IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lenzner, S.
Right arrow Articles by Berger, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lenzner, S.
Right arrow Articles by Berger, W.
(Investigative Ophthalmology and Visual Science. 2002;43:2825-2833.)
© 2002 by The Association for Research in Vision and Ophthalmology, Inc.

Global Gene Expression Analysis in a Mouse Model for Norrie Disease: Late Involvement of Photoreceptor Cells

Steffen Lenzner, Sandra Prietz, Silke Feil, Ulrike A. Nuber, H.-Hilger Ropers and Wolfgang Berger

From the Max Planck Institute for Molecular Genetics, Berlin, Germany.


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
PURPOSE. Mutations in the NDP gene give rise to a variety of eye diseases, including classic Norrie disease (ND), X-linked exudative vitreoretinopathy (EVRX), retinal telangiectasis (Coats disease), and advanced retinopathy of prematurity (ROP). The gene product is a cystine-knot–containing extracellular signaling molecule of unknown function. In the current study, gene expression was determined in a mouse model of ND, to unravel disease-associated mechanisms at the molecular level.

METHODS. Gene transcription in the eyes of 2-year-old Ndp knockout mice was compared with that in the eyes of age-matched wild-type control animals, by means of cDNA subtraction and microarrays. Clones (n = 3072) from the cDNA subtraction libraries were spotted onto glass slides and hybridized with fluorescently labeled RNA-derived targets. More than 230 differentially expressed clones were sequenced, and their expression patterns were verified by virtual Northern blot analysis.

RESULTS. Numerous gene transcripts that are absent or downregulated in the eye of Ndp knockout mice are photoreceptor cell specific. In younger Ndp knockout mice (up to 1 year old), however, all these transcripts were found to be expressed at normal levels.

CONCLUSIONS. The identification of numerous photoreceptor cell–specific transcripts with a reduced expression in 2-year-old, but not in young, Ndp knockout mice indicates that normal gene expression in these light-sensitive cells of mutant mice is established and maintained over a long period and that rods and cones are affected relatively late in the mouse model of ND. Obviously, the absence of the Ndp gene product is not compatible with long-term survival of photoreceptor cells in the mouse.


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Ocular symptoms of Norrie disease, a rare X-linked recessive form of congenital blindness, include bilateral leukokoria soon after birth, vascularized retrolental membranes, retinal detachment, and progressive shrinking of the eye. At least one third of affected males have mental retardation and experience progressive hearing loss in later life.1 2 The NDP gene was isolated by positional cloning. Mutation analyses demonstrated that mental handicaps and hearing deficiencies are pleiotropic effects of a single gene defect.3 4 5 6 Mutations in the NDP gene also account for a variety of other familial and sporadic eye diseases, including exudative vitreoretinopathy, retinopathy of prematurity, and Coats disease.7 8 9 Disease symptoms of these traits are confined to the inner eye or retina; neither mental retardation nor deafness is observed. The predicted protein consists of 133 amino acid residues and contains an N-terminal signal sequence and a cystine-knot motif at its carboxyl-terminal end. Three-dimensional computer modeling of the amino acid sequence reveals striking similarity with transforming growth factor-ß (TGFß),10 suggesting that this protein is involved in developmental and differentiation processes. However, the precise function of the gene has been hitherto unknown.

Prior to the current study, we generated a mouse model for ND by homologous recombination in embryonic stem cells.11 In the mouse, the Ndp gene is expressed in the inner layers of the retina, but also in brain and ear, as shown by RNA in situ hybridization.11 12 Thus, the expression pattern matches the tissues affected in human disease. Morphologic characteristics in the eyes of mutant mice include retrolental structures, reduced number of retinal ganglion cells, regional disorganization of the inner nuclear and photoreceptor cell layers, and malformation of the retinal vasculature.11 13 Electrophysiologic recordings reveal a negatively shaped b-wave of the electroretinogram, suggesting a predominant loss of inner retinal components.14 Hearing deficits in mutant mice have also been reported.12

To shed more light on the cellular and molecular processes underlying ND in the eye, we compared gene expression patterns in mutant and wild-type mice by using cDNA subtraction and microarrays. These techniques enabled us to characterize hundreds of transcripts in parallel. For cDNA subtraction, we used whole-eye RNA from 2-year-old mice. Several thousand clones from the subtractions were printed on glass slides and used as probes to target cDNA from wild-type and Ndp knockout mice for differential expression. Approximately 1600 differentially expressed clones were identified and characterized in more detail.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Animals
Ndp knockout mice were obtained by gene-targeting, as described previously.11 Animal studies were conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the regulation for animal experiments of the federal government of Germany.

Light Microscopy
The enucleated eyes were immersion fixed for 5 hours in 2.5% glutaraldehyde in 0.05 M sodium cacodylate buffer. The cornea and lens were then removed. After postfixation in 2.5% glutaraldehyde overnight, the tissue was fixed in cacodylate-buffered osmium tetroxide (1%) for 1 hour and embedded in Spurr resin. For light microscopy analysis, 0.5-µm-thick sections were cut on a microtome (Ultracut E; Reichert-Jung, Arnsburg, Germany). Sections were stained with toluidine blue.

RNA Extraction
Total RNA was isolated from mouse eyes with an extraction kit (RNeasy; Qiagen, Hilden, Germany). Briefly, tissues were disrupted and simultaneously homogenized (Polytron PT 3100; VWR International, Darmstadt, Germany) in lysis buffer containing guanidinium isothiocyanate. The sample was then applied to an RNA extraction column, in which the total RNA bound to the silica-gel matrix, and contaminants were efficiently washed away. High-quality RNA (longer than 200 bases) was eluted in water.

Suppression Subtractive Hybridization
cDNAs were synthesized from 0.75 µg total RNA with a kit (Smart PCR cDNA synthesis kit; BD Biosciences-Clontech, Heidelberg, Germany). Single-stranded cDNA was amplified by long-distance PCR (Advantage cDNA PCR Kit; BD Biosciences-Clontech). Before subtraction, cDNA was size fractionated with spin columns (Chroma Spin-1000; BD Biosciences-Clontech), digested by RsaI, and purified (Nucleo Spin Extract; Macherey and Nagel, Düren, Germany).

Subtraction was performed (PCR-Select cDNA Subtraction Kit; BD Biosciences-Clontech), according to the method described by Diatchenko et al.15 and the manufacturer’s instructions. Two separate subtractive hybridization experiments were performed for the isolation of genes suppressed (wild-type cDNA was the tester for forward subtraction) or overexpressed (knockout cDNA was the tester for reverse subtraction) in the knockout mice, respectively. We applied 27 cycles of primary PCR and 12 cycles of secondary PCR with a cDNA polymerase mix (Advantage cDNA Polymerase Mix; BD Biosciences-Clontech).

Subtraction Efficiency Test
A comparison of the abundance of known cDNAs before and after subtraction by hybridization analysis can be used to estimate the efficiency of subtraction. Secondary PCR products (10 µL from a 25-µL reaction) of forward- and reverse-subtracted and unsubtracted samples were separated on 1.6% agarose gels and transferred onto membranes (GeneScreenPlus; NEN Life Science Products, Köln, Germany) by alkaline transfer. Hybridizations were performed overnight with 32P-labeled cDNA probes at 65°C in 0.5 M phosphate buffer, 7% SDS, and 1 mM EDTA.

Generation of Complete cDNAs
Complete cDNAs of five selected genes were amplified by RT-PCR using whole-eye RNA and sequence-specific primers (Pde6b: 5'-CAGTGAGGAACAGGTACGCA and 5'-AGGCAGAGTCCGTATGCAGT, 2623 bp; Bcp: 5'-GAATATCTCTTCGGTGGGGC and 5'-AGTGAGGGCCAACTTTGCTA, 1007 bp; Sag: 5'-CTGATAGGATTGCACCAGGTC and 5'-ATTTCTGGGAGGAATGCTCA, 1482 bp; Rpr1: 5'-TCAGTGGACAGCGATTCTCA and 5'-GCCCAAATAAAAATGCCAAG, 1158 bp; Xlrs1: 5'-GACCAAGGACAAGGAGAAAATGC, and 5'- TGATCCAAAGGTAGCCAGAAT, 5565 bp).

Cloning of the Subtraction Libraries
Subtracted secondary PCR products were ligated into a plasmid vector from a T/A cloning kit (pGEM-T Easy plasmid vector; Promega, Mannheim, Germany). The resultant constructs were transformed by electroporation into XL1 Blue–competent cells (Stratagene, Heidelberg, Germany) and selected by blue–white screening. Colonies were chosen randomly, placed in 96-well plates, and grown for 16 hours in 100 µL LB medium containing ampicillin (50 µg/mL). For long-term storage (-80°C), an equal volume of glycerol was added.

Microarray Construction
Clone inserts were PCR amplified with vector-specific standard M13 primers (M13for-TG: 5'-GTAAAACGACGGCCAGTG and M13rev-C: 5'- caggaaacagctatgacc). Subsequently, a nested PCR-reaction with 5' amino-modified, adaptor-specific primers NPp1 (5'-amino- TCGAGCGGCCGCCCGGGCAGGT) and NPp2R (5'-amino- AGCGTGGTCGCGGCCGAGGT) was performed. Control genes (62 retina-specific genes [201 expressed sequence tags (ESTs)], 31 housekeeping genes [111 ESTs, used for normalization of fluorescence intensities], and 17 different plant cDNAs [used as the negative control and for background estimation]) were amplified with 5' amino-modified M13 primers (M13for-TG and M13rev-C). By agarose gel electrophoresis, evaluated PCR products were ethanol precipitated, washed in 70% ethanol, air dried, and resuspended in 8 µL 100 mM sodium carbonate (pH 9). Microarrays were printed on pretreated amino-silane–coated slides (PE-Applied Biosystems, Weiterstadt, Germany) using a robotic spotting device (Beecher Instruments, Silver Spring, MD). Spotting volume was approximately 5 nL per spot, resulting in spots approximately 200 µm in diameter.

Labeling of Targets and Microarray Hybridization
In general, targets (complete cDNAs, pools of PCR-amplified inserts, and subtraction products) were labeled by random priming in 60 µL labeling buffer containing 6.3 µg decanucleotides; 15 µM each of dGTP, dCTP, and dATP (Decalabel; MBI Fermentas, Vilnius, Lithuania); and 15 µM Cy3- or Cy5-dUTP (Amersham, Freiburg, Germany). Cy3- and Cy5-labeled targets were cohybridized on a single microarray. Each hybridization was replicated at least once, with a color swap.

Total RNA (25 µg) was reverse transcribed by direct incorporation of fluorescent dyes in a reaction containing 1 µg oligo(dT), 100 µM Cy3- or Cy5-dUTP (Amersham), 200 µM dTTP, and 500 µM each of dGTP, dCTP, and dATP (Roche Diagnostics, Mannheim, Germany).

Labeled products were purified with a kit (Qiaquick PCR Purification; Qiagen) and combined, and 30 µg mouse DNA enriched for repetitive sequences (mouse-COT-1 DNA; Gibco), 25 µg yeast t-RNA (Gibco), and 20 µg poly(dA-dT) were added. To block unspecific signals caused by cross-hybridization of flanking primer sequences of the subtraction products, an oligonucleotide mix containing the nested primers NPp1 and NPp2R and their complementary sequences was added. Products were dried in a speedvac, dissolved in a formamide-based hybridization buffer (50% formamide, 6x SSC, 0.5% SDS, and 5x Denhardt solution), and hybridized under a coverslip in a humid chamber for 16 hours at 42°C. Unbound targets were washed away by a 5-minute incubation in 0.01% SDS and 0.2x SSC, followed by two 5-minute incubations in 0.2x SSC at room temperature.

Image Acquisition and Data Analysis
Hybridization signals were detected with a confocal laser scanner (model 418; Affymetrix, Santa Clara, CA). Sixteen-bit TIF-tagged images, with intensities ranging from 1 to 65,536 arbitrary units, were obtained for each dye and virtually merged by using an extension of image analysis software (IPLab Spectrum; Scanalytics, Billerica, MA). Background-corrected mean spot intensities were obtained from each processed picture using the algorithms of Chen et al.16 Data sets were transferred to a spreadsheet computer program (Excel; Microsoft, Redmond, WA). Plant genes, clones without an insert, and empty spots were used to estimate nonspecific hybridization signals and background. Signals from clones containing mitochondrial sequences were used to normalize arrays with regard to labeling bias, differences in quantum yield, and photobleaching of the dyes.

In the comparative analysis, transcript levels were considered significantly different when the ratio of the experimental to the control average fluorescence intensities was more than threefold and the average fluorescence intensity was greater than 1000 arbitrary units. The latter criteria minimized selection of genes that showed multifold changes over a control involving weak absolute responses (low average fluorescence intensities).

DNA Sequencing
Putative differentially expressed clones were chosen from glycerol stocks. Plasmid DNA was prepared using a robot and a kit (model 9600 robot and Turbo kit; Qiagen). Inserts of recombinant clones were sequenced (Big Dye terminator chemistry; PE-Applied Biosystems). The sequencing gels were run (model ABI377 sequencer; PE-Applied Biosystems), and data were assembled and edited using the GAP4 Contig Editor (provided in the public domain by the Laboratory of Molecular Biology, Medical Research Council, Cambridge, UK, and available at http://www.mrc-lmb.cam.ac.uk/pubseq/manual/gap4_unix_1.html).17 Sequences were compared with entries in the GenBank and EMBL databases by using the BLAST homology search program.18 (GenBank is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD, and is available at http://www.ncbi.nlm.nih.gov/Genbank/; EMBL is provided in the public domain by the European Molecular Biology Laboratory, Heidelberg, Germany, and is available at http://www.embl-heidelberg.de/.)

Virtual Northern Blot Analysis
Plasmids of individual clones were digested with RsaI (New England Biolabs, Frankfurt am Main, Germany), and inserts were recovered for hybridization experiments. PCR-amplified cDNAs (15 µL from a 100-µL reaction; Smart PCR cDNA synthesis kit; BD Biosciences-Clontech) from wild-type and Ndp knockout mice were electrophoresed, blotted, and hybridized, as described for the subtraction efficiency test.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Suppression Subtractive Hybridization, Characterization of Subtraction Libraries, and Construction of a cDNA Microarray
To identify changes in gene expression in the eyes of Ndp knockout mice, we used suppression subtractive hybridization (SSH), a subtractive hybridization technique that enriches the amount of cDNA fragments from transcripts present in one population of mRNAs (tester) but absent from another (driver). The technique simultaneously reduces fragments of equally expressed genes. Subtraction was performed in both orientations, forward (tester: wild-type whole-eye RNA) and reverse (tester: knockout whole-eye RNA). The forward subtraction was performed to identify genes downregulated or not expressed in 2-year-old knockout mice, and the reverse library was generated to recognize upregulated genes.

From the forward-subtraction library, 96 randomly chosen clones were analyzed in an initial differential screening test by hybridizing the inserts to blots of wild-type and knockout cDNAs (virtual Northern blot analysis). A large percentage of clones (49/96; 51%) detected normal signal intensities in wild-type but no or weak signals in knockout cDNA, indicating lower levels or complete loss of expression in the eyes of knockout mice. Hybridization of 38 randomly selected clones from the reverse library revealed no expression differences between wild-type and mutant mice. Because of this result, we determined the efficiency of subtractive suppression. In addition to the subtractive enrichment, SSH excludes sequences that the tester and driver have in common (subtractive suppression). The hybridization of probes from two housekeeping genes (Gapdh and mt-Nd1) to wild-type and knockout cDNAs before and after SSH showed their reduction in both subtracted samples (Fig. 1) . To determine the enrichment rate of tester-specific fragments, we hybridized two clones from the forward-subtraction library (clones 90 and 975) to blotted cDNAs and subtraction products. The abundance of both fragments was significantly increased in the forward subtraction (Fig. 1) . In addition, we performed a PCR-based subtraction efficiency test (data not shown) and obtained consistent results. Altogether, these data demonstrate a high fidelity of cDNA subtraction in both orientations (forward and reverse subtraction).



View larger version (85K):
[in this window]
[in a new window]
 
Figure 1. Subtraction efficiency test. Virtual Northern blot analysis of four RsaI fragments from different mRNAs on wild-type and knockout mice cDNAs before and after subtraction (forward: tester is wild-type; reverse: tester is knockout). The concentrations of the housekeeping transcripts (Gapdh and mt-Nd1) were considerably lower after forward and reverse subtraction. The clone inserts 90 and 975 are RsaI fragments from different mRNAs that are absent or significantly reduced in knockout tissue. The abundance of both fragments was highly enriched during forward subtraction.

 
Because 49 of 96 clones from the forward-subtraction library were identified as differentially expressed genes (i.e., RNA transcripts present in wild-type but absent or reduced in mutant mice), we analyzed this library in more detail. The inserts of further 3072 clones were PCR-amplified and spotted together with controls onto glass slides. Subsequently, the cDNA microarray was hybridized with fluorescently labeled subtracted cDNA targets (e.g., Cy3-labeled forward-subtraction product and Cy5-labeled reverse-subtraction product, Fig. 2A ). Based on the 96 clones assessed in the previous differential screening test, criteria were defined to identify additional differentially expressed cDNA fragments (see the Methods section). On the microarray, 1565 of 3072 clones (i.e., 51%) fulfilled these criteria. Before individual inserts were tested for differential expression, redundant clones were eliminated. The full-length cDNAs of five genes (Pde6b, Opn1sw, Sag, Rpr1, and Rsh1) representing 13 of the precharacterized set of 96 clones were hybridized to the microarray. In this way, 339 of 1565 clones were excluded from further analysis. Of the remaining 1226 clones, 295 were then hybridized on virtual Northern blots. Differential expression was confirmed for 187 (63.4%) of them. Some of the corresponding transcripts were completely absent in knockout mice, whereas others showed a decreased expression level in the affected tissue (Fig. 2B) . Consistent results were obtained for more than 100 of these clones on a second pair of (wild-type and knockout) animals.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 2. (A) cDNA microarray hybridization with subtracted targets. The microarray containing 3072 PCR-amplified cDNA clones from the forward-subtraction library and controls was hybridized with fluorescently labeled forward-subtracted (Cy3) and reverse-subtracted (Cy5) targets. Green signals: genes with a higher expression in the forward-subtracted target; red signals: false positives or artifacts of the subtraction process; and yellow signals: transcripts with an equal expression in both targets. Of the 3072 clones in the microarray, 1565 fulfilled the criteria for differential expression. White boxes: cDNA clones from the forward-subtraction library representing RsaI fragments of the indicated transcripts. (B) Confirmation of differential expression on virtual Northern blot analysis. Selected cDNA clones were hybridized on Southern blots containing equal amounts of PCR-amplified cDNA from whole eyes of 2-year-old wild-type and Ndp knockout mice, respectively. A clone for alcohol dehydrogenase family-3 (Ahd3), which exhibits identical expression levels in wild-type and Ndp knockout mice served as a control. (C, D) Hybridization of cDNA microarrays with PCR-amplified whole-eye cDNA targets derived from animals at 4 weeks (C) and 2 years (D) of age. The cDNAs from wild-type and Ndp knockout mice were fluorescently labeled with Cy3 and Cy5, respectively, and cohybridized to the microarray. Numerous differentially expressed clones were detected late in disease (D), but not in young Ndp knockout mice (C).

 
Identity of Differentially Expressed Clones and Calculation of Number of Genes in the Microarray
All 236 confirmed differentially expressed clones (49/96 and 187/3072) were sequenced. Of those, 156 represented 83 known genes (mouse genes or human orthologues). Further, 67 clones were part of 51 different ESTs, and 13 clones did not show homology to any known sequences (sequence information provided on a Web site hosted by the Max Planck Institute for Molecular Genetics, Berlin, Germany, at http://www.molgen.mpg.de/~norrie/iovs/welcome.html). Among known genes, structural proteins of photoreceptor cells (peripherin and rod outer membrane protein) and numerous components of the phototransduction cascade (rhodopsin, transducin, two phosphodiesterase subunits, arrestin, guanylate cyclase–activating protein, and cyclic guanosine monophosphate [cGMP] gated cation channel) were identified. The human orthologues of 13 of these transcripts have been shown to be mutated in familial forms of photoreceptor degeneration. We also found genes involved in calcium binding, signal transduction, and exocytosis, RNA-binding, apoptosis, and cytoskeleton organization. The results of sequence-based gene identification are summarized in Table 1 Go Go .


View this table:
[in this window]
[in a new window]
 
Table 1. Differentially Expressed Genes

 

View this table:
[in this window]
[in a new window]
 
Table 1A. Differentially Expressed Genes (continued)

 

View this table:
[in this window]
[in a new window]
 
Table 1B. Differentially Expressed Genes (continued)

 
To estimate the number of individual transcripts in the subtraction library we ascertained the frequency of identical fragments by screening the microarray with nine pools each containing 6 to 14 individual clone inserts. On average, each fragment occurred with a frequency of two to three. Subsequently, we calculated the number of amplifiable RsaI fragments per transcript. Sequence data for 12 complete cDNAs were extracted from the database or generated by sequencing of full-length RT-PCR products. On average, each transcript contained five amplifiable RsaI fragments. Correspondingly, clones from the forward-subtraction library (n = 3072) should represent approximately 250 different transcripts. On virtual Northern blot analysis, 49 (51%) of 96 randomly selected clone inserts from the forward-subtraction library detected differentially expressed transcripts. Hence, this library contains at least 126 transcripts that are underrepresented in the eyes of knockout mice.

Differential Gene Expression during Disease Progression
Initially, the temporal transcription pattern of the Ndp gene itself was analyzed to confirm whether the gene is active throughout life. Indeed, the transcript was detected on virtual Northern blot analysis from postnatal day 14 up to 2 years of age in the eyes of wild-type mice (Fig. 3) . As expected, no transcript was found in all Ndp knockout mice.11 To monitor differential gene expression early in disease, the cDNA microarray was cohybridized with Cy5- and Cy3-labeled PCR-amplified cDNA targets (Smart PCR cDNA synthesis kit; BD Biosciences-Clontech) from 4-week-old Ndp knockout mice and wild-type littermates, respectively (Fig. 2C) . None of the clones on the microarray produced differential signals according to the defined criteria, whereas marked signal differences were found with PCR-amplified cDNA from 2-year-old animals (Fig. 2D) .



View larger version (86K):
[in this window]
[in a new window]
 
Figure 3. Gene expression analysis during disease progression. The Ndp cDNA and four other confirmed differential clones (representing Bcp, Pde, Rpr1, and Sag) were hybridized to virtual Northern blots containing whole-eye cDNA from wild-type and Ndp knockout mice at 0.5, 1, 3, 9, 12, and 24 months of age. The Ndp transcript is only present in wild-type mice. All others genes show normal expression up to 12 months. Only in the oldest (2-year-old) Ndp knockout mice were the expression levels drastically reduced. Gapdh served as the control.

 
In addition to PCR-amplified cDNAs, total RNAs from eyes of wild-type and Ndp knockout mice at 4 weeks and 2 years of age, respectively, were used as targets in hybridization experiments (data not shown). To obtain reliable sets of expression data, total RNAs from three independent pairs of animals were hybridized to separate microarrays. Again, the expression of photoreceptor-specific transcripts was drastically reduced only in 2-year-old but not in 4-week-old knockout mice.

Subsequently, selected differentially expressed clones were hybridized to virtual Northern blots containing total eye cDNA from wild-type and mutant mice at 0.5, 1, 3, 9, 12, and 24 months of age (Fig. 3) . These genes showed normal expression levels up to 12 months. Significant reduction of transcript levels was observed only after 2 years.

To correlate gene expression with histologic data, we examined retinal morphology in Ndp knockout mice at 24 and 29 months of age by light microscopy (Fig. 4) . All retinal layers were significantly reduced; however, remnants of photoreceptor cells were still present.



View larger version (76K):
[in this window]
[in a new window]
 
Figure 4. Light micrographs of mouse retinas from a 16-month-old male wild-type (A), a 24-month-old male Ndp knockout (B), and a 29-month-old female homozygote Ndp knockout (C) mouse. The retinas of Ndp knockout animals (B, C) showed a drastic degeneration of all retinal cell layers, particularly of the photoreceptor inner and outer segments. Sections were stained with toluidine blue. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; IS, inner segment; OS, outer segment; RPE, retinal pigment epithelium. Scale bar, 50 µm.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
To search for alterations in the gene expression pattern in the eyes of Ndp knockout mice, we used RNA from 2-year-old wild-type and mutant animals for SSH, an approach that enriches the amount of differentially expressed genes. The total number of different transcripts in the forward-subtraction library and the quantity of confirmed differentially expressed genes was calculated to be approximately 250 and 126, respectively. Most likely, the absolute numbers are much higher, because numerous clones occur only once in the subtraction library. Although SSH has been reported to detect expression differences efficiently,15 the forward-subtraction library may contain only a portion of all differentially expressed genes. Because subtractive enrichment relies on RsaI fragments of cDNAs, it apparently fails to identify transcripts that do not contain amplifiable RsaI fragments.

Because of the advanced age of the mice (2 years), the subtraction products reflect primarily consequences of disease progression. In the forward subtraction, numerous differentially expressed genes were identified that were present in wild-type, but not in mutant, mice. Absence of specific mRNAs in the eyes of mutant mice is mainly due to disease-associated loss of particular cell types, but is also due to altered gene expression. Histologic examination of the eyes of 2-year-old Ndp knockout mice revealed that all retinal cell layers were drastically reduced but still present, including photoreceptors. Possibly, the almost complete absence of several photoreceptor-specific transcripts does not result from complete loss of photoreceptors but rather from their failure to express the characteristic set of genes.

Although we used RNA from whole eyes for cDNA subtraction, many of the differentially expressed genes are known to be retina specific, consistent with the fact that disease processes in the Ndp knockout mouse are most conspicuous in retinal cells11 and that the Ndp gene is highly expressed in mouse retina. Macroscopically, the eyes of Ndp knockout mice are normal, but light and electron microscopy have revealed characteristic morphologic changes in the retina and vitreous.11 13

Studies of the electroretinogram in young mutant mice have pointed to a defect of inner retinal components, whereas the pathologic features of photoreceptors are less pronounced.14 By analyzing the gene expression of several photoreceptor-specific transcripts over time we found alterations only late in the disease.

In addition to photoreceptor-specific transcripts, differentially expressed genes encode proteins involved in Fas-mediated apoptotic cell death. Bcl-2 binding protein (Bis) and Fas apoptosis inhibitory molecule (Faim) are expressed in wild-type mice at 2 years, but not in age-matched Ndp knockout mice. Both genes code for negative regulators of apoptotic pathways. Bis itself has only weak antiapoptotic activity, but enhances Bcl-2-mediated prevention of apoptosis.19 Ectopic expression of Bcl-2 in photoreceptor cells of mice with a mutation in the peripherin (retinal degeneration slow, rds) gene protects against photoreceptor cell death.20 It also has been shown that overexpression of Bcl-2 protects photoreceptor cells in vitro against apoptosis induced by exposure to visible light.21 Faim was originally isolated by analyzing Fas-resistant B lymphocytes but was also shown to be expressed in other tissues and cell types. It functions as inducible mediator of Fas resistance, thereby affecting apoptotic processes.22 Loss of the antiapoptotic functions of Bis and Faim in Ndp knockout mice may contribute to the degeneration of photoreceptor cells during disease progression.

In summary, we identified numerous alterations in gene expression that reflect pathologic changes at the molecular level in an advanced disease stage of Ndp knockout mice. Because the Ndp gene is predominantly expressed in the inner cell layers of the adult mouse retina, and photoreceptor degeneration is seen relatively late in Ndp knockout mice, the effect of the NDP protein on rods and cones may be indirect. However, our results demonstrate that proximal retinal cell layers and continuous expression of the Ndp gene have an important function for maintenance and integrity of all retinal cell layers, in particular photoreceptor cells.

Differentially expressed genes are involved in phototransduction, protein trafficking, RNA processing, cytoskeleton and extracellular matrix turnover, apoptosis, and exo- and endocytosis. Also, numerous novel genes were shown to be differentially expressed in Ndp knockout mice, many of which may be candidate genes for retinal diseases, and their characterization promises to provide new insights into physiological processes in the retina. Clues to the initial pathogenetic processes in ND can be expected from the analysis of subtraction libraries prepared from early disease stages. Characterization of differentially expressed cDNAs from these libraries is in progress.


    Acknowledgements
 
The authors thank Wolfgang Mann and Roland Kirchner for advice on microarray technology and data analysis; Renate Kirschner, Ulrich Luhmann, and Christina Zeitz for helpful discussions and critical reading of the manuscript; and Ralph Schulz, Jens Fassen, Gerhild Lüder, and Rudi Lurz for technical assistance.


    Footnotes
 
Supported in part by Grant Be 1559/3-1 from the German Research Foundation.

Submitted for publication February 22, 2002; revised April 22, 2002; accepted May 20, 2002.

Commercial relationships policy: N.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Steffen Lenzner, Max-Planck-Institut für Molekulare Genetik, Ihnestrasse 73, 14195 Berlin, Germany; lenzner{at}molgen.mpg.de.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Warburg, M. (1961) Norrie’s disease: a new hereditary bilateral pseudotumour of the retina Acta Ophthalmol 39,757-772
  2. Warburg, M. (1966) Norrie’s disease: a congenital progressive oculo-acoustico-cerebral degeneration Acta Ophthalmol 89(suppl),1-147
  3. Berger, W, Meindl, A, van de Pol, TJR, et al (1992) Isolation of a candidate gene for Norrie disease by positional cloning Nat Genet 1,199-203[Medline][Order article via Infotrieve]
  4. Chen, Z-Y, Hendriks, RW, Jobling, MA, et al (1992) Isolation and characterization of a candidate gene for Norrie disease Nat Genet 1,204-208[Medline][Order article via Infotrieve]
  5. Berger, W, van de Pol, D, Warburg, M, et al (1992) Mutations in the candidate gene for Norrie disease Hum Mol Genet 1,461-465[Abstract/Free Full Text]
  6. Schuback, DE, Chen, Z-Y, Craig, IW, Breakefield, XO, Sims, KB. (1995) Mutations in the Norrie disease gene Hum Mutat 5,285-292[Medline][Order article via Infotrieve]
  7. Chen, Z-Y, Battinelli, EM, Fielder, A, et al (1993) A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy Nat Genet 5,180-183[Medline][Order article via Infotrieve]
  8. Shastry, BS, Pendergast, SD, Hartzer, MK, Liu, X, Trese, MT. (1997) Identification of missense mutations in the Norrie disease gene associated with advanced retinopathy of prematurity Arch Ophthalmol 115,651-655[Abstract/Free Full Text]
  9. Black, GCM, Perveen, R, Bonshek, R, et al (1999) Coats’ disease of the retina (unilateral retinal telangiectasis) caused by somatic mutation in the NDP gene: a role for norrin in retinal angiogenesis Hum Mol Genet 8,2031-2035[Abstract/Free Full Text]
  10. Meitinger, T, Meindl, A, Bork, P, et al (1993) Molecular modelling of the Norrie disease protein predicts a cystine knot growth factor tertiary structure Nat Genet 5,376-380[Medline][Order article via Infotrieve]
  11. Berger, W, van de Pol, D, Bächner, D, et al (1996) An animal model for Norrie disease (ND): gene targeting of the mouse ND gene Hum Mol Genet 5,51-59[Abstract/Free Full Text]
  12. Chen, Z-Y, Adams, JC, Ropers, H-H, Brown, MC, Berger, W, Corey, DC. (1998) Inner ear pathology in the Norrie knockout mouse supports the role of norrin as a growth factor required for survival and maintenance of cells Am J Hum Genet 63(suppl),2057
  13. Richter, M, Gottanka, J, May, CA, Welge-Lüssen, U, Berger, W, Lütjen-Drecoll, E. (1998) Retinal vasculature changes in Norrie-disease mice Invest Ophthalmol Vis Sci 39,2450-2457[Abstract/Free Full Text]
  14. Ruether, K, van de Pol, D, Jaissle, G, Berger, W, Tornow, RP, Zrenner, E. (1997) Retinoschisis-like alterations in the mouse eye due to gene targeting of the Norrie disease (ND) gene Invest Ophthalmol Vis Sci 38,710-718[Abstract/Free Full Text]
  15. Diatchenko, L, Lau, YF, Campbell, AP, et al (1996) Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries Proc Natl Acad Sci USA 93,6025-6030[Abstract/Free Full Text]
  16. Chen, Y, Dougherty, ER, Bittner, ML. (1997) Ratio-based decisions and the quantitative analysis of cDNA microarray images Biomed Opt 2,364-374
  17. Bonfield, JK, Smith, K, Staden, R. (1995) A new DNA sequence assembly program Nucleic Acids Res 23,4992-4999[Abstract/Free Full Text]
  18. Altschul, SF, Gish, W, Miller, W, Myers, EW, Lipman, DJ. (1990) Basic local alignment search tool J Mol Biol 215,403-410[Medline][Order article via Infotrieve]
  19. Lee, JH, Takahashi, T, Yasuhara, N, Inazawa, J, Kamada, S, Tsujimoto, Y. (1999) Bis, a Bcl-2-binding protein that synergizes with Bcl-2 in preventing cell death Oncogene 18,6183-6190[Medline][Order article via Infotrieve]
  20. Nir, I, Kedzierski, W, Chen, J, Travis, GH. (2000) Expression of Bcl-2 protects against photoreceptor degeneration in retinal degeneration slow (rds) mice J Neurosci 20,2150-2154[Abstract/Free Full Text]
  21. Crawford, MJ, Krishnamoorthy, RR, Rudick, VL, et al (2001) Bcl-2 overexpression protects photooxidative stress-induced apoptosis of photoreceptor cells via NF-kappaB preservation Biochem Biophys Res Commun 281,1304-1312[Medline][Order article via Infotrieve]
  22. Schneider, TJ, Fischer, GM, Donohoe, TJ, Colarusso, TP, Rothstein, TL. (1999) A novel gene coding for a Fas apoptosis inhibitory molecule (FAIM) isolated from inducibly Fas-resistant B lymphocytes J Exp Med 189,949-956[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
C. N. Hahn, Z. J. Su, C. J. Drogemuller, A. Tsykin, S. R. Waterman, P. J. Brautigan, S. Yu, G. Kremmidiotis, A. Gardner, P. J. Solomon, et al.
Expression profiling reveals functionally important genes and coordinately regulated signaling pathway genes during in vitro angiogenesis
Physiol Genomics, June 16, 2005; 22(1): 57 - 69.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lenzner, S.
Right arrow Articles by Berger, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lenzner, S.
Right arrow Articles by Berger, W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS