(Investigative Ophthalmology and Visual Science. 2001;42:1553-1560.)
© 2001
by The Association for Research in Vision and Ophthalmology, Inc.
Inhibitory Effects of Antithrombin III against Leukocyte Rolling and Infiltration during Endotoxin-Induced Uveitis in Rats
Kenji Yamashiro1,
Junichi Kiryu1,
Akitaka Tsujikawa1,
Megumi Honjo1,
Atsushi Nonaka1,
Kazuaki Miyamoto1,
Yoshihito Honda1,
Hidenobu Tanihara1 and
Yuichiro Ogura2
1 From the Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Japan; and the
2 Department of Ophthalmology, Nagoya City University Medical School, Japan.
 |
Abstract
|
|---|
PURPOSE. This study was designed to investigate the suppressive effects of
antithrombin (AT)III on inflammatory reactions during endotoxin-induced
uveitis (EIU) in rats by studying leukocyteendothelium interactions.
METHODS. EIU was induced in Lewis rats by footpad injection of
lipopolysaccharide (LPS). ATIII was administered immediately after or
at 6 hours after LPS injection. Its suppressive effects on inflammatory
leukocyte behavior were evaluated in vivo with acridine orange digital
fluorography. Clinical signs of inflammation were also examined, and
aqueous humor (AH) was collected to evaluate leukocyte infiltration and
protein leakage. In a separate experiment, P-selectin mRNA expression
was studied in the iris-ciliary body (ICB) and the retina.
RESULTS. After treatment with ATIII, leukocyte rolling was substantially
inhibited along the retinal veins, suppressing subsequent leukocyte
infiltration into the vitreous cavity. Similarly, leukocyte
infiltration and protein leakage into the AH were significantly reduced
with ATIII treatment. The clinical grade of EIU was substantially lower
in ATIII-treated rats. In addition, delayed administration of ATIII
after EIU induction significantly attenuated these inflammatory
reactions. The levels of P-selectin mRNA expression in both ICB and
retina, which were upregulated after LPS injection, were substantially
lower in the ATIII-treated rats.
CONCLUSIONS. ATIII treatment significantly inhibited inflammatory reactions induced
with LPS. Its suppressive effects on P-selectin expression could
contribute to the attenuation of leukocyte infiltration, possibly by
inhibiting leukocyte rolling. The current findings suggest that ATIII
may have a role in the management of patients with
uveitis.
 |
Introduction
|
|---|
Antithrombin (AT)III is an important endogenous inhibitor
of serine proteases that are generated within the coagulation cascade.
Clinically, it has been widely used as treatment for ATIII deficiency
or disseminated intravascular coagulation. Recently, it has been
demonstrated that ATIII may have other functions in addition to its
role in inhibiting clotting. OReilly et al.1
have shown
its remarkable antiangiogenic and antitumor activities. In addition,
some investigators have reported that ATIII suppresses leukocyte
infiltration and subsequent tissue damage in endotoxin-induced vascular
injury,2
or ischemiareperfusion (I/R)
injury.3
4
In the field of septic shock, the suppressive
effects of ATIII on inflammation have been highlighted.5
6
In patients with severe sepsis, treatment with ATIII improved lung
function and prevented septic liver and kidney failure.7
Now, ATIII is attracting a great deal of attention as a possible
treatment for these various kinds of conditions, because no adverse
side effects have been reported in human trials.8
However,
little information is available about the effects of ATIII on ocular
inflammation and the mechanisms of its anti-inflammatory action.
When generated endogenously or administered intravenously, ATIII is
tethered to the wall of the microvasculature with the help of heparin
and is then bound to the active site on thrombin to suppress its
functions. In addition to its hemostatic role, thrombin has the ability
to induce interactions between endothelial cells and blood-flowing
cells, such as leukocytes9
10
11
or tumor
cells.12
13
Because these interactions are thought to be
the initial step in leukocyte infiltration, tumor invasion, or
metastasis,14
15
the anti-inflammatory and antitumor
properties of ATIII may be based partially on its suppressive effects
on these interactions. In this study, we investigated the
anti-inflammatory effects of ATIII during endotoxin-induced uveitis
(EIU) in rats by studying leukocyte-endothelium interactions in vivo.
EIU is an animal model of ocular inflammation induced by subcutaneous
injection of lipopolysaccharide (LPS).16
17
It is
characterized by bloodocular barrier disruption and leukocyte
infiltration. At sites of inflammation, the recruitment of circulating
leukocytes out of the vessels is thought to occur through a multistep
cascade of leukocyteendothelium interactions involving sequential
rolling, firm adhesion, and transmigration into inflamed
tissues.14
15
18
19
20
To investigate these interactions in
vivo, intravital microscopy is a popular technique. In this technique,
acridine orange (AO) is widely used to label
leukocytes.21
22
23
24
25
26
27
28
29
30
By investigating the AO-stained
leukocytes in eyes, we have clearly visualized and quantitatively
evaluated each step of leukocyte recruitment in the retina and the
vitreous during EIU.31
32
Although EIU in rats has been
thought to be predominantly an anterior uveitis model, in vivo
evaluation of the sequential leukocyte behavior in the posterior
segment of eyes would be helpful to investigate the mechanism by which
ATIII blocks the development of EIU.
During this multistep cascade of leukocyte infiltration, each process
is mediated by distinct adhesion molecules and is regulated
elaborately.14
15
18
19
20
Previous studies have
demonstrated that monoclonal antibodies against these adhesion
molecules can suppress leukocyte infiltration during
EIU.33
34
35
36
37
38
39
We have shown that, among these adhesion
molecules, P-selectin contributes to leukocyte rolling during
EIU.39
Before mediating leukocyte rolling, P-selectin
should be expressed on endothelial cells in response to a stimulator
such as thrombin. Therefore, we hypothesized that ATIII might
downregulate P-selectin expression and thereby suppress
leukocyteendothelium interactions to block the development of EIU in
rats. To verify our hypothesis, we evaluated P-selectin gene expression
in the iris-ciliary body (ICB) and the retina.
 |
Methods
|
|---|
Animal Model
Animals were handled in accordance with the ARVO Statement for
the Use of Animals in Ophthalmic and Vision Research. EIU was induced
in female Lewis rats, each weighing approximately 200 g, by
injecting 100 µg of LPS (Salmonella typhimurium; Difco
Laboratories, Detroit, MI) diluted in 0.1 ml sterile saline into one
hind footpad. Control animals received a footpad injection of saline
alone.
Treatment
ATIII, obtained from Aventis Pharma (Frankfurt, Germany), was
purified from heat-treated, pooled human plasma by absorption on fixed
heparin according to a modified version of the technique of
Miller-Anderson et al.40
The purity of ATIII concentrates
used in this experiment had been shown by two-dimensional
immunoelectrophoresis (Fig. 1) . The concentrations of heparin and other antiproteases such as
2-macroglobulin and
1-antitrypsin were less than 0.4 IU/ml and 0.5
mg/dl, respectively, and the ATIII was free of pathogens. The ATIII
concentrate was stored at -80°C until use.

View larger version (96K):
[in this window]
[in a new window]
|
Figure 1. Two-dimensional immunoelectrophoresis pattern of the ATIII concentrate
used in this experiment.
|
|
The effects of various doses of ATIII on endotoxin-induced endothelial
cell injury in rats have already been evaluated.41
42
These studies have demonstrated that 250 U/kg is needed to prevent
endothelial cell injury, whereas lower doses are not sufficient.
Indeed, some groups have investigated its anti-inflammatory effect
using doses of 250 U/kg of ATIII in rats2
3
4
43
44
45
and
other animals.6
46
47
In the present study, 250 U/kg of
ATIII was injected intravenously immediately after LPS injection. Six
different rats were used at each time point in both untreated and
ATIII-treated groups. In another experiment, to evaluate the efficacy
of delayed administration of ATIII, 250 U/kg of ATIII was injected
intravenously 6 hours after LPS injection.
To test the specificity of ATIII activity, inactivated ATIII, which was
boiled at 100°C for 10 minutes, was administered immediately after
LPS injection (n = 6).
AO Digital Fluorography
AO digital fluorography has been described
elsewhere.48
49
In this technique, a scanning laser
ophthalmoscope (SLO; Rodenstock Instruments, Munich, Germany) coupled
with a computer-assisted image analysis system makes continuous
high-resolution images of the fundus of animals injected with the
metachromatic fluorochrome AO (Wako Pure Chemical, Osaka, Japan). The
obtained images are recorded on S-VHS videotape at the rate of 30
frames/sec for further analysis.
Immediately before AO digital fluorography was performed, rats were
anesthetized with a 1:1 mixture of xylazine hydrochloride (4 mg/kg) and
ketamine hydrochloride (10 mg/kg) and the pupils dilated with 0.5%
tropicamide and 2.5% phenylephrine hydrochloride. In each rat, a
catheter was inserted into the tail vein. Arterial blood pressure was
monitored with a blood pressure analyzer (IITC, Woodland Hills, CA).
The rat was then placed on a movable platform, and AO (0.1% solution
in saline) was injected through the tail vein catheter. The fundus was
observed with the SLO in the 40° field. The behavior of leukocytes
can be observed within several seconds after AO infusion, because the
dye circulation time is less than 10 seconds, and AO is so
membrane-permeable that leukocytes can be stained shortly after its
infusion. Once infused, AO permeates the tissues gradually. Therefore,
AO was injected for 1 minute at a rate of 1 ml/min to investigate the
behavior of leukocytes for a few minutes. At 20 minutes after the
injection of AO, the fundus was observed again to evaluate leukocyte
infiltration into the vitreous cavity.29
AO is thought to be a mutagenic and carcinogenic agent, and
phototoxicity also has been noted after exposure of AO to
light.50
However, AO has been used to study leukocyte
behavior in various organs,21
22
23
24
25
26
27
28
29
30
and no undesirable
effect on microcirculation of the dye has been reported.
Image Analysis
The video recordings were analyzed with an image analysis system
consisting of a computer equipped with a video digitizer (Radius, San
Jose, CA). The video image was digitized in real time (30 frames/sec)
to 640 horizontal and 480 vertical pixels with an intensity resolution
of 256 steps.
Rolling leukocytes were defined as leukocytes that moved more slowly
than free-flowing leukocytes. To evaluate the number of rolling
leukocytes, a locus 1 disc diameter away from the center of the optic
disc was picked up in each vessel. The number of rolling leukocytes
passing through this locus for 1 minute was counted. This was defined
as the number of rolling leukocytes in a vessel. We then calculated the
average number of rolling leukocytes in all major veins. This was used
as the flux of rolling leukocytes in a given rat. The number of
leukocytes infiltrating into the vitreous was determined by counting
the number of fluorescent dots in the vitreous within a circle with a
radius of 1 disc diameter from the center of the optic disc.
Vessel diameters were measured at 1 disc diameter from the center of
the optic disc in monochromatic images recorded before AO injection.
Each vessel diameter was calculated in pixels as the distance between
the half-height points determined separately on each side of the
density profile of the vessel image. Averages of the arterial and
venous diameters were used as the arterial and venous diameters for
each rat. After the experiment, each rat was killed with an overdose of
anesthesia, and the study eye was enucleated to determine a calibration
factor to convert values measured on a computer monitor (in pixels)
into real values (in micrometers).
Clinical Scoring
Clinical scoring of EIU was performed using the classification
of Hoekzema et al.51
The eyes were examined clinically
with a slit lamp, and the uveitis was graded using the following
scoring system: iris hyperemia, grades 02; flare, 01; cells in the
anterior chamber, 02; hypopyon, 01; and miosis, 01. The maximum
possible score was 7.
Analysis of Leukocytes and Protein in Aqueous Humor
Aqueous humor (AH) was collected by anterior chamber puncture
using a 27-gauge needle. For the leukocyte count, the sample was
suspended with an equal volume of 0.4% trypan blue stain solution, and
the leukocytes were counted under a light microscope. The concentration
of protein in AH was determined using a protein assay kit (Bio-Rad
Laboratories, Hercules, CA) and dilution of bovine serum albumin (Sigma
Chemical, St. Louis, MO) as a standard.
P-Selectin Gene Expression
To evaluate the effect of ATIII on P-selectin mRNA expression,
the ICB and the retina were collected from the eyes of the following
three groups: control rats, untreated rats receiving LPS, and rats
treated with ATIII (250 U/kg) at the time of LPS injection. Total RNA
was isolated from the pooled ICB or retina of both eyes of each rat,
according to the acid guanidinium thiocyanate-phenol-chloroform
extraction method.52
The extracted RNA was quantified, and
4 µg was used to make cDNA with a cDNA synthesis kit (First Strand;
Pharmacia Biotech, Uppsala, Sweden). Polymerase chain reaction (PCR)
was performed using the method of Saiki et al.53
with
slight modification. The following conditions were used: denaturation,
95°C for 30 seconds; annealing, 55°C for 30 seconds; extension,
72°C for 60 seconds. The reaction was initiated by adding two units
of polymerase (Taq NA; Perkin ElmerCetus, Norwalk, CT),
after which 30 cycles for P-selectin and 25 cycles for
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were performed. The
primers used in this experiment were GCAGACAACGAGCCCAATAACA (sense) and
AGTGCAGTGGAGTATGTCAGAG (antisense) for P-selectin and
TGGCACAGTCAAGGCTGAGA (sense) and CTTCTGAGTGGCAGTGATGG (antisense) for
GAPDH.54
55
Nucleotide sequencing and restriction pattern
analysis confirmed that PCR products were derived from the target cDNA
sequences. To quantify the P-selectin gene expression, PCR was
performed in a semiquantitative manner.56
In this
procedure, 2 µCi of radiolabeled dCTP was added to the PCR reaction
mixture. The PCR products were then electrophoresed, the bands excised,
and the radioactivity incorporated in the DNA measured by Cerenkov
scintillation counting.
Statistical Analysis
All values are expressed as mean ± SEM. Students
t-test with Welchs correction was used to compare two
groups. To compare three or more conditions, statistical analysis was
performed by analysis of variance, with post hoc comparisons tested by
Scheffés procedure. Spearmans rank correlation was used to
test correlation. Differences were considered statistically significant
at P < 0.05.
 |
Results
|
|---|
Leukocyte Rolling
No rolling leukocytes were identified in control rats, but
leukocyte rolling was observed in rats with EIU, but only in major
retinal veins. The flux of rolling leukocytes in EIU rats increased
gradually after LPS injection and reached its peak at 12 hours. The
correlation between venous diameter and the number of rolling
leukocytes in EIU at 12 hours after LPS injection is shown in Figure 2
. The number of rolling leukocytes had no significant correlation with
the diameter of the vein. Figure 3
shows the effects of ATIII on the flux of rolling leukocytes along the
major retinal veins. ATIII administered immediately after LPS injection
significantly inhibited leukocyte rolling, compared with untreated rats
(P < 0.0001). The flux of rolling leukocytes in
ATIII-treated rats was reduced by 89.6% (P = 0.0062),
83.5% (P < 0.0001), 72.7% (P =
0.0090), and 53.1% (P = 0.020) at 6, 12, 24, and 48
hours after LPS injection, respectively.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 2. Relationship between vessel diameter and number of rolling leukocytes
along the major retinal veins in EIU at 12 hours after LPS injection.
No significant correlation was detected.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3. Effect of ATIII on the flux of rolling leukocytes after EIU induction.
ATIII was administered immediately after LPS injection. Values are
mean ± SEM (n = 6 at each time point in both
groups). *P < 0.01, P <
0.05, compared with untreated rats.
|
|
Leukocyte Infiltration into Vitreous Cavity
In the control rats, no leukocytes were observed in the vitreous.
With the induction of EIU, the number of leukocytes that infiltrated
the vitreous cavity was increased from 24 hours after EIU induction,
and peaked at 48 hours (Fig. 4)
. However, leukocyte infiltration into the vitreous cavity was
significantly suppressed with ATIII treatment (P =
0.0004). At 48 hours after LPS injection, the maximum number of
leukocytes in the vitreous cavity was reduced by 56.3% in
ATIII-treated rats compared with untreated rats (P =
0.0086, Fig. 5
).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 4. Effect of ATIII on the number of leukocytes infiltrating the vitreous
cavity after LPS injection. ATIII was administered immediately after
LPS injection. Values are mean ± SEM (n = 6
at each time point in both groups). *P < 0.01,
P < 0.05, compared with untreated rats.
|
|

View larger version (94K):
[in this window]
[in a new window]
|
Figure 5. Digitized fundus images of an untreated rat (A) and of an
ATIII-treated rat (B) at 48 hours after LPS injection. These
images were taken at 20 minutes after AO injection. Leukocytes
infiltrating the vitreous were observed as fluorescent
(white) dots, whereas circulating or rolling
leukocytes showed no fluorescence, because the dye was washed out. The
fluorescent dots within the circle (radius, 1
disc diameter from the center of the optic disc) were counted.
|
|
Major Retinal Vessel Diameters
Figure 6
shows the changes in major retinal vessel diameters in untreated rats
and ATIII-treated rats. Both arteries and veins showed substantial
vasodilation after EIU induction. In ATIII-treated rats, however,
vasodilation in arteries and veins was significantly suppressed,
compared with that in untreated rats (P < 0.0001 for
both arteries and veins). The diameters of major retinal arteries and
veins, in ATIII-treated rats were reduced by 16.0% (P = 0.0026) and 29.2% (P = 0.0015), respectively, at 24
hours after LPS injection (Fig. 7)
.

View larger version (73K):
[in this window]
[in a new window]
|
Figure 7. Digitized fundus images of an untreated rat (A) and of an
ATIII-treated rat (B) at 24 hours after LPS injection. These
images were taken before AO injection.
|
|
Clinical Score
Clinical scores in untreated and ATIII-treated rats were studied
at 24 hours after EIU induction. Rats treated with ATIII immediately
after EIU induction showed significantly reduced signs of inflammation
compared with untreated rats (P = 0.0005). Untreated
eyes had a mean clinical uveitis score of 5.5 ± 0.3, whereas
ATIII-treated eyes had a mean clinical score of 3.0 ± 0.4.
Leukocyte Infiltration and Protein Leakage into AH
Figure 8
shows the effects of ATIII administered immediately after LPS injection
on leukocyte count and protein concentration in AH. In untreated rats,
both leukocyte count and protein concentration in AH gradually
increased after EIU induction and reached a peak level at 24 hours. In
ATIII-treated rats, however, leukocyte count and protein concentration
in AH were significantly lower than in untreated rats
(P < 0.0001 for both leukocyte count and protein
concentration). At 24 hours after LPS injection, ATIII treatment
suppressed leukocyte infiltration in AH by 90.8% (P =
0.00,068) and protein leakage by 77.4% (P = 0.00,033).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 8. Effects of ATIII on leukocyte infiltration (A) and protein
leakage (B) into AH after LPS injection. ATIII was
administered immediately after LPS injection. Values are mean ±
SEM (n = 6 at each time point in both groups).
*P < 0.01, P < 0.05,
compared with untreated rats.
|
|
Blood Pressure and Leukocyte Count in Peripheral Blood
We measured the mean arterial blood pressure and peripheral
leukocyte count in both ATIII-treated and untreated groups. There were
no significant differences between groups.
Effects of Inactivated ATIII
As shown in Table 1
, inactivated ATIII, which was administered immediately after LPS
injection, did not suppress leukocyte rolling in retinal veins,
leukocyte infiltration into vitreous cavity, vasodilation of retinal
vessels, clinical score, leukocyte infiltration into AH, or protein
leakage into AH.
Effects of ATIII Administered at 6 Hours after LPS Injection
Figure 9
shows the effects of ATIII administered 6 hours after LPS injection.
Similar to the concomitant treatment with ATIII, delayed administration
of ATIII significantly suppressed leukocyte rolling in retinal veins at
12 hours (P < 0.0001) and subsequent leukocyte
infiltration into the vitreous cavity at 48 hours (P =
0.0006). Vasodilation in arteries and veins at 24 hours was also
significantly suppressed in ATIII-treated rats (P =
0.0004 and P = 0.0006, respectively). As for the
anterior uveitis, ATIII-treated rats showed significantly reduced signs
of inflammation at 24 hours (P = 0.018). Moreover,
leukocyte count and protein concentration in AH were significantly
lower in ATIII-treated rats at the peak of the anterior uveitis
(P = 0.0006 and P = 0.023).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 9. Effects of delayed treatment with ATIII. ATIII was administered at 6
hours after LPS injection. Flux of rolling leukocytes at 12 hours
(A), numbers of leukocytes infiltrating into vitreous cavity
at 48 hours (B), diameter of major retinal arteries
(C) and veins (D) at 24 hours, clinical grade at
24 hours (E), and leukocyte count (F) and protein
concentration (G) in AH at 24 hours after LPS injection.
Values are mean ± SEM (n = 6 at each time point
in each group). *P < 0.01,
P < 0.05, compared with untreated rats.
|
|
Gene Expression of P-Selectin
The levels of gene expression were shown as a ratio to the average
values of control rats (Fig. 10)
. At 6 hours after LPS injection, P-selectin mRNA expression was
upregulated in both ICB and retina. ATIII treatment immediately after
LPS injection significantly suppressed P-selectin mRNA expression in
the ICB (P = 0.014) and the retina (P =
0.047).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 10. Effects of ATIII on P-selectin gene expression in iris-ciliary body
(A) and retina (B) at 6 hours after LPS
injection. ATIII was administered immediately after LPS injection.
Typical electrophoresis pattern of PCR products for P-selectin in
iris-ciliary body (C) and retina (D).
Top: P-selectin; bottom: GAPDH. Lane
C: control; lane U: untreated; lane A:
ATIII-treated. Values are mean ± SEM (n = 6 at
each time point in both groups). *P < 0.05, compared
with untreated rats.
|
|
 |
Discussion
|
|---|
In the present study, we demonstrated that ATIII blocked leukocyte
rolling along the major retinal veins and subsequent leukocyte
infiltration into the vitreous cavity during EIU in rats. Although EIU
is thought to be predominantly an anterior uveitis model, increasing
numbers of studies have demonstrated leukocyte infiltration in the
posterior segment of the eye.38
57
58
59
60
61
62
63
Moreover, direct
observation of the fundus with SLO demonstrated remarkable vasodilation
of retinal vessels in EIU,31
39
which had been reported to
be very mild in a study using histologic examination.57
Although leukocyte behavior in the posterior segment might be somewhat
different from that in anterior uveitis, it would be helpful to
evaluate the sequential steps of leukocyte infiltration to understand
the mechanism of anti-inflammatory drugs.
Accumulating evidence indicates that the recruitment of circulating
leukocytes into inflamed tissue is mediated through a multistep cascade
of events involving sequential rolling, firm adhesion, and
transmigration.19
Among these processes of
leukocyte infiltration, the present study showed that ATIII suppressed
leukocyte rolling in retinal veins. Leukocyte rolling is the initial
step and prerequisite for the subsequent steps resulting in leukocyte
infiltration.19
In this study, the number of leukocytes
infiltrating the vitreous cavity was also successfully reduced with
ATIII treatment. Moreover, ATIII suppressed vasodilation in the retina.
Its inhibitory effects on leukocyte infiltration would contribute to
its suppressive effects on retinal vasodilation, because accumulated
leukocytes can produce a large amount of nitric oxide. We have
demonstrated that anti-P-selectin monoclonal antibody can suppress
vasodilation in addition to its effect of suppressing leukocyte rolling
and subsequent infiltration in EIU.
We also demonstrated that ATIII significantly inhibited P-selectin mRNA
expression in the retina and ICB at 6 hours after EIU induction.
P-selectin is a key mediator of leukocyte rolling along inflamed
endothelial cells,64
65
66
and our previous study showed
that P-selectin mediates leukocyte rolling in EIU as
well.39
The peak time point of P-selectin gene expression
in the retina of EIU rat is reportedly at 6 and 24 hours after LPS
injection, whereas leukocyte rolling in the veins reached a peak at 12
hours.39
Therefore, our finding of suppressed P-selectin
gene expression at 6 hours would account for the reduced leukocyte
rolling at 12 hours. ATIII would suppress leukocyte rolling by
inhibiting the expression of P-selectin on the endothelial cells of
retinal veins.
Furthermore, ATIII treatment substantially reduced leukocyte
infiltration in the AH. Our experiment using PCR demonstrated that
ATIII suppressed P-selectin mRNA expression in the ICB at 6 hours after
EIU induction. The P-selectin expression in the iris vessels is
reportedly prominent at from 5 to 7 hours after LPS
injection,37
and leukocyte rolling in iris vessels has
been shown to increase during EIU in rats.67
Therefore,
the suppression of P-selectin mRNA expression could account for the
anti-inflammatory effects of ATIII on anterior uveitis, partly through
inhibition of leukocyte rolling in the anterior uveal vessels.
Moreover, ATIII successfully suppressed protein leakage into AH. The
attenuation of the process of leukocyte infiltration may contribute to
the protective effects on bloodocular barrier disruption during EIU
as well as its suppressive effects on vasodilation in the retina.
Experimental autoimmune uveitis (EAU) is a model of chronic uveitis. We
have demonstrated that rolling leukocytes can be observed in the major
retinal veins during EAU.68
Also in EAU, adhesion
molecules such as L-selectin, intercellular adhesion molecule-1, and
lymphocyte function associated antigen-1 have been shown to play
important roles during leukocyte infiltration,69
70
71
and
therefore ATIII may have a role in the management of the more chronic
type of inflammation by downregulating these adhesion molecules.
Among various studies on the suppressive effects of ATIII on
LPS-induced inflammation both in vitro72
and in
vivo,2
3
4
5
6
43
44
45
46
73
74
there is no report that ATIII binds
LPS. The possibility that ATIII binds LPS cannot be denied, but ATIII
would then exert its ani-inflammatory effects by inhibiting later
conditions induced by LPS. We demonstrated that ATIII administered at 6
hours after LPS injection still had anti-inflammatory effects on EIU,
and thus it may be that ATIII suppresses leukocyte infiltration during
EIU by downregulation of P-selectin expression, rather than by binding
LPS.
The method for ATIII purification has been established, and various
effects of ATIII have been investigated using this
method.2
3
6
43
44
45
73
The purity of the ATIII
concentration used in this study was shown, and other antiproteases
were below detectable levels. The anti-inflammatory effects observed in
the present study could thus be said to originate from ATIII itself.
In contrast to the anti-inflammatory effects of ATIII at 12 and 24
hours after LPS injection, its effects were somewhat weakened at 48
hours. This could be explained by the half-life of ATIII, which in rats
is reportedly 12 hours.75
When administered immediately
after LPS injection, sufficient concentrations of ATIII could not be
maintained for 48 hours. In support of this view, ATIII administered at
6 hours after LPS injection suppressed leukocyte infiltration into the
vitreous cavity at 48 hours, more effectively than when administered
immediately after LPS injection.
Clinically, it is valuable to know that ATIII has a significant
inhibitory effect when administered after EIU has been established.
ATIII has been reported to attenuate organ damage when administered
after endotoxin challenge in animal models of
endotoxemia.42
Furthermore, patients with severe sepsis
who were treated with ATIII showed improvement of lung function and did
not experience septic liver and kidney failure.7
Accordingly, ATIII may be useful not only preventatively, but may also
work therapeutically for ocular inflammations.
Today, steroids are widely used in the treatment of uveitis. Similar to
ATIII, steroids are endogenous agents that have various effects.
However, their adverse side effects can cause serious problems. In
contrast, ATIII has been used widely and safely in humans and may thus
be useful when used in conjunction with other treatments for uveitis.
 |
Footnotes
|
|---|
Supported by a grant-in-aid for Scientific Research from the Ministry of Education, Science, and Culture, Tokyo, Japan (JK, YO, YH).
Submitted for publication July 31, 2000; revised January 29, 2001; accepted February 7, 2001.
Commercial relationships policy: N.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Junichi Kiryu, Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, 54 Kawara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. kiryu{at}kuhp.kyoto-u.ac.jp
 |
References
|
|---|
-
OReilly, MS, Pirie-Shepherd, S, Lane, WS, Folkman, J. (1999) Antiangiogenic activity of the cleaved conformation of the serpin antithrombin Science 285,1926-1928[Abstract/Free Full Text]
-
Okajima, K. (1998) Antithrombin prevents endotoxin-induced pulmonary vascular injury by inhibiting leukocyte activation Blood Coagul Fibrinolysis 9,S25-S37
-
Harada, N, Okajima, K, Kishimoto, S, Isobe, H, Tanaka, K. (1999) Antithrombin reduces ischemia/reperfusion injury of rat liver by increasing the hepatic level of prostacyclin Blood 93,157-164[Abstract/Free Full Text]
-
Ostrovsky, L, Woodman, RC, Payne, D, Teoh, D, Kubes, P. (1997) Antithrombin III prevents and rapidly reverses leukocyte recruitment in ischemia/reperfusion Circulation 96,2302-2310[Abstract/Free Full Text]
-
Minnema, MC, Chang, AC, Jansen, PM, et al (2000) Recombinant human antithrombin III improves survival and attenuates inflammatory responses in baboons lethally challenged with Escherichia coli Blood 95,1117-1123[Abstract/Free Full Text]
-
Dickneite, G, Leithauser, B. (1999) Influence of antithrombin III on coagulation and inflammation in porcine septic shock Arterioscler Thromb Vasc Biol 19,1566-1572[Abstract/Free Full Text]
-
Inthorn, D, Hoffmann, JN, Hartl, WH, Muhlbayer, D, Jochum, M. (1998) Effect of antithrombin III supplementation on inflammatory response in patients with severe sepsis Shock 10,90-96[Medline][Order article via Infotrieve]
-
Carrell, RW (1999) How serpins are shaping up Science 285,1861-1863[Free Full Text]
-
Vu, TH, Hung, DT, Wheaton, VI, Coughlin, SR (1991) Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation Cell 64,1057-1068[Medline][Order article via Infotrieve]
-
Zimmerman, BJ, Paulson, JC, Arrhenius, TS, Gaeta, FCA, Granger, AN (1994) Thrombin receptor peptide-mediated leukocyte rolling in rat mesenteric venules: roles of P-selectin and sialyl Lewis X Am J Physiol 267,H1049-H1053[Abstract/Free Full Text]
-
Toothill, VJ, Van-Mourik, JA, Niewenhuis, HK, Metzelaar, MJ, Pearson, JD (1990) Characterization of the enhanced adhesion of neutrophil leukocytes to thrombin-stimulated endothelial cells J Immunol 145,283-291[Abstract]
-
Klepfish, A, Greco, MA, Karpatkin, S. (1993) Thrombin stimulates melanoma tumor-cell binding to endothelial cells and subendothelial matrix Int J Cancer 53,978-982[Medline][Order article via Infotrieve]
-
Wojtukiewicz, MZ, Tang, DG, Ciarelli, JJ, et al (1993) Thrombin increases the metastatic potential of tumor cells Int J Cancer 54,793-806[Medline][Order article via Infotrieve]
-
Eugene, CB (1991) Leukocyte-endothelial cell recognition: three (or more) steps to specificity and diversity Cell 67,1033-1036[Medline][Order article via Infotrieve]
-
Osborn, L. (1990) Leukocyte adhesion to endothelium in inflammation Cell 62,3-6[Medline][Order article via Infotrieve]
-
Rosenbaum, JT, McDevitt, HO, Guss, RB, Egbert, PR (1980) Endotoxin-induced uveitis in rats as a model for human disease Nature 286,611-613[Medline][Order article via Infotrieve]
-
Bhattacherjee, P, Williams, RN, Eakins, KE (1983) An evaluation of ocular inflammation following the injection of bacteria endotoxin into the rat foot pad Invest Ophthalmol Vis Sci 24,196-202[Free Full Text]
-
Bevilacqua, MP, Nelson, RM (1993) Selectins J Clin Invest 91,379-387
-
Laurence, MB, Springer, TA (1991) Leukocytes roll on a selectin at physiologic flow rates: distinction from and prerequisite for adhesion through integrins Cell 65,859-873[Medline][Order article via Infotrieve]
-
Zimmerman, GA, Prescott, SM, McIntyre, TM (1992) Endothelial cell interactions with granulocytes: tethering and signaling molecules Immunol Today 13,93-100[Medline][Order article via Infotrieve]
-
Post, S, Menger, MD, Rentsch, M, Gonzalez, AP, Herfarth, C, Messmer, K. (1992) The impact of arterialization on hepatic microcirculation and leukocyte accumulation after liver transplantation in the rat Transplantation 54,789-794[Medline][Order article via Infotrieve]
-
Richardson, M, Berker, A, Roberts, A, Guth, P, Freischlag, JA (1992) In vivo microscopy of rat skeletal muscle after ischemia using labelled neutrophils (PMN) J Surg Res 53,563-567[Medline][Order article via Infotrieve]
-
Wu, NZ, Klitzman, B, Dodge, R, Dewhirst, MW (1992) Diminished leukocyte-endothelium interaction in tumor microvessels Cancer Res 52,4265-4268[Abstract/Free Full Text]
-
Marzi, I, Walcher, F, Buhren, V. (1993) Macrophage activation and leukocyte adhesion after liver transplantation Am J Physiol 265,G172-G177[Abstract/Free Full Text]
-
Mian, R, Marshall, JM (1993) Effect of acute systemic hypoxia on vascular permeability and leucocyte adherence in the anaesthetised rat Cardiovasc Res 27,1531-1537[Abstract/Free Full Text]
-
Lehr, HA, Frei, B, Arfors, KE (1994) Vitamin C prevents cigarette smoke-induced leukocyte aggregation and adhesion to endothelium in vivo Proc Natl Acad Sci USA 91,7688-7692[Abstract/Free Full Text]
-
Sheridan, FM, Cole, PG, Ramage, D. (1996) Leukocyte adhesion to the coronary microvasculature during ischemia and reperfusion in an in vivo canine model Circulation 93,1784-1787[Abstract/Free Full Text]
-
Borgstrom, P, Hughes, GK, Hansell, P, Wolitsky, BA, Sriramarao, P. (1997) Leukocyte adhesion in angiogenic blood vessels: role of E-selectin, P-selectin, and beta2 integrin in lymphotoxin-mediated leukocyte recruitment in tumor microvessels J Clin Invest 99,2246-2253[Medline][Order article via Infotrieve]
-
Masuda, Y, Oguma, T, Kaneko, H. (1998) Intrahepatic flow disturbance as detected by in vivo acridine orange staining in endothelin-1-treated and cirrhotic rats Jpn J Pharmacol 77,315-318[Medline][Order article via Infotrieve]
-
Bouskela, E, Cyrino, FZ, Lerond, L. (1999) Leukocyte adhesion after oxidant challenge in the hamster cheek pouch microcirculation J Vasc Res 1,11-14
-
Miyamoto, K, Ogura, Y, Hamada, M, Nishiwaki, H, Hiroshiba, N, Honda, Y. (1996) In vivo quantification of leukocyte behavior in the retina during endotoxin-induced uveitis Invest Ophthalmol Vis Sci 37,2708-2715[Abstract/Free Full Text]
-
Ogura, Y, Hiroshiba, N, Kiryu, J, Tsujikawa, A, Miyamoto, K, Honda, Y. (1998) In vivo evaluation of leukocyte dynamics in the retinal microcirculation of mice [ARVO Abstract] Invest Ophthalmol Vis Sci 39(4),S995Abstract nr 4599
-
Whitcup, SW, DeBarge, LR, Rosen, H, Nussenblatt, RB, Chan, C-C. (1993) Monoclonal antibody against CD11b/CD18 inhibits endotoxin-induced uveitis Invest Ophthalmol Vis Sci 34,673-681[Abstract/Free Full Text]
-
Whitcup, SW, Hikita, N, Shirao, M, et al (1995) Monoclonal antibodies against CD54 (ICAM-1) and CD11a (LFA-1) prevent and inhibit endotoxin-induced uveitis Exp Eye Res 60,597-601[Medline][Order article via Infotrieve]
-
Kanagawa, T, Matsuda, S, Mikawa, Y, et al (1996) Role of ICAM-1 and LFA-1 in endotoxin-induced uveitis in mice Jpn J Ophthalmol 40,174-180[Medline][Order article via Infotrieve]
-
Whitcup, SW, Kozhich, AT, Lobanoff, M, Wolitzky, BA, Chan, C-C. (1997) Blocking both E-selectin and P-selectin inhibits endotoxin-induced leukocyte infiltration into the eye Clin Immunol Immunopathol 83,45-52[Medline][Order article via Infotrieve]
-
Suzuma, K, Mandai, M, Kogishi, J, Tojo, SJ, Honda, Y. (1997) Role of P-selectin in endotoxin-induced uveitis Invest Ophthalmol Vis Sci 38,1610-1618[Abstract/Free Full Text]
-
Suzuma, I, Mandai, M, Suzuma, K, et al (1998) Contribution of E-selectin to cellular infiltration during endotoxin-induced uveitis Invest Ophthalmol Vis Sci 39,1620-1630[Abstract/Free Full Text]
-
Miyamoto, K, Ogura, Y, Hamada, M, et al (1998) In vivo neutralization of P-selectin inhibits leukocyte-endothelial interactions in retinal microcirculation during ocular inflammation Microvasc Res 55,230-240[Medline][Order article via Infotrieve]
-
Miller-Anderson, M, Borg, H, Anderson, LO (1974) Purification of antithrombin III by affinity chromatography Thromb Res 5,439-452
-
Uchiba, M, Okajima, K, Murakami, K. (1998) Effects of various doses of antithrombin III on endotoxin-induced endothelial cell injury and coagulation abnormalities in rats Thromb Res 89,233-241[Medline][Order article via Infotrieve]
-
Emerson, T, Jr, Fournel, MA, Redens, TB, Taylor, F, Jr (1989) Efficacy of antithrombin III supplementation in animal models of fulminant Escherichia coli endotoxemia or bacteremia Am J Med 87(suppl),27S-33S[Medline][Order article via Infotrieve]
-
Uchiba, M, Okajima, K, Murakami, K, Okabe, H, Takatsuki, K. (1996) Attenuation of endotoxin-induced pulmonary vascular injury by antithrombin III Am J Physiol 270,L921-L930[Abstract/Free Full Text]
-
Uchiba, M, Okajima, K. (1997) Antithrombin III (AT III) prevents LPS-induced pulmonary vascular injury: novel biological activity of AT III Semin Thromb Hemost 23,583-590[Medline][Order article via Infotrieve]
-
Okajima, K, Uchiba, M. (1998) The anti-inflammatory properties of antithrombin III: new therapeutic implications Semin Thromb Hemost 24,27-32[Medline][Order article via Infotrieve]
-
Taylor, F, Jr, Emerson, T, Jr, Jordan, R, Chang, AK, Blick, KE (1988) Antithrombin-III prevents the lethal effects of Escherichia coli infusion in baboons Circ Shock 26,227-235[Medline][Order article via Infotrieve]
-
Hoffmann, JN, Vollmar, B, Inthorn, D, Schildberg, FW, Menger, MD (2000) Antithrombin reduces leukocyte adhesion during chronic endotoxemia by modulation of the cyclooxygenase pathway Am J Physiol 279,C98-C107
-
Nishiwaki, H, Ogura, Y, Kimura, H, Kiryu, J, Honda, Y. (1995) Quantitative evaluation of leukocyte dynamics in retinal microcirculation Invest Ophthalmol Vis Sci 36,123-130[Abstract/Free Full Text]
-
Kimura, H, Kiryu, J, Nishiwaki, H, Ogura, Y. (1995) A new fluorescent imaging procedure in vivo for evaluation of the retinal microcirculation in rats Curr Eye Res 14,223-228[Medline][Order article via Infotrieve]
-
Darzynkiewictz Z, Kapuscinski J. Acridine orange: a versatile probe of nucleic acids and other cell constituents. In: Melamed MR, ed. Flow Cytometry and Sorting. 2nd ed. New York: Wiley-Liss; 1990:291314.
-
Hoekzema, R, Verhagen, C, van-Haren, M, Kijlstra, A. (1992) Endotoxin-induced uveitis in the rat: the significance of intraocular interleukin-6 Invest Ophthalmol Vis Sci 33,532-539[Abstract/Free Full Text]
-
Chomczynski, P, Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal Biochem 162,156-159[Medline][Order article via Infotrieve]
-
Saiki, RK, Gelfand, DH, Stoffel, S, et al (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase Science 239,487-491[Abstract/Free Full Text]
-
Johnston, GI, Cook, RG, McEver, RP (1989) Cloning of GMP-140, a granule membrane protein of platelets and endothelium: sequence similarity to proteins involved in cell adhesion and inflammation Cell 56,1033-1044[Medline][Order article via Infotrieve]
-
Tso, JY, Sun, XH, Kao, TH, Reece, KS, Wu, R. (1985) Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene Nucleic Acids Res 13,2485-2502[Abstract/Free Full Text]
-
Yoshida, M, Tanihara, H, Yoshimura, N. (1992) Platelet-derived growth factor gene expression in cultured human retinal pigment epithelial cells Biochem Biophys Res Commun 189,66-71[Medline][Order article via Infotrieve]
-
Okumura, A, Mochizuki, M. (1988) Endotoxin-induced uveitis in rats: morphological and biochemical study Jpn J Ophthalmol 32,457-465[Medline][Order article via Infotrieve]
-
Ruiz-Moreno, JM, Thillaye, B, de-Kozak, Y. (1992) Retino-choroidal changes in endotoxin-induced uveitis in the rat Ophthalmic Res 24,162-168[Medline][Order article via Infotrieve]
-
Tilton, RG, Chang, K, Corbett, JA, et al (1994) Endotoxin-induced uveitis in the rat is attenuated by inhibition of nitric oxide production Invest Ophthalmol Vis Sci 35,3278-3288[Abstract/Free Full Text]
-
Goureau, O, Bellot, J, Thillaye, B, Courtois, Y, de-Kozak, Y. (1995) Increased nitric oxide production in endotoxin-induced uveitis. Reduction of uveitis by an inhibitor of nitric oxide synthase J Immunol 154,6518-6523[Abstract]
-
Jacquemin, E, de-Kozak, Y, Thillaye, B, Courtois, Y, Goureau, O. (1996) Expression of inducible nitric oxide synthase in the eye from endotoxin-induced uveitis rats Invest Ophthalmol Vis Sci 37,1187-1196[Abstract/Free Full Text]
-
Yang, P, de-Vos, AF, Kijlstra, A. (1997) Macrophages and MHC class II positive cells in the choroid during endotoxin induced uveitis Br J Ophthalmol 81,396-401[Abstract/Free Full Text]
-
Obrador, E, Peinado, E, de-Kozak, Y, Ruiz-Moreno, JM, Alio, JL. (1999) Human immunoglobulin preparations for intravenous use prevent endotoxin-induced uveitis in rats Ophthalmic Res 31,59-67[Medline][Order article via Infotrieve]
-
Dore, M, Korthuis, RJ, Granger, DN, Entman, ML, Smith, CW (1993) P-selectin mediates spontaneous leukocyte rolling in vivo Blood 82,1308-1316[Abstract/Free Full Text]
-
Jones, DA, Abbassi, O, McIntire, LV, McEver, RP, Smith, CW (1993) P-selectin mediates neutrophil rolling on histamine-stimulated endothelial cells Biophys J 65,1560-1569[Abstract/Free Full Text]
-
Mayadas, TN, Johnson, RC, Rayburn, H, Hynes, RO, Wagner, DD (1993) Leukocyte rolling and extravasation are severely compromised in P selectin-deficient mice Cell 74,541-554[Medline][Order article via Infotrieve]
-
Baatz, H, Pleyer, U, Thiel, H, Hammer, C. (1995) In vivo study of leukocyte-endothelium interaction in endotoxin-induced uveitis Invest Ophthalmol Vis Sci 36,1960-1967[Abstract/Free Full Text]
-
Hamada, M, Ogura, Y, Miyamoto, K, Nishiwaki, H, Hiroshiba, N, Honda, Y. (1997) Retinal leukocyte behavior in experimental autoimmune uveoretinitis of rats Exp Eye Res 65,445-450[Medline][Order article via Infotrieve]
-
Whitcup, SM, DeBarge, LR, Caspi, RR, Harning, R, Nussenblatt, RB, Chan, CC (1993) Monoclonal antibodies against ICAM-1 (CD54) and LFA-1 (CD11a/CD18) inhibit experimental autoimmune uveitis Clin Immunol Immunopathol 67,143-150[Medline][Order article via Infotrieve]
-
Tamatani, T, Kitamura, F, Kuida, K, et al (1993) Characterization of rat LECAM-1 (L-selectin) by the use of monoclonal antibodies and evidence for the presence of soluble LECAM-1 in rat sera Eur J Immunol 23,2181-2188[Medline][Order article via Infotrieve]
-
Uchio, E, Kijima, M, Tanaka, S, Ohno, S. (1994) Suppression of experimental uveitis with monoclonal antibodies to ICAM-1 and LFA-1 Invest Ophthalmol Vis Sci 35,2626-2631[Abstract/Free Full Text]
-
Gray, E, Thomas, S, Mistry, Y, Poole, S. (1996) Inhibition of tissue factor and cytokine release Haemostasis 1,92-95
-
Triantaphyllopoulos, DC (1984) Effects of human antithrombin III on mortality and blood coagulation induced in rabbits by endotoxin Thromb Haemost 51,232-235[Medline][Order article via Infotrieve]
-
Spannagl, M, Hoffmann, H, Siebeck, M, Weipert, J, Schwarz, HP, Schramm, W. (1991) A purified antithrombin IIIheparin complex as a potent inhibitor of thrombin in porcine endotoxin shock Thromb Res 61,1-10[Medline][Order article via Infotrieve]
-
van Amsterdam, RG, Vogel, GM, Visser, A, Kop, WJ, Buiting, MT, Meuleman, DG (1995) Synthetic analogues of the antithrombin III-binding pentasaccharide sequence of heparin: prediction of in vivo residence times Arterioscler Thromb Vasc Biol 15,495-503[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
K. Noda, H. She, T. Nakazawa, T. Hisatomi, S. Nakao, L. Almulki, S. Zandi, S. Miyahara, Y. Ito, K. L. Thomas, et al.
Vascular adhesion protein-1 blockade suppresses choroidal neovascularization
FASEB J,
August 1, 2008;
22(8):
2928 - 2935.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Mizuno, A. Matsubara, and Y. Ogura
Effect of Posterior Sub-Tenon Administration of Triamcinolone Acetonide on Leukocyte Dynamics in Rat Retinal Microcirculation after Panretinal Photocoagulation
Invest. Ophthalmol. Vis. Sci.,
May 1, 2008;
49(5):
2127 - 2133.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Noda, S. Miyahara, T. Nakazawa, L. Almulki, S. Nakao, T. Hisatomi, H. She, K. L. Thomas, R. C. Garland, J. W. Miller, et al.
Inhibition of vascular adhesion protein-1 suppresses endotoxin-induced uveitis
FASEB J,
April 1, 2008;
22(4):
1094 - 1103.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H Tamura, J Kiryu, K Miyamoto, K Nishijima, H Katsuta, S Miyahara, F Hirose, Y Honda, and N Yoshimura
In vivo evaluation of ocular inflammatory responses in experimental diabetes
Br. J. Ophthalmol.,
August 1, 2005;
89(8):
1052 - 1057.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Musashi, J. Kiryu, K. Miyamoto, S. Miyahara, H. Katsuta, H. Tamura, F. Hirose, and N. Yoshimura
Thrombin Inhibitor Reduces Leukocyte-Endothelial Cell Interactions and Vascular Leakage after Scatter Laser Photocoagulation
Invest. Ophthalmol. Vis. Sci.,
July 1, 2005;
46(7):
2561 - 2566.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Miyahara, J. Kiryu, K. Miyamoto, H. Katsuta, F. Hirose, H. Tamura, K. Musashi, Y. Honda, and N. Yoshimura
In Vivo Three-Dimensional Evaluation of Leukocyte Behavior in Retinal Microcirculation of Mice
Invest. Ophthalmol. Vis. Sci.,
November 1, 2004;
45(11):
4197 - 4201.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kolodjaschna, F. Berisha, S. Lung, G. Schaller, E. Polska, B. Jilma, M. Wolzt, and L. Schmetterer
LPS-induced microvascular leukocytosis can be assessed by blue-field entoptic phenomenon
Am J Physiol Heart Circ Physiol,
August 1, 2004;
287(2):
H691 - H694.
[Abstract]
[Full Text]
[PDF]
|
 |
|