IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by You, L.
Right arrow Articles by Kruse, F. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by You, L.
Right arrow Articles by Kruse, F. E.
(Investigative Ophthalmology and Visual Science. 2002;43:72-81.)
© 2002 by The Association for Research in Vision and Ophthalmology, Inc.

Differential Effect of Activin A and BMP-7 on Myofibroblast Differentiation and the Role of the Smad Signaling Pathway

Lingtao You and Friedrich E. Kruse

From the Department of Ophthalmology, University of Heidelberg Medical School, Heidelberg, Germany.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. To investigate myofibroblast differentiation and signal transduction induced by TGF-ß family members activin A and bone morphogenetic protein (BMP)-7.

METHODS. Transcription of activin and receptors (ActR) for activin A and BMP-7 was detected by RT-PCR. Levels of marker proteins for differentiation and phosphorylation of similar to mothers against decapentaplegics (Smads) were quantified by Western blot analysis in response to BMP-7, activin A and follistatin. Transfection with antisense Smad2/3 was performed to evaluate signal transduction.

RESULTS. Activin A and receptors (ActR-I, ActR-IB, ActR-II) are transcribed in corneal fibroblasts. Compared with TGF-ß1 or serum, activin A but not BMP-7 increased {alpha}-smooth muscle (SM) actin and actin-binding proteins such as SM myosin, {alpha}-actinin, and vinculin. Talin, paxillin, and desmin were not induced and vimentin was downregulated by activin. Activin also induced extracellular matrix proteins fibronectin and integrin ß1. Activin-dependent accumulation of proteins was blocked by follistatin. Regarding signal transduction, activin A induced phosphorylation of Smad 2, and BMP-7 induced Smad 1, both of which were inhibited by follistatin. Transfection with antisense Smad 2/3 prevented activin-induced expression and accumulation of {alpha}-SM actin.

CONCLUSIONS. TGF-ß proteins have different functions in the cornea. Activin A and TGF-ß1, but not BMP-7, are regulators of corneal keratocyte differentiation and may play a role during myofibroblast transdifferentiation. Smad 2/3 signal transduction seems to be important in the regulation of muscle-specific genes. Further investigation of Smad signaling may help to better understand the function of TGF-ß family members in the cornea.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cellular proliferation, differentiation, and wound healing in the cornea are largely regulated by polypeptide growth factors. Transforming growth factor (TGF)-ß is unique among the cytokines in the cornea, because it simultaneously inhibits epithelial proliferation and stimulates keratocyte proliferation and migration.1 2 3 Prototypic members of the TGF-ß superfamily, such as TGF-ß1 and -ß2 also regulate keratocyte differentiation4 5 6 7 . Although their role in the cornea is relatively well investigated, the functional significance of most other members of the TGF-ß family in the cornea is unknown.

Approximately 30 related dimeric proteins belong to the TGF-ß superfamily.8 9 Based on structural homology, at least three major groups of proteins can be differentiated: TGF-ßs, bone morphogenetic proteins (BMPs) and activins. The biological effects of these cytokines are mediated by signaling through two families of transmembranous serine-threonine kinase receptors.9 10 11 After ligand binding, a heteromeric complex is formed by a type I and a type II receptor that initiates phosphorylation of the type I receptor and activation of downstream signaling cascades.9 According to the different groups of TGF-ß, three classes of receptors have been described: TGF-ß receptors (TGF-ßRs), BMP-receptors (BMPRs) and activin receptors (ActRs). It is well established that both the corneal epithelium and stroma express TGF-ß receptors and that their ligands induce a variety of cellular functions.12 13 Also, BMP-receptors and several BMPs have been described in human corneal epithelium and stroma.14 15 Signaling through BMPRs has been shown to induce inflammatory mediators such as NF-{kappa}B and to modulate apoptosis.14 Furthermore, ligands to BMPR have an effect on fibroblast chemotaxis.16 It is presently unknown whether the third receptor system, ActR, is expressed in the human cornea and what function their ligands might have.

After receptor binding, phosphorylation of the type I receptor initiates signal transduction through proteins belonging to the "similar to mothers against decapentaplegic" (Smad) family.17 18 On the basis of their function receptor, activated Smad proteins can be differentiated into two groups serving different types of receptors.17 18 Activation of one arm of the Smad signaling pathway is induced by ActR-IB and results in phosphorylation and subsequent nuclear translocation of Smads 2 and 3. The other arm of the Smad signaling pathway is induced by ActR-I and results in activation of Smads 1 and 5. Therefore, binding of TGF-ß family members to ActRs can initiate signaling through two different Smad pathways. This is in contrast to BMPR, which can activate only Smads 1 and 5 and to TGF-ßR, which can activate Smads 2 and 3. Nuclear translocation of Smad 2 in response to TGF-ß1 has recently been shown in canine keratocytes.19 It is interesting that this process seems to depend on cell density, which can modulate myofibroblast differentiation.5 19 The process of myofibroblast transdifferentiation is characterized by the expression of muscle-specific genes such as {alpha}-actin.20 In the cornea, myofibroblast transdifferentiation is instrumental for the induction of scar formation and the reduction of corneal transparency.7 21 22 23

In the present study we show that activin and several ActR are transcribed in corneal fibroblasts. To learn about the biological significance of the ActR system in the cornea, we have investigated two prototype ligands (activin A and BMP-7) regarding their effect on fibroblast differentiation. Activin A and TGF-ß 1 had similar effects on proteins related to myofibroblast differentiation, migration, and cell adhesion. In contrast, the effect of BMP-7 was less pronounced. Follistatin, a protein that blocks activin receptors by binding activin A or BMP-7, neutralized the effect of activin A and BMP-7 on activation of intracellular signals and induction of gene expression.24 Because these results suggest a functional importance of Smads 2 and 3 for activin-dependent keratocyte differentiation, we performed transfection with an antisense DNA construct of Smad 2/3. Interruption of this signaling cascade also blocked the effect of activin A on {alpha}-SM actin transcription, thus confirming that the expression of muscle-specific proteins in corneal fibroblasts is in part regulated by Smad signals.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
A total RNA isolation kit (RNAgents), an mRNA purification system (polyATtract), RNase-free DNase, and Moloney murine leukemia virus reverse transcriptase (M-MLV RT) were obtained from Promega (Madison, WI). Thermus aquaticus (Taq) DNA Polymerase was obtained from Qiagen (Hilden, Germany). Digoxygenin (DIG) probe synthesis mix, DIG buffer (EasyHyb), a DIG washing set, a protein G immunoprecipitation kit, protease inhibitor (Complete), and bFGF (FGF-2) were from Roche Diagnostics (Mannheim, Germany). Enhanced chemiluminescence (ECL) Western blot analysis system and nitrocellulose membranes came from Amersham (Buckinghamshire, UK). 10% SDS-3-(N-morpholino)propanesulfonic acid (MOPS) gels (NuPAGE Bis-tris) or 3% to 8% Tris-acetate gels (NuPAGE) were obtained from Invitrogen (San Diego, CA). Antibodies against {alpha}-SM actin, SM myosin (light- and heavy-chain), {alpha}-actinin, vinculin, talin, paxillin, integrin ß1, fibronectin, desmin, and anti-mouse IgG conjugated to FITC and keratinocyte basal medium were purchased from Sigma (St. Louis, MO) and antibody against vimentin from Dako (Glostrup, Denmark). Polyclonal antibodies against Smads 1 and 2 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Polyclonal antibody against phospho-Smad 1 (Ser463/465) and polyclonal antibody against phospho-Smad 2 (Ser465/467) were from Upstate Biotechnology (Lake Placid, NY). Dulbecco’s modified Eagle’s medium (DMEM) came from Gibco (Grand Island, NY), and TGF-ß1 and follistatin were from R&D (Minneapolis, MN). Recombinant activin A was a generous gift from Yuzuru Eto (Ajinomoto Co., Inc., Kawasaki, Japan). Recombinant BMP-7 was a generous gift from Donald Jin (Creative Biomolecules, Hopkinton, MA).

Cell Culture
Human corneas stored for less than 24 hours in preservation medium (Likorol; Chauvin-Opsia, Labege, France) at 4°C were used to initiate keratocyte outgrowth cultures in DMEM with 10% fetal bovine serum (FBS), as described.15 For experiments, cells from passages 2 to 4 were used. Because seeding density is crucial in relation to the status of differentiation5 19 an intermediate density (150 cells/mm2) was used that has been shown to allow the expression of differentiation-related proteins such as {alpha}-SM actin’s response to TGF-ß.19

RNA Isolation and Reverse Transcription–Polymerase Chain Reaction
Total RNA and mRNA was isolated from fresh, snap-frozen human tissue samples or cultured corneal fibroblasts with a total RNA isolation kit (RNAgents) and an mRNA purification kit (polyATtract; both from Promega), as described.15 To minimize the risk of contamination by genomic DNA the mRNA samples were digested by RNase-free DNase followed by phenol-chloroform extraction and isopropanol precipitation.

The following primers were used: activin ßA: sense, CAGGATGCCCTTGCTTTGGCTGAGA, and antisense, CCCACATGAAGCTTTCTGATCGCGT (282 bp, GenBank accession no. M13436, J03634); ActR-I: sense, GTACAATGGTAGATGGAGTGATGAT, and antisense, CATACCTGCCTTTCCCGACACAC (663 bp, GenBank L02911, Z22534); ActR-IB: sense, ACGTGTGAGACAGATGGGGCCTGC, and antisense, GCGATGATGCCTACCAGCTCCACCG (263 bp, GenBank U14722, Z22536); ActR-II: sense, ATCTAGCGAGAACTTCCTCCG, and antisense, GCCCTCACAGCAACAAAAATATAC (364 bp, GenBank D31770, M93415, X62381). (GenBank is provided by the National Center for Biotechnology Information, Bethesda, MD, and is available in the public domain at http://www.ncbi.nlm.nih.gov/genbank/)

First-strand cDNA was synthesized by M-MLV RT at 42°C. PCR was performed using 1 ng single-strand cDNA with 3 U Taq DNA polymerase in a volume of 50 µL. After predenaturation at 95°C for 3 minutes, 35 cycles were performed including denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute and extension at 72°C for 1 minute followed by 2% agarose gel electrophoresis. All the PCR fragments were cloned and sequenced.

Western Blot Analysis
To investigate the effect of activin A and BMP-7 on keratocyte differentiation, Western blot analysis were performed. Fibroblasts were incubated in serum-free DMEM, with or without recombinant human activin A (100 ng/mL),25 26 27 BMP-7 (200 ng/mL),28 TGF-ß1 (1 ng/mL), FGF-2 (bFGF; 100 ng/mL) or 10% FBS for 3 days and solubilized in lysis buffer containing dithiothreitol and protease inhibitors. Total protein (80 µg per lane) was fractionated by 10% SDS-MOPS gels or 3 to 8% Tris-acetate gel and blotted onto nitrocellulose membranes. Membranes were then incubated with monoclonal antibodies against {alpha}-SM actin, SM myosin (heavy- and light-chain), {alpha}-actinin, vinculin, talin, paxillin, integrin ß1, fibronectin, desmin, and vimentin and visualized with the ECL Western blot analysis system. The relative intensities of the protein bands were quantified using NIH Image software, ver. 1.62 (NIH Image is provided in the public domain by the National Institutes of Health, Bethesda, MD, and is available at http://www.nb.nih.ncbi.gov). Results are expressed as a percentage of the signal obtained from serum-free control cultures set as 100% (y-axis, Figs. 2 3 4 5 6 ).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 2. Effect of activin A (100 ng/mL; Act) on intracellular levels of markers for myofibroblast differentiation and adhesion in cultured fibroblasts compared with the effect of TGF-ß1 (1 ng/mL; TGF), FGF-2 (100 ng/mL; FGF), and serum (10%; ser). One representative Western blot for (A) {alpha}-SM actin (42 kDa), (B) SM myosin heavy chain (200 kDa), (C) SM myosin light chain (20 kDa), (D) {alpha}-actinin (100 kDa), (E) vinculin (116 kDa), (F) talin (225 kDa), and (G) paxillin (68 kDa) is shown with quantification (control medium set as 100%).

 


View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Effect of activin A (100 ng/mL; Act) on intracellular levels of intermediate filaments in cultured fibroblasts compared with the effect of TGF-ß1 (1 ng/mL; TGF), FGF-2 (100 ng/mL; FGF), and serum (10%; ser). One representative Western blot for (A) vimentin (57 kDa) and (B) desmin (53 kDa) is shown with quantification (control medium set as 100%).

 


View larger version (36K):
[in this window]
[in a new window]
 
Figure 4. Effect of activin A (100 ng/mL; Act) on extracellular levels of matrix proteins in cultured fibroblasts compared with the effect of TGF-ß1 (1 ng/mL; TGF), FGF-2 (100 ng/mL; FGF), and serum (10%; ser). One representative Western blot for (A) fibronectin (240 kDa) and (B) integrin ß1 (120 kDa) is shown with quantification (control medium set as 100%).

 


View larger version (35K):
[in this window]
[in a new window]
 
Figure 5. Follistatin (200 ng/mL) inhibits the effect of activin A (100 ng/mL) on a marker for myofibroblast differentiation and an intermediate filament in cultured fibroblasts. One representative Western blot for {alpha}-SM actin (42 kDa) and vimentin (57 kDa) is shown.

 


View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. Effect of BMP-7 (200 ng/mL; BMP) on intracellular levels of markers for myofibroblast differentiation in cultured fibroblasts compared with the effect of TGF-ß1 (1 ng/mL; TGF), FGF-2 (100 ng/mL; FGF), and serum (10%; ser). One representative Western blot for (A) {alpha}-SM actin (42 kDa) and (B) SM myosin heavy chain (200 kDa) is shown with quantification (control medium set as 100%).

 
To investigate the effect of activin A and BMP-7 on time-dependent phosphorylation of Smads 1 and 2, fibroblasts were starved in serum-free DMEM for 1 day and incubated in serum-free DMEM without additives or with recombinant human BMP-7 (200 ng/mL) or activin A (100 ng/mL) for 5, 20, 35, and 50 minutes. Cell matrix proteins were extracted in the presence of dithiothreitol, sodium pyrophosphate, sodium orthovanadate, and a protease inhibitor (1 tablet/30 mL buffer; Complete; Roche). Western blot analyses were performed as described earlier with a polyclonal antibody against phospho-Smad 1(for BMP-7 induction) and phospho-Smad 2 (for activin induction) and polyclonal antibodies against total Smad 1 or 2 (phosphorylated and nonphosphorylated Smad).

To investigate the effect of follistatin on activin-induced Smad activation and keratocyte differentiation, fibroblasts were incubated with 200 ng/mL follistatin for 30 minutes followed by stimulation with activin (100 ng/mL) or BMP-7 (200 ng/mL) for 30 minutes or 3 days and total protein isolation for Western blot.

Immunoprecipitation
Cultured fibroblasts were incubated in serum-free DMEM without additives or with recombinant human activin A (100 ng/mL), TGF-ß1 (1 ng/mL), FGF-2 (100 ng/mL) or 10%FBS for 3 days and solubilized in lysis buffer containing 50 mM Tris2Cl (pH 8.0), 150 mM NaCl, 0.02% sodium azide, 100 µg/mL phenylmethylsulfonyl fluoride, 1 mM Na3VO4, 1% Triton X-100, and protease inhibitor (1 tablet/30 mL buffer, Complete; Roche). The lysate was then pelleted by brief centrifugation at 12,000 rpm. Protein concentrations in the supernatant were determined by Bradford assay. Protein (50 µg) in 500 µL lysis buffer was incubated with 5 µg monoclonal antibody against SM myosin (light chain) for 1 hour at 4°C, and 30 µL protein-G agarose (Roche) was used for protein absorption overnight according to the instructions of the manufacturer. The agarose protein complex was then pelleted by centrifugation at 12,000 rpm. Bound proteins from protein-G agarose were solubilized in SDS gel loading buffer. After heating to 100°C for 5 minutes and brief centrifugation at 12,000 rpm, samples were subjected to Western blot analysis.

Construction of an Antisense Smad2/3 Expression Vector and Gene Transfection
To investigate the importance of the Smad signaling pathway for the induction of keratocyte differentiation by activin A, we tested the effect of inhibiting Smad2/3 signaling on expression and accumulation of {alpha}-SM actin protein. An antisense fragment of Smad2 (-1 to +199 of the coding sequence) was cloned into the HindIII-BamHI cloning site of the pEGFP-N3 vector (Clontech Laboratories, Palo Alto, CA) to overexpress antisense Smad transcripts fused with enhanced green fluorescent protein (EGFP). Constructs were confirmed by sequencing. Cultured fibroblasts were transfected with pEGFP-anti-Smad or pEGFP (as a control) using reagents (Lipofectamine and Plus; Gibco) for 3 hours in serum-free keratinocyte basal medium. To ensure that only transfected cells were investigated, we performed a selection for 3 weeks, during which transfected cells grew in serum-containing DMEM with 150 µg/mL geneticin (G418; Amersham) and nontransfected cells did not survive. After selection, cells were incubated in serum-free DMEM, with or without recombinant human activin A (100 ng/mL), for 3 days and were then solubilized for Western blot analysis.

Northern Blot Analysis
To further confirm the effect of pEGFP-anti-Smad transfection on transcription of the {alpha}-SM actin gene, Northern blot analysis was performed. After transfection and 3 weeks of selection in medium containing genetticin, 1 x 107 corneal fibroblasts expressing either EGFP-anti-Smad or EGFP mRNA were cultured in serum-free DMEM without additives or with recombinant human activin A (100 ng/mL) for 1.5 hours followed by lysis with a total RNA isolation kit (RNAgents; Promega). Total RNA (50 µg) from each sample was separated on formaldehyde agarose gels (1%) and subsequently blotted onto nylon membranes. The RNA blots were then hybridized in 42°C overnight with either {alpha}-SM actin or a GFP cDNA probe labeled with digoxygenin-dUTP and subjected to DIG-detection and ECL film exposure.

In general, all experiments were performed in triplicate.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Presence of Activin A and Corresponding Receptors Transcripts in the Cornea
A cDNA fragment specific for the activin ßA chain was amplified by RT-PCR from ex vivo corneal stroma (Act (ex vivo), 282 bp) and cultured corneal fibroblasts (Act, (ex vitro), 282 bp; Fig. 1A ). The cellular responses induced by activin A and BMP-7 were mediated by type I and type II ActR and BMPR. cDNA fragments specific for ActR-I (663 bp), ActR-IB (263 bp), and ActR-II (364 bp) were amplified from ex vivo corneal stroma (ex vivo) and cultured corneal fibroblasts (ex vitro; Fig. 1B ).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. Activin A and ActRs are transcribed in ex vivo corneal stroma (ex vivo) and cultured cornea (ex vitro). (A) Activin ßA chain (282 bp; Act); (B) ActR-I (663 bp), ActR-IB (263 bp), and ActR-II (364 bp). One representative experiment is shown.

 
Induction of Myofibroblast Differentiation in Stromal Fibroblasts
We compared the effect of activin A (Fig. 2 , Act) on keratocyte differentiation with that of TGF-ß1 (TGF), because the latter had been thoroughly studied before. We also investigated two other mediators of corneal differentiation, FGF-2 (FGF) and serum (ser) as well as serum-free medium (co). Because we wanted to observe the maximal effect of FGF-2 we used a concentration of 100 ng/mL.

The first set of experiments shows that activin A induced the expression of proteins that are related to myofibroblast differentiation or alteration of cell shape in relation to the extracellular matrix. Three of the most important proteins in this respect are {alpha}-SM actin and SM myosin heavy and light chains, which are markers for corneal myofibroblast transdifferentiation.6 7 Figure 2 shows that both TGF-ß1 and activin A increase levels of {alpha}-SM actin (42 kDa; Fig. 2A ) as well as SM myosin heavy chain (200 kDa; Fig. 2B ). Also SM myosin light chain (20 kDa; which was investigated by immunoprecipitation and Western blot) was strongly induced by both TGF-ß1 and activin A compared with the control (Fig. 2C) .

The second set of experiments shows that activin differentially induced the expression of other proteins related to myofibroblast differentiation. {alpha}-Actinin, an actin-bundling protein, as well as vinculin, talin, and paxillin mediate the link between actin filaments and extracellular matrix. In Figure 2 , we show that {alpha}-actinin (100 kDa; Fig. 2D ) and vinculin (116 kDa; Fig. 2E ) were strongly induced by activin A, whereas serum and TGF-ß showed differential effects. In contrast activin A had no effect on the level of talin (225 kDa; Fig. 2F ) and paxillin (68 kDa; Fig. 2G ) which were both upregulated by serum.

In a third set of experiments we show that activin A had a different effect on cytoskeleton proteins that are not directly related to myofibroblast differentiation. The level of vimentin (57 kDa) was reduced by activin A (Fig. 3A) , whereas the level of desmin (53 kDa) remained the same (Fig. 3B) .

In a fourth set of experiments, activin also upregulated extracellular matrix proteins (fibronectin and integrin) that are essential for cell attachment. Levels of fibronectin (240 kDa) were induced by TGF-ß1, activin, and serum but inhibited by FGF-2 (Fig. 4A) . Similarly, integrin ß1 (120 kDa) was strongly augmented by TGF-ß1, activin A, and serum (Fig. 4B) .

Follistatin’s Inhibition of the Effect of Activin on Keratocyte Differentiation
To confirm that the effect of activin A on keratocyte differentiation is mediated by binding to ActR, we investigated the effect of follistatin. Follistatin binds to activin A and specifically blocks interaction of ActR with its ligand.24 Data shown in Figure 5 confirm that activin A increased {alpha}-SM actin. Pretreatment with follistatin inhibited this increase (Fig. 5) . Furthermore, activin A decreased vimentin levels, and pretreatment with follistatin prevented this decrease (Fig. 5) . Therefore, blockage of ActR-activin interaction by follistatin inhibited the effect of activin A on keratocyte differentiation.

Effect of BMP-7 on Keratocyte Differentiation
The effect of BMP-7 on keratocyte differentiation was studied in comparison with that of TGF-ß, FGF-2, and serum. Data presented in Figure 6A show that the level of {alpha}-SM actin remained unchanged in the presence of BMP-7 (BMP) and FGF-2 (FGF) but was significantly induced by TGF-ß1 (TGF) or serum (ser) in comparison with serum-free medium (co). SM myosin heavy chain remained unchanged by BMP-7 or FGF-2, but was significantly induced by serum (Fig. 6B) .

Phosphorylation of Smads 1 and 2 by BMP-7 and Activin A
To further investigate the signal transduction pathway induced by BMP-7 or activin A, we studied phosphorylation of Smad 1 or 2 by activin receptor serine-threonine kinases, which is a critical step for the initiation of Smad-mediated transcriptional responses. Data presented in Figure 7 show that BMP-7 (BMP) time dependently induced phosphorylation of Smad 1 and that activin A (Act) time dependently induced phosphorylation of Smad 2. The level of phosphorylated Smads increased up to 35 minutes and decreased at 50 minutes after addition of BMP-7 or activin A. During the entire observation period, levels of total Smad 1 (65 kDa) or 2 (52 kDa) remained the same (Fig. 7) .



View larger version (28K):
[in this window]
[in a new window]
 
Figure 7. BMP-7 (BMP; 200 ng/mL) induced time-dependent phosphorylation of Smad 1 (top), and activin A (Act; 100 ng/mL) induced time-dependent phosphorylation of Smad 2 (bottom). This representative Western blot analysis shows levels of phosphorylated Smad 1 or 2 proteins in comparison with total Smad 1 or 2 proteins after incubation with BMP-7 or activin A for between 5 and 50 minutes (m).

 
Inhibition by Follistatin of the Phosphorylation of Smads by BMP-7 or Activin
To test the specificity of the effect of BMP-7 and activin A on Smad phosphorylation, we investigated the effect of follistatin. Phosphorylation of Smad 1 induced by BMP-7 was inhibited by follistatin as shown in Figure 8 . Similarly, phosphorylation of Smad 2 induced by activin A was inhibited by follistatin. The intracellular level of total Smad 1 and 2 proteins remained the same under each condition. In conjunction with the findings shown in Figure 5 , these data suggest the possibility that corneal fibroblasts contain a regulatory system composed of BMP-7 and activin A as inducer and follistatin as inhibitor of Smad-signaling activation through activin receptors.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 8. Follistatin (200 ng/mL) inhibits phosphorylation of Smad 1 by BMP-7 (200 ng/mL; top) and phosphorylation of Smad 2 by activin A (100 ng/mL; bottom). This representative Western blot analysis shows levels of phosphorylated Smad 1 or 2 proteins in comparison with total Smad 1 or 2 proteins after incubation with BMP-7 or activin A alone as well as with BMP-7 or activin A after pretreatment with follistatin.

 
Effect of Antisense Smad Transfection on Activin-Induced Myofibroblast Transdifferentiation
To further confirm the importance of the Smad 2/3 signaling pathway for mediating activin-induced keratocyte differentiation, we selectively inhibited this pathway by antisense gene transfection. For this purpose we used two vectors. One contains a sequence encoding for the EGFP. The other contains EGFP fused with an antisense sequence corresponding to the human Smad 2 gene, which therefore blocks the expression of Smad 2 protein (EGFP-AntiSmad, Fig. 9A ). Due to the high similarity between Smads 2 and 3 the expression of Smad 3 is most likely also involved. After transfection and selection (for 3 weeks) the morphology of EGFP cells in serum-containing medium was almost identical with nontransfected cells, whereas EGFP AntiSmad cells were slim, with predominantly narrow cytoplasm (Fig. 9B) . This morphologic change may be related to the decreased expression of muscle specific proteins regulated by the Smad pathway, as described earlier. Preliminary experiments had shown that more than 60% of cultured fibroblasts were transfected before selection (data not shown). After 3 weeks of selective culture, nontransfected cells were eliminated.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 9. Transfection of fibroblasts with an antisense cDNA fragment specific for Smad 2. (A) Map of pEGFP-antisense construct containing the empty multiple cloning site (MCS) of pEGFP (lightly shaded bar) and the antisense cDNA fragment of Smad 2 (darkly shaded bar). (B) Phase-contrast micrograph shows the morphology of pEGFP (EGFP) and pEGFP-antisense transfected (EGFPAntiSmad) corneal fibroblasts.

 
All transfected cells expressed mRNA specific for EGFP (Fig. 10) , which is not present in nontransfected cells. The level of EGFP expression was identical in all transfected cells and independent of the presence of activin A (Act) in the culture medium. Cells transfected only with EGFP expressed Smad 2/3 protein and therefore contained normal levels of Smad 2 protein, which is independent of stimulation of activin A (Fig. 10) . In contrast, transfection with EGFP anti-Smad impaired transcription of Smad 2/3, and therefore cells contained significantly less Smad 2 protein than cells transfected with EGFP (Fig. 10) . The level of Smad 2 protein was not changed by activin A. Similar experiments also indicated that expression of Smad 3 protein was inhibited in cells transfected with EGFP anti-Smad (data not shown). In concordance with our results obtained by Western blot analysis (Fig. 4) , activin A significantly induced {alpha}-SM actin in cells that express Smad 2/3 proteins (EGFP; Fig. 10 ). In contrast, activin had no effect on expression of {alpha}-SM actin in fibroblasts that contained low levels of Smad 2/3 due to transfection with the antisense Smad2/3 construct (EGFP-AntiSmad; Fig. 10 ). These results confirm that the expression of {alpha}-SM actin in fibroblasts is modulated by activin A through the Smad pathway.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 10. Activin A induces expression of {alpha}-SM actin through Smad 2. First panel: representative Northern blot shows transcription of GFP in cells transfected with pEGFP (EGFP) or with pEGFP-AntiSmad (EGFPAntiSmad) grown in the absence (co) or presence of activin A (100 ng/mL; Act). Second panel: a representative Western blot shows expression of Smad 2 protein in cells transfected with pEGFP or with pEGFP-AntiSmad. Third panel: representative Northern blot analysis for {alpha}-SM actin mRNA. Fourth panel: representative Western blot for {alpha}-SM actin protein.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Within the TGF-ß superfamily activins represent a distinct group of molecules that can comprise one {alpha} and three ß chains (ßA, ßB, and ßC).29 30 Depending on the arrangement of these chains several dimeric molecules can be formed. Dimers composed of two ß chains are called activins, and dimers consisting of one {alpha} and one ß chain are called inhibins. Here we show transcription of genes encoding for the ßA chain as well as several activin receptors in corneal fibroblasts. As a prototypic molecule, we have investigated the function of the bioactive molecule activin A that consists of two monomeric ßA chains linked by disulfide bonds.30 Activin A as well as follistatin belong to a regulatory system in which follistatin inhibits receptor binding of activins-inhibins and therefore downregulates their biological effects.24 30 Such a system functions, for example, in the ovary or the prostate.31 32 In cultured corneal fibroblasts, follistatin blocks the effect of activin on protein expression and signal transduction. This suggests the possibility that the activin-follistatin system may also be present in the cornea and could be involved in the regulation of cellular functions.

The major function of activin A and BMP-7 is the regulation of cell differentiation. During embryogenesis, these molecules are instrumental for axis development and organogenesis in a variety of species.33 In adults, activins function as hormone-type feedback regulators in the reproductive system. They circulate in the vasculature to regulate the release of follicle-stimulating hormone.34 Activin A controls several aspects of hematopoiesis25 26 27 and regulates cell differentiation in the ovary, placenta, prostate, and testis.30 35 Furthermore, the presence of activin has be related to wound healing. During cutaneous wounding, activin is released from the vasculature as well as from activated monocytes and macrophages.36 Wound fluid collected after severe burns induces the differentiation of erythroid cells, an effect that is most likely due to activin A.37 Finally, activin A is present in skin wounds, and its expression in dermal keratinocytes is increased after wounding.37 38 In the current study, activin A modulated the levels of several differentiation-related proteins in corneal fibroblasts. Among the proteins under investigation the expression of {alpha}-SM actin and SM-myosin was most prominently affected. Both of these proteins are normally present in muscle cells, and their expression in fibroblasts is indicative of a transition into an activated phenotype, which is called myofibroblast transdifferentiation. In the cornea {alpha}-SM actin is induced in activated keratocytes within the wound but not in neighboring cells and serves as a marker for myofibroblast differentiation.22 23 39 This process has been shown to be influenced by activin A in nonocular tissues. In pulmonary fibrosis, scar formation is due to the activity of myofibroblasts, and activin A has been observed in remodeling lesions associated with interstitial pulmonary fibrosis.40 Furthermore, activin A increases the number of fetal lung fibroblasts immunopositive for {alpha}-SM actin.41 Similarly, activin modulates the growth of vascular smooth muscle cells that also express SM actin and myosin.42

In several studies, investigators have looked at the regulation of {alpha}-SM actin or SM-myosin in a variety of nonocular tissues, as well as the cornea. It has been shown that wound-related cytokines such as platelet-derived growth factor (PDGF) and FGF-2 inhibit the expression of {alpha}-SM actin or SM-myosin, which is supported by our results.6 43 44 In contrast, TGF-ß1 has been shown to upregulate the expression of these proteins and to govern various aspects of myofibroblast differentiation in the context of wound healing.6 7 Herein, we present evidence that a second TGF-ß family member, activin A (but not BMP-7) has similar, yet not identical functions as TGF-ß1 on keratocyte differentiation. It is notable that a similar common action was observed in RPE cells where both activin A and TGF-ß seem to attenuate the effect of promitogenic cytokines in the context of proliferative vitreoretinopathy.45 46

The mechanism by which activin modulates the expression of muscle-specific genes are unknown. For TGF-ß a direct effect on the target gene has been shown and it seems therefore possible that activin A follows a similar mechanism. Investigations of the effect of TGF-ß1 on {alpha}-SM actin gene expression have shown that the first 125 bp of the {alpha}-SM actin promoter are sufficient to confer TGF-ß responsiveness.47 Within this region a TGF-ß control element was identified that can also be found on the myosin promoter. Further studies are needed to identify response elements that can be induced by activin A. In addition to a direct mechanism, the effect of activin A could be indirect—for example, based on interactions with other cytokines. Corneal fibroblasts can express a variety of growth factors including TGF-ß family members such as TGF-ß1, ß2, and ß3 and BMP-2, -4, -5 and -7.14 15 48 Because there are no data concerning the induction of cytokine gene expression by activin A during postnatal life, it should be determined whether activin A can induce expression of cytokines that modulate myofibroblast transdifferentiation. Activin gene expression can be induced by factors that are important in wound healing. For example, PDGF induces expression of activin A in bone marrow cells.49 Furthermore, TGF-ß1 induces expression of activin A in differentiated cell lines, suggesting that TGF-ß1 can stimulate the secretion of activin A.50 This may imply that the modulating effects of TGF-ß1 and PDGF on myofibroblast transdifferentiation could be partly due to an induction of activin. This would also explain why some of the effects of activin A and TGF-ß1 are similar.

The effect of other members of the TGF-ß superfamily on gene expression during differentiation seems to differ from that of activin A and TGF-ß1. Activin A and BMP-7 could not induce mesenchymal transdifferentiation in NMuMG breast epithelial cells in comparison with significant induction by TGF-ß.51 BMP-12 and -13 inhibit terminal differentiation of myofibroblasts by inhibiting the expression of myosin.52 Similarly, BMP-2 downregulates myosin and simultaneously induces markers for osteoblast differentiation.53 In the light of the high structural homology of the TGF-ß family members, as well as overlapping affinity with transmembranous receptors, the diversity of the effect of members of this family on cellular differentiation is surprising. During the recent past, signal-transduction pathways have been investigated, and these studies allow insight in the divergent modes of action of various TGF-ß family members. Although TGF-ß and activin A bind to different receptors, they use the same signal-transduction pathway consisting of Smads 2, 3, and 4.54 In response to activin A or TGF-ß, the carboxyl-terminal domains of Smads 2 and 3 are essential for phosphorylation of Smad 2/3, association with Smad 4, translocation into the nucleus, and transcriptional response.55 56 To initiate transcription of target genes, Smads have to interact with transcription factors. Smad 2 has been shown to interact with FAST-1 and Smads 3 and 4 interact with Ap 1, ATF2 or Sp 1.56 57 58 59 Furthermore, specific target genes for Smad 2 have been identified, such as ARE(Mix.2 promoter) or TARE(gscd promoter).55 60

The finding that BMP-7 causes transcriptional responses that differ from those evoked by activin A can also be explained by the nature of the signal-transduction cascade. BMP-7 has a specific binding affinity to ActR-I, which activates Smads 1 and 5.61 Consequently, transcription factors induced by BMP-7 are also different. Target DNA-binding proteins of Smad 1 specific for BMP-induced gene transcription are Hoxc-8, STAT, and OAZ.62 63 64 One of the genes that are directly controlled by Smads 1 and 5 is the homeobox gene Tlx2.61 Of note, BMP-7 induces transcription of genes specific for {alpha}-SM actin and SM myosin heavy chain during myofibroblast transdifferentiation in vascular smooth muscle cells.65 This is in contrast to our findings in corneal fibroblasts, where transcription of {alpha}-SM actin is regulated by activin-Smad 2/3 signaling and is independent of BMP-7. This suggests the presence of unknown mechanisms that control a cell type–dependent regulation of TGF-ß signaling. Furthermore, it is currently not known how TGF-ß family members, such as activin A and TGF-ß1, can have very divergent functions, although their intracellular signals are mediated by identical Smad proteins. This could be due in part to the modulating effect of transcriptional repressors or activators that can modulate the activity of Smad proteins. Coactivators, such as C BP/P300 or corepressors such as Ski or SnoN, can regulate Smad-dependent transcriptional activity by binding to the MH2 domain of Smads 3 and 466 67 68 . C BP, Ski, and SnoN play important roles regarding the regulation of transcription of numerous genes in vertebrates as well as Drosophila. Differential expression or activation of these regulators in association with Smad proteins may explain the diversity of the biological effects induced by TGF-ß, activin, and BMPs.69 Another possible explanation is that other signal transduction pathways are used. It has been shown that TGF-ß induces fibronectin synthesis through a c-Jun N-terminal kinase–dependent, Smad4-independent pathway.70 Whether activin A also uses other pathways remains to be investigated. Further analysis of factors that modulate the Smad signaling pathway should help to better understand the function of TGF-ß family members in the cornea.


    Acknowledgements
 
The authors thank Brigitte Erber for experienced help concerning cell culture and immunostaining, Klaus Rohrschneider for statistical analysis, and Bernhard Mechlers’ laboratory (German Cancer Research Center, Heidelberg, Germany) for help with Northern blot analysis and computer imaging.


    Footnotes
 
Supported by Deutsche Forschungsgemeinschaft (DFG), Bonn, Germany (Kr 993/12-1) and Gertrud Kusen-Stiftung Hamburg.

Submitted for publication February 26, 2001; revised July 6, 2001; accepted July 24, 2001.

Commercial relationships policy: N.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Friedrich E. Kruse, Augenklinik der Universität Heidelberg, Im Neuenheimer Feld 400, 69120 Heidelberg, Germany; friedrich_kruse{at}med.uni-heidelberg.de.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mishima, H, Nakamura, M, Murakami, J, Nishida, T, Otori, T. (1992) Transforming growth factor-beta modulates effects of epidermal growth factor on corneal epithelial cells Curr Eye Res 11,691-696[Medline][Order article via Infotrieve]
  2. Honma, Y, Nishida, K, Sotozono, C, Kinoshita, S. (1997) Effect of transforming growth factor-ß1 and -ß2 on in vitro rabbit corneal epithelial proliferation promoted by epidermal growth factor, keratinocyte growth factor, or hepatocyte growth factor Exp Eye Res 65,391-396[Medline][Order article via Infotrieve]
  3. Imanishi, J, Kamiyama, K, Iguchi, I, Kita, M, Sotozono, C, Kinoshita, S. (2000) Growth factors: importance in wound healing and maintenance of transparency of the cornea Prog Retinal Eye Res 19,113-129[Medline][Order article via Infotrieve]
  4. Grant, MB, Khaw, PT, Schultz, GS, Adams, JL, Shimizu, RW (1992) Effects of epidermal growth factor, fibroblast growth factor, and transforming growth factor-beta on corneal cell chemotaxis Invest Ophthalmol Vis Sci 33,3292-3301[Abstract/Free Full Text]
  5. Masur, SK, Dewal, HS, Dinh, TT, Erenburg, I, Petridou, S. (1996) Myofibroblasts differentiate from fibroblasts when plated at low density Proc Natl Acad Sci USA 93,4219-4223[Abstract/Free Full Text]
  6. Jester, JV, Barry-Lane, PA, Cavanagh, HD, Petroll, WM (1996) Induction of alpha-smooth muscle actin expression and myofibroblast transformation in cultured corneal keratocytes Cornea 15,505-516[Medline][Order article via Infotrieve]
  7. Jester, JV, Huang, J, Barry-Lane, PA, Kao, WW, Petroll, WM, Cavanagh, HD (1999) Transforming growth factor(beta)-mediated corneal myofibroblast differentiation requires actin and fibronectin assembly Invest Ophthalmol Vis Sci 40,1959-1967[Abstract/Free Full Text]
  8. Kingsley, DM (1994) The TGF-beta superfamily: new members, new receptors, and new genetic tests of function in different organisms Genes Dev 8,133-146[Free Full Text]
  9. Massague, J, Attisano, L, Wrana, L. (1997) The TGF-ß family and its composite receptors Trends Cell Biol 4,172-178
  10. Mathews, LS, Vale, WW (1991) Expression cloning of an activin receptor, a predicted transmembrane serine kinase Cell 65,973-982[Medline][Order article via Infotrieve]
  11. Ten Dijke, P, Yamashita, H, Ichijo, H, et al (1994) Characterization of type I receptors for transforming growth factor-beta and activin Science 264,101-104[Abstract/Free Full Text]
  12. Li, DQ, Tseng, SC (1995) Three patterns of cytokine expression potentially involved in epithelial-fibroblast interactions of human ocular surface J Cell Physiol 163,61-79[Medline][Order article via Infotrieve]
  13. Joyce, NC, Zieske, JD (1997) Transforming growth factor-beta receptor expression in human cornea Invest Ophthalmol Vis Sci 38,1922-1928[Abstract/Free Full Text]
  14. Mohan, RR, Kim, WJ, Mohan, RR, Chen, L, Wilson, SE (1998) Bone morphogenetic proteins 2 and 4 and their receptors in the adult human cornea Invest Ophthalmol Vis Sci 39,2626-2636[Abstract/Free Full Text]
  15. You, L, Kruse, FE, Pohl, J, Völcker, HE (1999) Bone morphogenetic proteins and growth and differentiation factors in the human cornea Invest Ophthalmol Vis Sci 40,296-311[Abstract/Free Full Text]
  16. Kim, WJ, Mohan, RR, Mohan, RR, Wilson, SE (1999) Effect of PDGF, IL-1alpha, and BMP2/4 on corneal fibroblast chemotaxis: expression of the platelet-derived growth factor system in the cornea Invest Ophthalmol Vis Sci 40,1364-1372[Abstract/Free Full Text]
  17. Kretzschmar, M, Massague, J. (1998) SMADs: mediators and regulators of TGF-beta signaling Curr Opin Genet Dev 8,103-111[Medline][Order article via Infotrieve]
  18. Massague, J, Blain, SW, Lo, RS (2000) TGF-beta signaling in growth control, cancer, and heritable disorders Cell 103,295-309[Medline][Order article via Infotrieve]
  19. Petridou, S, Maltseva, O, Spanakis, S, Masur, SK (2000) TGF-beta receptor expression and Smad 2 localization are cell density dependent in fibroblasts Invest Ophthalmol Vis Sci 41,89-95[Abstract/Free Full Text]
  20. Gabbiani, G. (1998) Evolution and clinical implications of the myofibroblast concept Cardiovasc Res 38,545-548[Free Full Text]
  21. Jester, JV, Rodrigues, MM, Herman, IM (1987) Characterization of avascular corneal wound healing fibroblasts: new insights into the myofibroblast Am J Pathol 127,140-148[Abstract]
  22. Jester, JV, Barry, PA, Lind, GJ, Petroll, WM, Garana, R, Cavanagh, HD (1994) Corneal keratocytes: in situ and in vitro organization of cytoskeletal contractile proteins Invest Ophthalmol Vis Sci 35,730-743[Abstract/Free Full Text]
  23. Jester, JV, Petroll, WM, Barry, PA, Cavanagh, HD (1995) Expression of alpha-smooth muscle (alpha-SM) actin during corneal stromal wound healing Invest Ophthalmol Vis Sci 36,809-819[Abstract/Free Full Text]
  24. Nakamura, T, Takio, K, Eto, Y, Shibai, H, Titani, K, Sugino, H. (1990) Activin-binding protein from rat ovary is follistatin Science 247,836-838[Abstract/Free Full Text]
  25. Eto, Y, Tsuji, T, Takezawa, M, Takano, S, Yokogawa, Y, Shibai, H. (1987) Purification and characterization of erythroid differentiation factor (EDF) isolated from human leukemia cell line THP-1 Biochem Biophys Res Commun 142,1095-1103[Medline][Order article via Infotrieve]
  26. Murata, M, Onomichi, K, Eto, Y, Shibai, H, Muramatsu, M. (1988) Expression of Erythroid differentiation factor (EDF) in Chinese hamster ovary cells Biochem Biophys Res Commun 151,230-235[Medline][Order article via Infotrieve]
  27. Shiozaki, M, Kosaka, M, Eto, Y. (1998) Activin A: a commitment factor in erythroid differentiation Biochem Biophys Res Commun 242,631-635[Medline][Order article via Infotrieve]
  28. Ozkaynak, E, Rueger, DC, Drier, EA, et al (1990) OP-1 cDNA encodes an osteogenic protein in the TGF-beta family EMBO J 9,2085-2093[Medline][Order article via Infotrieve]
  29. Vale, W, Rivier, C, Hsueh, A, et al (1988) Chemical and biological characterization of the inhibin family of protein hormones Recent Prog Horm Res 44,1-34
  30. Mather, JP, Moore, A, Li, R. (1997) Activins, inhibins, and follistatins: further thoughts on a growing family of regulators Proc Soc Exp Biol Med 215,209-222[Abstract]
  31. Di Simone, N, Crowley, WF, Wang, QF, Sluss, PM, Schneyer, AL (1996) Characterization of inhibin/activin subunit, follistatin, and activin type II receptors in human ovarian cancer cell lines: a potential role in autocrine growth regulation Endocrinology 137,486-494[Abstract]
  32. Wang, QF, Tilly, KI, Tilly, JL, et al (1996) Activin inhibits basal and androgen-stimulated proliferation and induces apoptosis in the human prostatic cancer cell line, LNCaP Endocrinology 137,5476-5483[Abstract]
  33. Gurdon, JB, Harger, P, Mitchell, A, Lemaire, P. (1994) Activin signalling and response to a morphogen gradient Nature 371,487-492[Medline][Order article via Infotrieve]
  34. Vale, W, Rivier, J, Vaughan, J, et al (1986) Purification and characterization of an FSH releasing protein from porcine ovarian follicular fluid Nature 321,776-779[Medline][Order article via Infotrieve]
  35. Mather, JP, Woodruff, TK, Krummen, LA (1992) Paracrine regulation of reproductive function by inhibin and activin Proc Soc Exp Biol Med 201,1-15[Medline][Order article via Infotrieve]
  36. Petraglia, F, Sacerdote, P, Cossarizza, A, et al (1991) Inhibin and activin modulate human monocyte chemotaxis and human lymphocyte interferon-gamma production J Clin Endocrinol Metab. 72,496-502[Abstract]
  37. Hübner, G, Hu, Q, Smola, H, Werner, S. (1996) Strong induction of activin expression after injury suggests an important role of activin in wound repair Dev Biol 173,490-498[Medline][Order article via Infotrieve]
  38. Seishima, M, Nojiri, M, Akiyama, T, et al (1996) Expression of activin A in human keratinocytes at early stages of cultivation FEBS Lett 398,120-124[Medline][Order article via Infotrieve]
  39. Ishizaki, M, Zhu, G, Haseba, T, Shafer, SS, Kao, WW (1993) Expression of collagen I, smooth muscle alpha-actin, and vimentin during the healing of alkali-burned and lacerated corneas Invest Ophthalmol Vis Sci 34,3320-3328[Abstract/Free Full Text]
  40. Matsuse, T, Ikegami, A, Ohga, E, et al (1996) Expression of immunoreactive activin A protein in remodeling lesions associated with interstitial pulmonary fibrosis Am J Pathol 148,707-713[Abstract]
  41. Ohga, E, Matsuse, T, Teramoto, S, et al (1996) Effects of activin A on proliferation and differentiation of human lung fibroblasts Biochem Biophys Res Commun 228,391-396[Medline][Order article via Infotrieve]
  42. Kojima, I, Mogami, H, Kawamura, N, Yasuda, H, Shibata, H. (1993) Modulation of growth of vascular smooth muscle cells by activin A Exp Cell Res 206,152-156[Medline][Order article via Infotrieve]
  43. Desmouliere, A, Geinoz, A, Gabbiani, F, Gabbiani, G. (1993) Transforming growth factor-beta 1 induces alpha-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts J Cell Biol 122,103-111[Abstract/Free Full Text]
  44. Ronnov-Jessen, L, Petersen, OW (1993) Induction of alpha-smooth muscle actin by transforming growth factor-beta 1 in quiescent human breast gland fibroblasts. Implications for myofibroblast generation in breast neoplasia Lab Invest 68,696-607[Medline][Order article via Infotrieve]
  45. Jaffe, GJ, Roberts, WL, Wong, HL, Yurochko, AD, Cianciolo, GJ (1995) Monocyte-induced cytokine expression in cultured human retinal pigment epithelial cells Exp Eye Res 60,533-543[Medline][Order article via Infotrieve]
  46. Jaffe, GJ, Harrison, CE, Lui, GM, et al (1994) Activin expression by cultured human retinal pigment epithelial cells Invest Ophthalmol Vis Sci 35,2924-2931[Abstract/Free Full Text]
  47. Hautmann, MB, Madsen, CS, Owens, GK (1997) A transforming growth factor beta (TGF beta) control element drives TGFbeta-induced stimulation of smooth muscle alpha-actin gene expression in concert with two CArG elements J Biol Chem 272,10948-10956[Abstract/Free Full Text]
  48. Nishida, K, Kinoshita, S, Yokoi, N, Kaneda, M, Hashimito, K, Yamamoto, S. (1994) Immunohistochemical localization of transforming growth factor-ß1, -ß2 and -ß3 latency-associated peptide in human cornea Invest Ophthalmol Vis Sci 35,3289-3294[Abstract/Free Full Text]
  49. Uchimaru, K, Motokura, T, Takahashi, S, Sakurai, T, Asano, S, Yamashita, T. (1995) Bone marrow stromal cells produce and respond to activin A: interactions with basic fibroblast growth factor and platelet-derived growth factor Exp Hematol 23,613-618[Medline][Order article via Infotrieve]
  50. van der Kruijssen, CMM, Feijen, A, Huylebroeck, D, van den Eijnden-van Raaij, AJM. (1993) Modulation of activin expression by type ß transforming growth factors Exp Cell Res 207,407-412[Medline][Order article via Infotrieve]
  51. Peik, E, Moustakas, A, Kurisaki, A, Heldin, CH, ten Dijke, P. (1999) TGF-(beta) type I receptor/ALK-5 and. Smad proteins mediate epithelial to mesenchymal transdifferentiation in NMuMG breast epithelial cells J Cell Sci 112,4557-4568[Abstract]
  52. Inada, M, Katagiri, T, Akiyama, S, et al (1996) Bone morphogenetic protein-12 and 13 inhibit terminal differentiation of myoblasts, but do not induce their differentiation into osteoblasts Biochem Biophys Res Commun 222,317-322[Medline][Order article via Infotrieve]
  53. Katagiri, T, Yamaguchi, A, Komaki, M, et al (1994) Bone morphogenetic protein-2 converts the differentiation pathway of C2C12 myoblasts into the osteoblast lineage J Cell Biol 127,1755-1766[Abstract/Free Full Text]
  54. Zhang, Y, Feng, X, We, R, Derynck, R. (1996) Receptor-associated Mad homologues synergize as effectors of the TGF-beta response Nature 383,168-172[Medline][Order article via Infotrieve]
  55. Macias-Silva, M, Abdollah, S, Hoodless, PA, Pirone, R, Attisano, L, Wrana, JL (1996) MADR2 is a substrate of the TGF-ß receptor and its phosphorylation is required for nuclear accumulation and signaling Cell 87,1215-1224[Medline][Order article via Infotrieve]
  56. Liu, F, Pouponnot, C, Massague, J. (1997) Dual role of the Smad4/DPC4 tumor suppressor in TGFbeta-inducible transcriptional complexes Genes Dev 11,3157-3167[Abstract/Free Full Text]
  57. Moustakas, A, Kardassis, D. (1998) Regulation of the human p21/WAF1/Cip1 promoter in hepatic cells by functional interactions between Sp1 and Smad family members Proc Natl Acad Sci USA 95,6733-6738[Abstract/Free Full Text]
  58. Zhang, Y, Feng, XH, Derynck, R. (1998) Smad3 and Smad4 cooperate with c-Jun/c-Fos to mediate TGF-beta-induced transcription Nature 394,909-913[Medline][Order article via Infotrieve]
  59. Sano, Y, Harada, J, Tashiro, S, Gotoh-Mandeville, R, Maekawa, T, Ishii, S (1999) ATF-2 is a common nuclear target of Smad and TAK1 pathways in transforming growth factor-beta signaling J Biol Chem 274,8949-8957[Abstract/Free Full Text]
  60. Chen, X, Rubock, MJ, Whitman, M. (1996) A transcriptional partner for MAD proteins in TGF-beta signalling Nature 383,691-696[Medline][Order article via Infotrieve]
  61. Macias-Silva, M, Hoodless, PA, Tang, SJ, Buchwald, M, Wrana, JL (1998) Specific activation of Smad1 signaling pathways by the BMP7 type I receptor, ALK2 J Biol Chem 273,25628-25636[Abstract/Free Full Text]
  62. Yang, X, Ji, X, Shi, X, Cao, X. (2000) Smad1 domains interacting with Hoxc-8 induce osteoblast differentiation J Biol Chem 275,1065-1072[Abstract/Free Full Text]
  63. Ulloa, L, Doody, J, Massague, J. (1999) Inhibition of transforming growth factor-beta/SMAD signalling by the interferon-gamma/STAT pathway Nature 397,710-713[Medline][Order article via Infotrieve]
  64. Hata, A, Seoane, J, Lagna, G, Montalvo, E, Hemmati-Brivanlou, A, Massague, J. (2000) OAZ uses distinct DNA- and protein-binding zinc fingers in separate BMP-Smad and Olf signaling pathways Cell 100,229-240[Medline][Order article via Infotrieve]
  65. Dorai, H, Vukicevic, S, Sampath, TK (2000) Bone morphogenetic protein-7 (osteogenic protein-1) inhibits smooth muscle cell proliferation and stimulates the expression of markers that are characteristic of SMC phenotype in vitro J Cell Physiol 184,37-45[Medline][Order article via Infotrieve]
  66. Janknecht, R, Wells, NJ, Hunter, T. (1998) TGF-beta-stimulated cooperation of smad proteins with the coactivators C BP/p300 Genes Dev 12,2114-2119[Abstract/Free Full Text]
  67. Luo, K, Stroschein, SL, Wang, W, et al (1999) The Ski oncoprotein interacts with the Smad proteins to repress TGFbeta signaling Genes Dev 13,2196-2206[Abstract/Free Full Text]
  68. Stroschein, SL, Wang, W, Zhou, S, Zhou, Q, Luo, K. (1999) Negative feedback regulation of TGF-beta signaling by the SnoN oncoprotein Science 286,771-774[Abstract/Free Full Text]
  69. Wang, W, Mariani, FV, Harland, RM, Luo, K. (2000) Ski represses bone morphogenic protein signaling in xenopus and mammalian cells Proc Natl Acad Sci USA 97,14394-14399[Abstract/Free Full Text]
  70. Hocevar, BA, Brown, TL, Howe, PH (1999) TGF-beta induces fibronectin synthesis through a c-Jun N-terminal kinase-dependent, Smad4-independent pathway EMBO J 18,1345-1356[Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Fu, M. J. Corbley, L. Sun, J. E. Friedman, F. Shan, J. L. Papadatos, D. Costa, F. Lutterodt, H. Sweigard, S. Bowes, et al.
SM16, an Orally Active TGF-{beta} Type I Receptor Inhibitor Prevents Myofibroblast Induction and Vascular Fibrosis in the Rat Carotid Injury Model
Arterioscler. Thromb. Vasc. Biol., April 1, 2008; 28(4): 665 - 671.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
R. J. Wordinger and A. F. Clark
Bone Morphogenetic Proteins and Their Receptors in the Eye
Experimental Biology and Medicine, September 1, 2007; 232(8): 979 - 992.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J. K. Mouw, J. T. Connelly, C. G. Wilson, K. E. Michael, and M. E. Levenston
Dynamic Compression Regulates the Expression and Synthesis of Chondrocyte-Specific Matrix Molecules in Bone Marrow Stromal Cells
Stem Cells, March 1, 2007; 25(3): 655 - 663.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Saika, K. Ikeda, O. Y