| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 From the Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine; 2 Department of Ophthalmology, Tenri Yorozu Hospital; 3 Sumitomo Pharmaceuticals Research Center, Osaka; and the 4 Department of Ophthalmology, Nagoya City University Medical School, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
METHODS. Transient retinal ischemia was induced in Long-Evans rats for 60 minutes by temporal ligation of the optic nerve. Isolated platelet samples labeled with carboxyfluorescein diacetate succinimidyl ester were administered intravenously to recipient rats after various reperfusion periods. Platelet–endothelial interactions in postischemic retina were evaluated in vivo with a scanning laser ophthalmoscope. Anti-P-selectin monoclonal antibody (mAb) was administered 5 minutes before the injection of labeled platelets. P-selectin gene expression in the postischemic retina was studied by semiquantitative polymerase chain reaction.
RESULTS. Under basal conditions, infused platelets showed minimal interactions with retinal endothelial cells. In contrast, postischemic retinas showed active platelet–endothelial interactions. Many platelets were observed rolling along and adhering to the major retinal veins. The number of rolling and adhering platelets reached a peak (555 ± 65/mm per min and 25.8 ± 3.2/mm2) 12 hours after reperfusion. However, the interactions between platelets and postischemic retinal endothelial cells were substantially inhibited by neutralizing P-selectin expressed on endothelial cells. In addition, P-selectin gene expression in postischemic retina corresponded with the time course of platelet–endothelial interactions during the reperfusion period.
CONCLUSIONS. This study demonstrated that platelets actively interacted with retinal endothelial cells in the postischemic retina through P-selectin expressed on the retinal endothelial cells.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Under physiological conditions, platelets flowing in the bloodstream circulate without firm attachment to vascular endothelium. To recruit flowing platelets to the postischemic region, it would be necessary for platelets to interact with vascular endothelial cells through distinct adhesion molecules expressed on the surface of both the platelets and the cells. Recently, an intravital microscopic study first reported that platelets can roll along endothelial cells in the postischemic mesentery in the course of accumulation during ischemia–reperfusion injury.18 P-selectin, the first adhesion molecule expressed on the postischemic endothelium, is thought to mediate these platelet–endothelial interactions.18 There is, however, little information about platelet–endothelial interactions in the retina during ischemia–reperfusion injury.
To study the role of platelets in postischemic retina, it is essential to investigate platelet behavior during the reperfusion period in vivo. Recently, we have developed a new in vivo method to quantitatively evaluate platelet–endothelial interactions in rat retina.19 With the use of this method, we have reported that activated platelets show minimal interactions with endothelial cells but that endothelial cells treated with lipopolysaccharide show active interactions with nonactivated platelets. This method could help to disclose the role of platelets in retinal ischemia–reperfusion injury. In this study, we evaluated platelet–endothelial interactions in vivo during reperfusion after transient retinal ischemia and investigated the molecular mechanism in these interactions.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Transient retinal ischemia was induced in the right eye of each rat, according to the method of Stefansson et al.,20 with slight modification.21 22 Rats were anesthetized with a mixture (1:1) of xylazine hydrochloride (4 mg/kg) and ketamine hydrochloride (10 mg/kg). The pupils were dilated with 0.5% tropicamide and 2.5% phenylephrine hydrochloride. After lateral conjunctival peritomy and disinsertion of the lateral rectus muscle, the optic nerve of the right eye was exposed by blunt dissection. A 6-0 nylon suture was passed around the optic nerve and tightened until blood flow ceased in all the retinal vessels. Complete nonperfusion was confirmed by visualization through a surgical microscope. After 60 minutes of ischemia, nonperfusion was confirmed through a surgical microscope, and the suture was removed. Reperfusion of the vessels also was observed through the surgical microscope. Control rats underwent similar surgery, but without tightening of the suture (sham operation).
Blood Sampling and Platelet Preparation
Carboxyfluorescein diacetate succinimidyl ester (CFDASE;
Molecular Probes, Eugene, OR) is a nonfluorescent precursor that
diffuses into cells and forms the stable fluorochrome
carboxyfluorescein succinimidyl ester (peak absorbance, 492 nm; peak
emission, 518 nm) after being catalyzed by esterase. This enzymatic
reaction occurs predominantly in leukocytes and platelets and partially
in serum. Intracellular fluorophores react with lysine residues of
protein and remain within the cell as long as the membrane is
intact.23
CFDASE was dissolved in dimethyl sulfoxide (Wako Pure Chemicals, Osaka, Japan) to a concentration of 15.6 mM, and a small aliquot (200 µl) was stored at -70°C until use. Platelet samples were prepared in accordance with the method described previously, with a slight modification.19 Blood samples from donor rats were harvested from the abdominal artery and collected in polypropylene tubes containing a 2-ml volume of acid-citrate-dextrose (38 mM citric acid, 75 mM trisodium citrate, and 100 mM dextrose). The blood was centrifuged at 250g for 10 minutes.18 Platelet-rich plasma was gently transferred to a fresh tube and centrifuged at 2000g for 10 minutes. The platelet pellet was resuspended in 10 ml Hanks’ balanced salt solution (HBSS; Gibco, Grand Island, NY) and incubated with 150 µl CFDASE solution for 30 minutes at 37°C.24 After incubation, the platelet suspension was centrifuged again at 2000g for 10 minutes, 18 resuspended in 10 ml HBSS, centrifuged again at 2000g for 10 minutes, and resuspended in HBSS at a concentration of 6 x 106 platelets/0.2 ml or 6 x 108 platelets/0.2 ml.
Experimental Procedure
After each rat was anesthetized, the pupil of the right eye was
dilated again. A contact lens was used to retain corneal clarity
throughout the experiment. Each rat had a catheter inserted into the
tail vein and was placed on a movable platform. Arterial blood pressure
and heart rate were monitored with the blood pressure analyzer (IITC,
Woodland Hills, CA). After fluorescently labeled platelets were infused
into the tail vein catheter, platelet behavior in the retinal
microcirculation was observed with a scanning laser ophthalmoscope
(Rodenstock Instruments, Munich, Germany). The argon blue laser
(wavelength, 488 nm) was used for the illumination source, with a
regular emission filter for fluorescein angiography. The obtained
images were recorded on an S-VHS videotape at the video rate of 30
frames/sec for further analysis.
Experimental Design
Platelet behavior in the retinal microcirculation was evaluated
at 1, 2, 4, 6, 9, 12, 24, and 48 hours after reperfusion. Nonischemic
rats were used as a control. Six different rats were used at each time
point. Platelets (6 x 106) were infused to
measure the velocity of each platelet in the major retinal vessels.
Thereafter, 6 x 108 platelets were infused
to evaluate the interactions with the retinal endothelial cells (group
1).
In another experiment, to evaluate the effect of platelet samples on platelet–endothelial interactions, blood samples were harvested from donor rats that had been subjected to 60 minutes of retinal ischemia and reperfusion after 12 or 24 hours. These platelets were also infused in postischemic rats or nonischemic control rats after fluorescent labeling (group 2, n = 6 at either time point).
To evaluate the involvement of P-selectin in platelet–endothelial interactions, 2 mg/kg P-selectin monoclonal antibody (mAb, ARP2–4; Sumitomo Pharmaceuticals, Osaka, Japan) was administered to the recipient rats 5 minutes before they received labeled platelets (group 3, n = 6).25 26 Some platelet samples were preincubated with ARP2-4 at a concentration of 20 µg/ml while being labeled with CFDASE.27 These platelets were also infused into recipient rats that had undergone 60 minutes of retinal ischemia at 12 or 24 hours after reperfusion (group 4, n = 6 at either time point).
Image Analysis
The video recordings were analyzed with an image-analysis
system, consisting of a personal computer (Apple Computer, Cupertino,
CA) equipped with a video digitizer (Radius, San Jose, CA). The latter
digitizes the video image in real time (30 frames/sec) to 640
horizontal and 480 vertical pixels with an intensity resolution of 256
steps. We investigated the behavior of platelets in the retinal vessels
to evaluate platelet–endothelial interactions.
Rolling platelets were defined as platelets that moved at a slower velocity than free-flowing platelets in a given vessel and that made intermittent adhesive contacts with vascular endothelial cells.18 28 29 The number of rolling platelets in each major retinal vein was calculated as the number of platelets rolling along each vein for 1 minute at a distance 200 µm from the optic disc center and the data expressed as platelets per venous diameter. The averages of the individual counts were used as the number of rolling platelets in each rat. Velocity of rolling platelets was calculated as the time required for a platelet to travel a given distance (30 µm) along the vessel. A platelet was defined as adherent to vascular endothelium if it remained stationary for longer than 10 seconds. Adherent platelets were calculated as the total number of adherent platelets along all major retinal veins for 1 minute within a circle with a radius of 500 µm from the center of the optic disc. The data are expressed as the number of adherent platelets per square millimeter of the endothelial surface of the major retinal veins. All parameters were evaluated after a stabilization period of 5 minutes after the administration of platelets.19
To monitor the venous wall shear rate in retinal veins, we substituted the maximal velocity of flowing platelets (Vmax) for the centerline red blood cell velocity. The mean red blood cell velocity (Vmean) was estimated as Vmax/1.6. The venous wall pseudoshear rate was calculated based on Poiseuille’s law for a Newtonian fluid: pseudoshear rate = (Vmean/D) x 8/sec, where D is the venular diameter.30 Venular diameters were measured 200 µm from the optic disc center in monochromatic images recorded before the administration of platelets.
Semiquantification of P-selectin Gene Expression in Postischemic
Retina
The eyes were enucleated at 1, 2, 4, 6, 9,12, 24, and 48 hours
after reperfusion. Three rats were used at each time point. Each
enucleated eye was cut into two pieces along the limbus, and then the
retina was collected from the posterior segment. Nonischemic eyes were
used as a control. Total RNA was isolated from the retina according to
the acid guanidinium thiocyanate-phenol-chloroform extraction
method.31
The extracted RNA was quantified, and then 5
µg of the RNA was used to make cDNA. cDNA was synthesized with a kit
(First Strand; Pharmacia Biotech, Uppsala, Sweden). Polymerase chain
reaction (PCR) was performed using the method of Saiki et
al.32
and Nudel et al.,33
with slight
modifications. The following conditions were used: denaturation at
94°C for 30 seconds, annealing at 55°C for 1 minute, and
polymerization at 72°C for 1 minute. The reaction was performed for
35 cycles for P-selectin and 25 cycles for ß-actin. The primers were
CAAGAGGAACAACCAGGACT (sense) and AATGGCTTCACAGGTTGGCA (antisense) for
P-selectin and AGCTGAGAGGGAAATCGTGC (sense) and ACCAGACAGCACTGTGTTGG
(antisense) for ß-actin. Nucleotide sequencing and restriction
pattern analysis confirmed that PCR products were derived from the
target cDNA sequences.
Statistical Analysis
All values are presented as means ± SEM. The data were
analyzed using a one-way analysis of variance using a post hoc test
with the Fisher protected least-significance procedure. Differences
were considered statistically significant at P < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
|
|
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Accumulating evidence has suggested that platelets recruited in the postischemic tissue play a pivotal role in the pathogenesis of ischemic reperfusion injury.1 2 The importance of platelets is supported by many animal studies that have demonstrated beneficial effects of platelet depletion during ischemia–reperfusion injury.3 4 Platelets certainly contribute to thrombus formation, resulting in reocclusion of the blood vessels.5 Previous in vitro experimental studies have shown that accumulated platelets can generate free oxygen radicals and release various kinds of inflammatory cytokines. These cytokines recruit leukocytes to the ischemic region, which leads to postischemic tissue injury. Moreover, platelets can support leukocyte adhesion to vascular endothelium and can modulate leukocyte functional response. Recently, Campbell et al.34 have reported that platelets and neutrophils act synergistically to provoke ischemia–reperfusion injury in the heart. In their report, hearts perfused with platelets and neutrophils exhibited remarkable cardiac dysfunction, compared with those perfused with only platelets or neutrophils. Platelets caused postischemic tissue damage not only by themselves but also in cooperation with leukocytes.
In the present study, platelets in the control rats circulated normally without firmly attaching to intact vascular endothelium. Nitric oxide or prostaglandin I2 derived from endothelial cells may partially contribute to the antiplatelet property of the endothelium.35 Under low shear stress, rolling of activated platelets on endothelial venules was reported, depending primarily on platelet P-selectin.28 However, we have shown that even activated platelets revealed minimal interactions with unstimulated endothelial cells in the retina due to higher shear stress.19 Figure 4 shows the time course of the number of rolling platelets in the postischemic retina. Rolling platelets were first observed along the venous walls 4 hours after reperfusion. The number of rolling platelets substantially increased and reached a peak at 12 hours, which is comparable to the peak of rolling leukocytes reported by Tsujikawa et al.22 It is possible that rolling platelets were attaching to leukocytes rolling along the postischemic venous walls; however, we think that most rolling platelets were not attached to rolling leukocytes, because the velocity of a rolling platelet in the present study was 71 to 120 µm/sec, or three to seven times faster than rolling leukocytes.22 Although some platelets observed rolling slowly and irregularly along the major retinal veins in the postischemic retina might have adhered to the rolling leukocytes, the ratio would be quite small.
It is well known that leukocyte adhesion to the endothelium is mediated through a multistep process. Rolling is the first step and a prerequisite for leukocytes to subsequently firmly adhere and migrate.36 37 However, the concept of platelet rolling on endothelial cells is relatively new and its significance is therefore still controversial. Figure 5 shows the time course of platelet adhesion along the postischemic retinal veins. The time course is parallel with that of platelet rolling. No platelets adhered along the retinal veins in control rats or in surgical subjects before 4 hours after reperfusion. The number of adherent platelets substantially increased and reached a peak at 12 hours. Some platelets rolling along the postischemic retinal veins were observed rolling away from the optic disc or flowing away downstream; others decreased in velocity and adhered to the vascular walls. All evidence taken together, rolling of platelets would be the initial stage of the adhesion of platelets to endothelial cells.
Recently, experiments investigating platelet–endothelial interactions by intravital microscopy have shown that platelet recruitment to the inflammatory region is mediated through specific adhesion molecules.18 28 29 P-selectin expressed on endothelial cells is thought to mediate these interactions. In the present study, intravenous administration of P-selectin mAb substantially attenuated platelet–endothelial interaction in the postischemic retina. Initially, P-selectin was thought to be expressed by rapid secretion from storage granules within a few minutes after stimulation with agents such as thrombin and to return to normal levels within a few hours.38 Subsequent studies, however, demonstrated that P-selectin synthesis and endothelial surface expression can be regulated by inflammatory cytokines.39 P-selectin expression in endothelial cell monolayers exposed to hypoxia and reoxygenation shows a biphasic response that initially peaks at 30 minutes, with a second peak in surface expression at 4 to 6 hours after reoxygenation.40 Figure 6 shows the time course of P-selectin gene expression in the postischemic retina. Expression gradually increased immediately after reperfusion and reached a maximum 9 to 24 hours after reperfusion. The time course of expression was delayed, compared with that in experiments in vitro. Similarly, Suzuki et al.41 42 showed that P-selectin immunoreactivity begins to be expressed in the microvascular vessels in the cerebral cortex at 2 hours after reperfusion and that the expression reaches a maximum at 8 hours to 1 day. P-selectin expression on retinal endothelial cells occurred for longer periods than initially expected.
Activated platelets express P-selectin on their surfaces by rapid
secretion from 
-granules.43
In the present study,
although intravenous administration of P-selectin mAb substantially
diminished platelet–endothelial interactions in the postischemic
retina, platelet pretreated with P-selectin mAb showed active
interactions with the postischemic retinal veins. Although some
platelets harvested from donor rats may have been activated and may
have expressed P-selectin on their surface, P-selectin expressed on the
platelets would have little influence on platelet–endothelial
interactions. Therefore, P-selectin would mainly mediate platelet
rolling on activated endothelial cells and not on platelets. Our
findings are supported by intravital microscopic studies with the
mesentery of P-selectin–deficient mice reported by Massberg et
al.18
They showed that platelets from
P-selectin–deficient and wild-type mice can roll along postischemic
endothelium in wild-type mice but not in P-selectin–deficient mice.
In the present study, platelets harvested from control rats showed
similar interactions, with venous endothelial cells in the postischemic
retina through P-selectin expressed on the endothelial cells, compared
with those from rats with induced transient retinal ischemia (Fig. 7)
. Therefore, the ligand against endothelial P-selectin would
be expressed constitutively on the platelets. In the past few years,
selectin ligand expressed on the surface of platelets has been the
subject of intense investigation. Very recently, it has been reported
that P-selectin glycoprotein ligand-1 and glycoprotein Ib expressed
on platelets mediate platelet–endothelial
interaction.27
44
45
These glycoproteins are reportedly
expressed constitutively on the platelets and contribute to
platelet–endothelial interactions in the postischemic retina.
In conclusion, we demonstrated that platelets, similarly to leukocytes, roll and firmly adhere along venous endothelial cells in the retina during ischemia–reperfusion injury. These interactions were mainly mediated by P-selectin expressed on the retinal endothelial cells. We have reported that blocking of P-selectin significantly attenuates retinal ischemia–reperfusion injury.26 This protective effect may be partially based on the inhibition of platelet–endothelial interactions in the postischemic retina.
|
Footnotes |
|---|
Submitted for publication October 19, 2000; revised April 2, 2001; accepted April 26, 2001.
Commercial relationships policy: N.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. 
1734 solely to indicate this fact.
Corresponding author: Junichi Kiryu, Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, 54 Kawara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. kiryu{at}kuhp.kyoto-u.ac.jp
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  K. Noda, S. Miyahara, T. Nakazawa, L. Almulki, S. Nakao, T. Hisatomi, H. She, K. L. Thomas, R. C. Garland, J. W. Miller, et al. Inhibition of vascular adhesion protein-1 suppresses endotoxin-induced uveitis FASEB J, April 1, 2008; 22(4): 1094 - 1103. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Li, A. R. Burns, R. E. Rumbaut, and C. W. Smith {gamma}{delta} T Cells Are Necessary for Platelet and Neutrophil Accumulation in Limbal Vessels and Efficient Epithelial Repair after Corneal Abrasion Am. J. Pathol., September 1, 2007; 171(3): 838 - 845. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Li, R. E. Rumbaut, A. R. Burns, and C. W. Smith Platelet Response to Corneal Abrasion Is Necessary for Acute Inflammation and Efficient Re-epithelialization Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 4794 - 4802. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Cooper, J. Russell, K. D. Chitman, M. C. Williams, R. E. Wolf, and D. N. Granger Leukocyte dependence of platelet adhesion in postcapillary venules Am J Physiol Heart Circ Physiol, May 1, 2004; 286(5): H1895 - H1900. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Nishijima, J. Kiryu, A. Tsujikawa, K. Miyamoto, M. Honjo, H. Tanihara, A. Nonaka, K. Yamashiro, H. Katsuta, S. Miyahara, et al. Platelets Adhering to the Vascular Wall Mediate Postischemic Leukocyte-Endothelial Cell Interactions in Retinal Microcirculation Invest. Ophthalmol. Vis. Sci., March 1, 2004; 45(3): 977 - 984. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Nishiwaki, T. Ueda, S. Ugawa, S. Shimada, and Y. Ogura Upregulation of P-selectin and Intercellular Adhesion Molecule-1 after Retinal Ischemia-Reperfusion Injury Invest. Ophthalmol. Vis. Sci., November 1, 2003; 44(11): 4931 - 4935. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Miyahara, J. Kiryu, A. Tsujikawa, H. Katsuta, K. Nishijima, K. Miyamoto, K. Yamashiro, A. Nonaka, and Y. Honda Argatroban Attenuates Leukocyte- and Platelet-Endothelial Cell Interactions After Transient Retinal Ischemia Stroke, August 1, 2003; 34(8): 2043 - 2049. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yamashiro, A. Tsujikawa, S. Ishida, T. Usui, Y. Kaji, Y. Honda, Y. Ogura, and A. P. Adamis Platelets Accumulate in the Diabetic Retinal Vasculature Following Endothelial Death and Suppress Blood-Retinal Barrier Breakdown Am. J. Pathol., July 1, 2003; 163(1): 253 - 259. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ishikawa, D. Cooper, J. Russell, J. W. Salter, J. H. Zhang, A. Nanda, and D. N. Granger Molecular Determinants of the Prothrombogenic and Inflammatory Phenotype Assumed by the Postischemic Cerebral Microcirculation Stroke, July 1, 2003; 34(7): 1777 - 1782. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Cooper, K. D. Chitman, M. C. Williams, and D. N. Granger Time-dependent platelet-vessel wall interactions induced by intestinal ischemia-reperfusion Am J Physiol Gastrointest Liver Physiol, June 1, 2003; 284(6): G1027 - G1033. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Nishijima, J. Kiryu, A. Tsujikawa, M. Honjo, A. Nonaka, K. Yamashiro, H. Kamizuru, Y. Ieki, H. Tanihara, Y. Honda, et al. Inhibitory Effects of Antithrombin III on Interactions between Blood Cells and Endothelial Cells during Retinal Ischemia-Reperfusion Injury Invest. Ophthalmol. Vis. Sci., January 1, 2003; 44(1): 332 - 341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Russell, D. Cooper, A. Tailor, K. Y. Stokes, and D. N. Granger Low venular shear rates promote leukocyte-dependent recruitment of adherent platelets Am J Physiol Gastrointest Liver Physiol, January 1, 2003; 284(1): G123 - G129. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
P < 0.01,
compared with data in control rats. n = 6 for each group.
