalized to neovascularized vessels characterized by their morphology and location on in situ hybridization. The levels of NP-1 protein also correlated with its mRNA levels.

High levels of Flk-1 and NP-1 mRNA expression have been observed in endothelial cells during embryonic vasculogenesis and angiogenesis.17 31 Indeed, gene targeting of these molecules demonstrates their crucial roles in the formation of blood vessels.17 31 32 Furthermore, enhanced expression of VEGFR is found during tumor neovascularization.33 Very recently, the significance of NP-1 in tumor angiogenesis has been suggested by transfecting NP-1 cDNA into rat prostate carcinoma cells.34 It is of interest that despite aberrant levels of NP-1 and Flk-1 expression in neovascularized vessels, the levels of expression of these molecules in normal, differentiated, and quiescent endothelial cells was below the limits of detection.13 It has been reported that angiogenesis, which is upregulated in pathologic conditions, is similar to physiological angiogenesis or vasculogenesis during embryogenesis.13 These findings suggest that immature or proliferating endothelial cells in neovascularized vessels express high levels of Flk-1 and NP-1 mRNA in the ROP retina.

Furthermore, the high levels of Flk-1 and NP-1 mRNA expression in neovascularized vessels together with the aberrant VEGF production from astrocytes may be the major causes of deregulated growth of blood vessels. Regulation of Flk-1 and NP-1 expression in immature or proliferating endothelial cells is an important subject for future study. So far, little is known about the control of NP-1 expression in normal and pathologic angiogenesis. Recently, decreased NP-1 expression in human astrocytoma under hypoxic condition has been reported, but the mechanisms of the gene regulation remain unknown.35 Flk-1 promoter does not contain elements in contrast with the presence of this element in the promoter region of the Flt-1 gene.36 However, in vitro experiments have revealed that the Flk-1 protein level is increased under hypoxic conditions,37 suggesting the presence of a posttranscriptional regulatory mechanism of Flk-1 expression.

Our RT-PCR experiment showed that the expression levels of NP-1 and Flk-1 mRNA in the whole retina were not grossly affected by hypoxia, but in situ hybridization clearly showed that the expression of Flk-1 and NP-1 mRNAs in neovascularized vessels was strongly induced by hypoxia. These apparently contradictory results can be resolved by considering that Flk-1 and NP-1 mRNAs are expressed in many other retinal cells at low levels. Our immunohistochemical analysis for NP-1, as well as previous reports regarding Flk-1, revealed the low levels of expression of these molecules in the inner nuclear layer, which contains a large proportion of retinal cells.38

The signals of VEGF, which regulates cell migration, proliferation, and differentiation, is received by molecular complex of the transmembrane tyrosine kinases, a coreceptor (NP-1 or NP-2), and a modulator (a heparan sulfate proteoglycan).13 14 Although the precise roles of these molecules in neovascularization have not been established, further analyses are essential for the successful development of better treatment regimens and prevention of ROP and other retinal vascular diseases.


    Footnotes
 
Submitted for publication September 26, 2000; revised January 12, 2001; accepted January 24, 2001.

Commercial relationships policy: N.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Hidenori Ishihama, Department of Biochemistry, Nagoya University School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550, Japan. ishihama{at}tsuru.med.nagoya-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gibson, DL, Sheps, SB, Uh, SH, Schechter, MT, McCormick, AQ (1990) Retinopathy of prematurity-induced blindness: birth weight-specific survival and the new epidemic Pediatrics 86,405-412[Abstract/Free Full Text]
  2. Stone, J, Itin, A, Alon, T, et al (1995) Development of retinal vasculature is mediated by hypoxia-induced vascular endothelial growth factor (VEGF) expression by neuroglia J Neurosci 15,4738-4747[Abstract]
  3. Gospodarowicz, D, Abraham, JA, Schilling, J. (1989) Isolation and characterization of a vascular endothelial cell mitogen produced by pituitary-derived folliculo stellate cells Proc Natl Acad Sci USA 86,7311-7315[Abstract/Free Full Text]
  4. Jonca, F, Ortega, N, Gleizes, PE, Bertrand, N, Plouet, J. (1997) Cell release of bioactive fibroblast growth factor 2 by exon 6-encoded sequence of vascular endothelial growth factor J Biol Chem 272,24203-24209[Abstract/Free Full Text]
  5. Senger, DR, Perruzzi, CA, Feder, J, Dvorak, HF (1986) A highly conserved vascular permeability factor secreted by a variety of human and rodent tumor cell lines Cancer Res 46,5629-5632[Abstract/Free Full Text]
  6. Michaelson, IC (1948) The mode of development of vascular system of retina, with some observations on its significance for certain retinal disease Trans Ophthalmol Soc UK 68,137-180
  7. Ashton, N, Ward, B, Serpell, G. (1954) Effect of oxygen on developing retinal vessels with particular reference to the problem of retrolental fibroplasia Br J Ophthalmol 38,397-432
  8. Plate, KH, Breier, G, Weich, HA, Risau, W. (1992) Vascular endothelial growth factor is a potential tumour angiogenesis factor in human gliomas in vivo Nature 359,845-848[Medline][Order article via Infotrieve]
  9. Shweiki, D, Itin, A, Soffer, D, Keshet, E. (1992) Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis Nature 359,843-845[Medline][Order article via Infotrieve]
  10. Kim, KJ, Li, B, Winer, J, et al (1993) Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo Nature 362,841-844[Medline][Order article via Infotrieve]
  11. Pierce, EA, Avery, RL, Foley, ED, Aiello, LP, Smith, LE (1995) Vascular endothelial growth factor/vascular permeability factor expression in a mouse model of retinal neovascularization Proc Natl Acad Sci USA 92,905-909[Abstract/Free Full Text]
  12. Pierce, EA, Foley, ED, Smith, LE (1996) Regulation of vascular endothelial growth factor by oxygen in a model of retinopathy of prematurity Arch Ophthalmol 114,1219-1228[Abstract]
  13. Neufeld, G, Cohen, T, Gengrinovitch, S, Poltorak, Z. (1999) Vascular endothelial growth factor (VEGF) and its receptors FASEB J 13,9-22[Abstract/Free Full Text]
  14. Ortega, N, Hutchings, H, Plouet, J. (1999) Signal relays in the VEGF system Front Biosci 4,D141-D152[Medline][Order article via Infotrieve]
  15. de Vries, C, Escobedo, JA, Ueno, H, Houck, K, Ferrara, N, Williams, LT (1992) The fms-like tyrosine kinase, a receptor for vascular endothelial growth factor Science 255,989-991[Abstract/Free Full Text]
  16. Terman, BI, Dougher–Vermazen, M, Carrion, ME, et al (1992) Identification of the KDR tyrosine kinase as a receptor for vascular endothelial cell growth factor Biochem Biophys Res Commun 187,1579-1586[Medline][Order article via Infotrieve]
  17. Shalaby, F, Rossant, J, Yamaguchi, TP, et al (1995) Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice Nature 376,62-66[Medline][Order article via Infotrieve]
  18. Fong, GH, Rossant, J, Gersenstein, M, Breitman, ML (1995) Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium Nature 376,66-70[Medline][Order article via Infotrieve]
  19. Takagi, S, Tsuji, T, Amagai, T, Takamatsu, T, Fujisawa, H. (1987) Specific cell surface labels in the visual centers of Xenopus laevis tadpole identified using monoclonal antibodies Dev Biol 122,90-100[Medline][Order article via Infotrieve]
  20. Takagi, S, Hirata, T, Agata, K, Mochii, M, Eguchi, G, Fujisawa, H. (1991) The A5 antigen, a candidate for the neuronal recognition molecule, has homologies to complement components and coagulation factors Neuron 7,295-307[Medline][Order article via Infotrieve]
  21. Takagi, S, Kasuya, Y, Shimizu, M, et al (1995) Expression of a cell adhesion molecule, neuropilin, in the developing chick nervous system Dev Biol 170,207-222[Medline][Order article via Infotrieve]
  22. Kawakami, A, Kitsukawa, T, Takagi, S, Fujisawa, H. (1996) Developmentally regulated expression of a cell surface protein, neuropilin, in the mouse nervous system J Neurobiol 29,1-17[Medline][Order article via Infotrieve]
  23. He, Z, Tessier–Lavigne, M. (1997) Neuropilin is a receptor for the axonal chemorepellent semaphorin III Cell 90,739-751[Medline][Order article via Infotrieve]
  24. Kolodkin, AL, Levengood, DV, Rowe, EG, Tai, YT, Giger, RJ, Ginty, DD (1997) Neuropilin is a semaphorin III receptor Cell 90,753-762[Medline][Order article via Infotrieve]
  25. Soker, S, Takashima, S, Mioa, H, Neufeld, G, Klagsbrun, M. (1998) Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor Cell 92,735-745[Medline][Order article via Infotrieve]
  26. Giger, RJ, Urguhart, ER, Gillespeie, SK, Levengood, DV, Ginty, DD, Kolodkin, AL (1998) Neuropilin-2 is a receptor for semaphorin IV: insight into the structural basis of receptor function and specificity Neuron 21,1079-1092[Medline][Order article via Infotrieve]
  27. Gluzman–Poltorak, Z, Cohen, T, Herzog, Y, Neufeld, G. (2000) Neuropilin-2 and neuropilin-1 are receptors for the 165-amino acid form of vascular endothelial growth factor (VEGF) and of placenta growth factor-2, but only neuropilin-2 functions as a receptor for the 145-amino acid form of VEGF J Biol Chem 275,18040-18045[Abstract/Free Full Text]
  28. Smith, LE, Wesolowski, E, McLellan, A, Kostyk, SK, D’Amato, R, Sullivan, R, D’Amore, PA (1994) Oxygen-induced retinopathy in the mouse Invest Ophthalmol Vis Sci 35,101-111[Abstract/Free Full Text]
  29. Fan, QW, Yuasa, S, Kuno, N, et al (1998) Expression of basigin, a member of the immunoglobulin superfamily, in the mouse central nervous system Neurosci Res 30,53-63[Medline][Order article via Infotrieve]
  30. Horiba, M, Kadomatsu, K, Nakamura, E, et al (2000) Neointima formation in a restenosis model is suppressed in midkine-deficient mice J Clin Invest 105,489-495[Medline][Order article via Infotrieve]
  31. Kitsukawa, T, Shimono, A, Kawakami, A, Kondoh, H, Fujisawa, H. (1995) Overexpression of a membrane protein, neuropilin, in chimeric mice causes anomalies in the cardiovascular system, nervous system and limbs Development 121,4309-4318[Abstract]
  32. Kitsukawa, T, Shimizu, M, Sanbo, M, et al (1997) Neuropilin-semaphorin III/D-mediated chemorepulsive signals play a crucial role in peripheral nerve projection in mice Neuron 19,995-1005[Medline][Order article via Infotrieve]
  33. Hatva, E, Kaipainen, A, Mentula, P, et al (1995) Expression of endothelial cell-specific receptor tyrosine kinases and growth factors in human brain tumors Am J Pathol 146,368-378[Abstract]
  34. Miao, HO, Lee, P, Lin, H, Soker, S, Klagsbrun, M. (2000) Neuropilin-1 expression by tumor cells promotes tumor angiogenesis and progression FASEB J 14,2532-2539[Abstract/Free Full Text]
  35. Ding, H, Wu, X, Roncari, L, et al (2000) Expression and regulation of neuropilin-1 in human astrocytomas Int J Cancer 88,584-592[Medline][Order article via Infotrieve]
  36. Gerber, HP, Condorelli, F, Park, J, Ferrara, N. (1997) Differential transcriptional regulation of the two vascular endothelial growth factor receptor genes. Flt-1, but not Flk-1/KDR, is up-regulated by hypoxia J Biol Chem 19,23659-23667
  37. Walten, J, Mayr, U, Pentz, S, Hombach, V. (1996) Functional upregulation of the vascular endothelial growth factor receptor KDR by hypoxia Circulation 94,1647-1654[Abstract/Free Full Text]
  38. Yang, K, Cepko, CL (1996) Flk-1, a receptor for vascular endothelial growth factor (VEGF), is expressed by retinal progenitor cells J Neurosci 16,6089-6099[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
IOVSHome page
S. Satofuka, A. Ichihara, N. Nagai, T. Koto, H. Shinoda, K. Noda, Y. Ozawa, M. Inoue, K. Tsubota, H. Itoh, et al.
Role of Nonproteolytically Activated Prorenin in Pathologic, but Not Physiologic, Retinal Neovascularization
Invest. Ophthalmol. Vis. Sci., January 1, 2007; 48(1): 422 - 429.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
N. Nagai, K. Noda, T. Urano, Y. Kubota, H. Shinoda, T. Koto, K. Shinoda, M. Inoue, T. Shiomi, E. Ikeda, et al.
Selective Suppression of Pathologic, but Not Physiologic, Retinal Neovascularization by Blocking the Angiotensin II Type 1 Receptor
Invest. Ophthalmol. Vis. Sci., March 1, 2005; 46(3): 1078 - 1084.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ishihama, H.
Right arrow Articles by Muramatsu, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ishihama, H.
Right arrow Articles by Muramatsu, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS