IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2003;44:4184-4191.)
© 2003 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.03-0251

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zeitz, C.
Right arrow Articles by Berger, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeitz, C.
Right arrow Articles by Berger, W.

NYX (Nyctalopin on Chromosome X), the Gene Mutated in Congenital Stationary Night Blindness, Encodes a Cell Surface Protein

Christina Zeitz,1,2,3,4 Harry Scherthan,2,4 Susanne Freier,2 Silke Feil,1,2 Vanessa Suckow,2 Susann Schweiger,2 and Wolfgang Berger1,2

1From the Division of Medical Molecular Genetics and Gene Diagnostics, Institute of Medical Genetics, University of Zurich, Schwerzenbach, Switzerland; the 2Max-Planck Institute for Molecular Genetics, Berlin, Germany; and the 3Institute for Chemistry/Biochemistry, Free University, Berlin, Germany.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. The complete type of X-linked congenital stationary night blindness (CSNB1) in human and mouse is caused by mutations in the NYX gene. The human NYX protein has been predicted to contain an N-terminal endoplasmic reticulum (ER) signaling sequence and a C-terminal glycosylphosphatidylinositol (GPI) anchor. In the current study, these computer predictions were verified experimentally by expression of domain-specific cDNA constructs in COS-7 and HeLa cells. Moreover, computer-based analysis of the orthologue mouse amino acid sequence did not reveal a GPI anchor, which may result in a different protein localization compared with human NYX. Therefore, the cellular localization for the mouse Nyx protein was also examined.

METHODS. A new method was established that differentially visualizes both the protein at the surface of the living cell and subsequently in intracellular compartments. The localization of the human and mouse V5-tagged wild-type and mutant NYX protein were studied.

RESULTS. Human and mouse V5-NYX proteins were dispersed in the form of speckles over the entire cell surface. Subsequent staining of the same cells after detergent extraction revealed that V5-NYX located to the ER and Golgi apparatus. Deletion of the GPI anchor domain of NYX resulted in a time-dependent loss of V5-NYX from the surface of living cells and accumulation of this truncated protein in the ER and Golgi apparatus. Deletion of the ER signal sequence in Nyx delocalized the intracellular V5-Nyx protein and caused its dispersion in the cytosol. Furthermore, mutations introduced in the leucine-rich repeat (LRR)-region, which has been described as a pathogenic variant of NYX, had no effect on subcellular localization of the protein.

CONCLUSIONS. These data provide evidence that human and mouse nyctalopin are membrane-bound extracellular proteins and are functionally conserved.


X-linked congenital stationary night blindness (XLCSNB) is a nonprogressive retinal disorder characterized by impaired night vision and other ocular symptoms such as myopia, hyperopia, nystagmus, and reduced visual acuity.1 According to the clinical phenotype, XLCSNB can be divided into two types: complete (CSNB1) and incomplete (CSNB2). These two subtypes can be distinguished on the basis of electroretinogram (ERG) and by genetic means.2 3 CSNB2 is associated with a reduced rod b-wave and substantially reduced cone response and is due to mutations in CACNA1F, an X chromosomal gene encoding the {alpha}1-subunit of an L-type calcium channel.4 5 CSNB1 is characterized by the complete absence of the rod b-wave, but largely normal cone amplitudes. By positional cloning we and others have isolated a gene in Xp11.4 (NYX, nyctalopin on chromosome X) that is mutated in patients with CSNB1.6 7 The gene consists of three exons and codes for a novel protein belonging to the leucine-rich repeat (LRR) superfamily. The predicted polypeptide contains an N-terminal ER signal peptide, a C-terminal glycosylphosphatidylinositol (GPI) membrane anchor, and 11 leucine-rich repeats (LRR), flanked by cysteine-rich LRRs. LRRs are short-sequence motifs present in a number of proteins with diverse functions and cellular localization. Functionally, these repeats are suggested to mediate protein-protein interactions.8 Several membrane proteins have been shown to be linked to the outer leaflet of the lipid bilayer through a GPI anchor.9 10 They are synthesized and attached at the endoplasmic reticulum (ER) before modification and are then transported to the cell surface through the secretory pathway.11 The mammalian Golgi apparatus is the central organelle within the secretory machinery. It plays an important role in processing, maturation, and sorting of newly synthesized secretory and membrane proteins received from the ER.12 13 GPI-anchored proteins may be localized in microdomains14 and have been implicated in processes such as protein sorting.15 T4-cell activation,16 and cell signaling.17 18 Most notably, it has been shown that connectin and chaoptin, two prominent GPI-anchored LRR proteins, have a pivotal role in photoreceptor cell adhesion and axon guidance processes.19 20

The amino acid sequence identity between the mouse orthologue, previously identified by screening a genomic mouse PAC library21 and human NYX is much higher in the LRR core (>90%) than in the N- and C-terminal sequences (62% and 52%, respectively). Computer-based protein motif prediction revealed the ER signaling peptide, the LRRs, and the GPI anchor in the human protein sequence. However, only the signal sequence and the LRRs were predicted in the mouse sequence.

To understand the function of NYX, we generated V5-tagged human and mouse cDNA expression constructs and studied their subcellular localization by immunofluorescence of tagged NYX protein on live and in fixed cells after transfection into COS-7 and HeLa cells. Different protocols were established to identify the localization of V5-NYX. Although V5-NYX showed a speckled pattern at the cell surface in living cells, it clearly colocalized with markers for ER and Golgi in detergent-treated cells. Identical results were obtained with mouse cDNA expression constructs.

In addition, a decisive role of the signal sequence and the GPI anchor for the proper subcellular synthesis and localization of the V5-NYX protein was demonstrated by using deletion constructs.

Our results show that the ER signaling peptide and GPI anchor are of functional relevance, not only in humans but also in the mouse, and that V5-NYX is a membrane bound, extracellular protein.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Expression Constructs
Expression constructs were generated by using a mammalian expression system (Invitrogen, Karlsruhe, Germany), in which pcDNA4/V5-His is used for gene fusion. Inserts were amplified with DNA Polymerase in a kit (HotStarTaq with Q-solution; Qiagen, Hilden, Germany) on genomic DNA and with a second DNA polymerase (ProofStart with Q-solution; Qiagen) on purified amplified PCR products. To avoid overlong primers, wild-type and mutant inserts were amplified by using two forward primers. They contained the NYX signal sequence, a V5 recognition site (GGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACG), and 20 nucleotides of the corresponding cDNA. The reverse primer, used in both PCRs, contained the NYX stop codon to avoid the C-terminal V5- and His-tags positioned downstream in the vector.

After the first PCR reaction, amplified products were purified by gel extraction (Qiaquick; Qiagen) and used as a template for the second PCR.

The forward primer used for the first PCR amplifying the insert of the human wild-type and mutant expression construct was 5'-CTCGGGAGATCTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCT-CGATTCTACGTGCGCCCGCGCTTGTCCC-3' (polyacrylamide gel electrophoresis [PAGE] purified; Invitrogen) and for the second PCR, 5'-GCACTTGGTACCATGAAAGGCCGAGGGATGTTGGTCCTGCTTCTGCATGCGGTGGTCCTCGGCCTGCCCAGCGCCTGGGCCGTGGGGGCCTGCGCCGGTAAGCCTATCCCTAACCC-3' (HPLC purified; Metabion, Martinsried, Germany). The reverse primers for both reactions were identical in both reactions: 5'-GATCGAGAATTCTCAGTCCATCTGCAGGCCAAA-3' (MWG, Ebersberg, Germany). Amplification of the insert of the mouse wild-type Nyx expression construct was performed with the first forward primer, 5'-GGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTGTCTGCGGGCCTGCCCTG-3' (PAGE purified; Invitrogen); the second forward primer, 5'-GCACTTGGTACCAT-GCTGATCCTGCTTCTTCATGCGGTGGTCTTCAGTCTGCCCTAC-ACCAGGGCCACCGAGGCCGGTAAGCCTATCCCTAACCC-3' (PAGE purified, Invitrogen); and the reverse primer for both reactions, 5'-GATCGAGAATTCTCACTCCCTCTGCAGGCCCC-3' (Invitrogen). For expression constructs without the C-terminal or the signaling sequence of NYX and Nyx, wild-type plasmids described earlier were used as templates. To amplify the human and mouse insert without the GPI anchor, the following primer combination was used: 5'-GCAC-TTGGTACCATGAAAGGCCGAGGGATGTTG-3' (MWG) and 5'-GAGCT-AGAATTCTCAGGAGGAGAGGCTGTCGGA-3' (MWG); and 5'-GATCT-AGGTACCATGCTGATCCTGCTTCTTCATG-3' (MWG) 5'-GAGCTAGAATTCTCACCGAAAGCTGTCATTCAACG-3' (MWG), respectively. Primers used for amplifying the mouse insert without the signal sequence were 5'-GATCTAGGTACCATGCTGATCCTGCTTGGTAAGCCTATCCCTAACCC-3' (HPLC purified, Metabion) and 5'-GAGCTAGAATTCTCAGGAGGAGAGGCTGTCGGA-3' (MWG). Primers used for amplifying the mouse insert without the signal sequence and the GPI anchor were 5'-GATCTAGGTACCATGCTGATCCTGCTTGGTAAGCCTATCCCTAACCC-3' (HPLC purified, Metabion) and 5'-GAGCTAGAATTCTCACCGAAAGCTGTCATTCAACG-3' (MWG). KpnI/EcoRI-digested PCR products were isolated from agarose gel (Qiaquick; Qiagen) and cloned in KpnI/EcoRI-digested PCR products were isolated from agarose gels (Qiaquick; Qiagen) and cloned in a similarly treated pcDNA4/V5-His expression vector (Invitrogen).

Cell Culture and Transfection
COS-7 and HeLa cells were spread at 1 x 105 cells per well of a six-well plate or at 3 x 106 cells per flask in DMEM/F12 (Invitrogen), containing 3 mM L-glutamine, streptomycin (100 U/mL), penicillin (100 U/mL), and 10% FCS, 1 day before transfection. Transfection was performed according to a commercial protocol (PolyFect; Qiagen), by using 1 or 15 µg plasmid DNA, 10 or 50 µL transfection reagent (PolyFect; Qiagen), and 100 or 600 µL serum-free medium (Opti-MEM; Invitrogen). The transfection efficiency for all experiments was 20%.

Immunofluorescence
COS-7 and HeLa cells were transfected as just described. After 24 hours, transfected cells were analyzed using different staining methods. To observe proteins that localize exclusively on the plasma membrane, we performed live cell staining as follows. The anti-V5 antibody (Invitrogen) was diluted 1:300 in an appropriate volume of cell culture medium containing 2 µL of a crude, heat-denatured lysate prepared from nontransfected HeLa or COS-7 cells. After this 10-minute absorption step at 37°C, which removes nonspecific binding sites among the anti-V5 antibodies, the antibody solution was added to the living transfected cells in the culture dish. After 30 minutes of incubation at 37°C, cells were washed three times with medium to remove unbound antibody. The live cells were then incubated for a further 10 minutes at 37°C with FITC-conjugated rabbit anti-mouse antibody (Dako, Glostrup, Denmark) serum diluted 1:500 in culture medium. After unbound antibodies were removed by three washes with culture medium, cells were either instantly fixed in 2% formaldehyde, 1x PBS for 5 minutes, or incubated for a further 30 minutes in medium to determine whether there nyctalopin would be released from the plasma membrane. After the detection and fixation of surface proteins on the live cell (as described earlier), the intracellular pool of this protein was revealed by extracting the membranes of the cell with 0.2% Triton X-100, 1x PBS for 15 minutes. After three washes in PBS, the cells were incubated with preabsorbed anti-V5 in PBGT (0.1% BSA, 0.1% gelatin, 0.05% Tween 20, and 1x PBS22 ) for 1 hour at RT. After cells were washed three times with PBGT, the primary antibody was detected by incubation with Cy3-conjugated F(ab')2 fragment donkey anti-mouse antibody (AffiniPure; Dianova GmbH, Hamburg, Germany) diluted 1:500 in PBGT for 30 minutes at RT. The cells were then washed three times with PBGT and postfixed for 5 minutes in 1% formaldehyde PBS to avoid color shifts between epitopes at different subcellular localization.

In some experiments, the ER was visualized in live cells by incubating them with a dye (ER-Tracker Blue-white DPX; Molecular Probes, Leiden, The Netherlands) diluted 1:1000 in medium. Detection of the Golgi apparatus was performed with anti-human golgin-97 mouse monoclonal CDf4 antibody (Molecular Probes) as follows. Cells that had been stained for proteins on the surface and in the cytosol were again fixed with 2% formaldehyde, 0.015 Triton X-100, and 1x PBS for 5 minutes. After a triple wash with 0.1% glycine and 1x PBS, cells were incubated with anti-human golgin-97, mouse monoclonal antibody (Molecular Probes) diluted 1:1000 in PBGT. After three further washes in PBGT, cells were incubated with Cy5-conjugated goat anti-mouse antibody (Dianova GmbH) diluted 1:1000 in PBGT. Finally, cells were embedded in antifade mounting medium (Vectashield; Vector Laboratories, Peterborough, UK) containing 0.5 µg/mL 4',6-diamidine-2'-phenylindoledihydrochloride (DAPI) and inspected in a fluorescence microscope (Axioscope 1; Carl Zeiss Meditec, Oberkochen, Germany) equipped with a fluorescence imaging system (ISIS; MetaSystems, Altlussheim, Germany).

Cell Fractionation and Western Blot Analysis
For immunochemical detection after 48 hours, transfected COS-7 or HeLa cells were collected by centrifugation and homogenized in HEPES buffer (0.32 M sucrose, 4 mM HEPES [pH 7.4], including protease inhibitor cocktail; Complete Mini; Roche, Mannheim, Germany) and 2% mercaptoethanol (Merck, Dietikon, Switzerland) with five to seven strokes with an ice-cold homogenizer with a loose pestle. After cell disruption, cell debris was removed twice by centrifugation at 1000g for 20 minutes. The supernatant was centrifuged at 100,000g for 1 hour. The remaining supernatant was precipitated with a fourfold excess of acetone at 20,000g, at 4°C for 15 minutes. The remaining pellet was dissolved in 20 µL yeast lysis buffer (2% Triton X-100, 100 mM NaCl, 10 mM Tris [pH 8.0], and 1 mM EDTA) and the detectable amount of expressed protein was loaded on 10% SDS-polyacrylamide gel. Protein was transferred to polyvinylidene difluoride (PVDF) membrane (Roche Diagnostics, Mannheim, Germany) by electroblotting and detected in PBST (0.1% Tween 20, 1x PBS) with mouse anti-V5 antibody (Invitrogen) diluted 1:3000 after blocking the membrane overnight with 5% powdered milk (Protifar; Zoetermeer, The Netherlands) and the anti-V5 antibody at 37°C for 15 minutes with a crude, heat denatured lysate prepared from nontransfected HeLa or COS-7 cells. Primary antibody was detected with goat anti-mouse IgG (H+L) horseradish peroxidase-conjugated secondary antibody and chemiluminescence reaction (NEN Life Science Products-Perkin Elmer, Rodgau-Jügesheim, Germany).


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Subcellular Localization of Human and Mouse V5-NYX
To examine the subcellular localization of the NYX protein, we expressed V5-tagged23 human NYX in COS-7 and HeLa cells (Fig. 1A) . Expression of the fusion protein was confirmed by Western blot analysis of the pellet fraction from transfected cells with the anti-V5 antibody (Fig. 1B) .



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 1. Motif analysis of human and mouse nyctalopin. (A) Diagrams of cDNA constructs for NYX expression in COS-7 and HeLa cells. (a) The human (NYX) cDNA coding for a signal sequence, an LRR region and a GPI anchor and the same construct with its mouse orthologue. Deletion constructs without either the C-terminal (b) or the N-terminal sequence (c) or both of them (d) were cloned to analyze the function of these motifs. A V5 tag was inserted downstream of the signal sequence for detection of the protein on fluorescence microscopy and Western blot analysis. (B) The high-speed pellet fraction was probed with an anti-V5 antibody and revealed proteins of the expected size. The calculated molecular masses of V5-tagged fusion proteins are as follows: V5-NYX (human construct), 55 kDa; V5-Nyx (mouse construct), 55kDa; V5-NYX{Delta}GPI (human construct without GPI anchor), 51 kDa; V5-Nyx{Delta}GPI (mouse construct without C-terminal sequence), 50 kDa; V5-Nyx{Delta}SS (mouse construct without signal sequence), 52 kDa; and V5-Nyx{Delta}GPISS (mouse construct without C-terminal and signal sequence), 49kDa. (C) Shaded boxes: amino acid identities. The degree of the amino acid sequence conservation between human and mouse in the signal sequence is 62% and in the GPI anchor region 52%.23 24

 
Standard immunofluorescence staining is limited in its ability to provide simultaneous visualization of proteins at the cell surface and in intracellular compartments. Therefore, we developed a sequential staining method that first detects the protein at the extraplasmatic face of the plasma membrane of living cells and, after cross-linking fixation, reveals the distribution of the same protein within the cell.

Using live cell staining in V5-NYX-expressing COS-7 cells, fluorescence microscopic analysis of transfected cells revealed wild-type V5-NYX localized at the cell surface in a punctuate pattern (Figs. 2A 2B) . To address whether the distribution of the fusion protein is cell-type-dependent, we expressed the same construct in HeLa cells and obtained identical results. Control experiments with the empty vector plasmid did not show fluorescence staining (data not shown).



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 2. Colocalization studies of intracellular V5-NYX and an ER marker in COS-7 cells. (A, E) Composite images of consecutive immunofluorescence staining showing V5-NYX at the extracellular membrane in green (FITC), the intracellular V5-NYX protein pool in red (Cy3), the ER in white (ER tracer dye) and the nucleus stained in blue (DAPI). (B, F) Same cells as in (A) and (E), showing the surface staining only (green channel). (C, G) Red channel of the cell shown in (B) and (F) revealing the intracellular V5-NYX pool only. The protein is expressed at high levels and concentrated around the nuclei. (D) Nuclei (counterstaining, DAPI, blue) of the cells of the left column. (H) Same cell as in (E) in vivo stained for the endoplasmic reticulum by an ER tracer (white) before fixation. The ER marker exhibits a reticulate distribution, which partially colocalizes with the endogenous V5-tagged NYX shown in (G).

 
Comparison of the sequences of the NYX proteins in human and mouse revealed that the degree of homology is variable throughout the protein. Although amino acid identity is very high in the LRR core (>90%), the N-terminal and, even more striking, the C-terminal sequences showed only average interspecies homology (62% and 52%, respectively)21 24 (Fig. 1C) . Moreover, computer analysis (www.expasy.org/tools/ provided in the public domain by the Swiss Institute of Bioinformatics, Geneva, Switzerland) does not predict a GPI anchor in mouse Nyx. Although a hydrophobic amino acid stretch at the C terminus of Nyx protein could function as a GPI anchor motif, the respective hydrophilic motif seems to be too short in comparison to known GPI anchors. To determine whether the less-conserved C terminus and signal sequence in mouse and human NYX influence the subcellular distribution of the two proteins, COS-7 and HeLa cells were transfected with the mouse and the human wild-type V5-tagged constructs. Live cell staining revealed that both proteins showed a similar localization pattern at the extraplasmatic face of the plasma membrane in both cell types (data not shown). These results suggest that despite low sequence conservation, the N- and C-terminal sequences in human and mouse have a similar role.

In a second step, live stained V5-NYX-overexpressing cells were fixed, detergent-extracted and differentially stained for the intracellular V5-NYX pool with anti-V5 antibody. In cells expressing human and mouse V5-NYX protein at high levels, strong labeling throughout the cells was observed that conspicuously surrounded the nuclei (Fig 2D) . This was the case in both COS-7 and HeLa cells (Fig. 2C) . To investigate whether NYX is synthesized at the ER and passed trough the Golgi apparatus, we incubated live cells with an ER tracer (ER-Tracker; Molecular Probes) and imaged the cells under the microscope (Fig. 2H) . After image recording, the cells were live stained for surface V5-NYX protein (Fig. 2H) , fixed, and permeabilized and the intracellular pool of V5-NYX was detected in a different color (Fig. 2G) . Again anti-V5 live cell staining showed that V5-NYX is attached to the membrane in living COS-7 cells, when using either construct. Within the same cells, V5-NYX and the ER marker displayed a similar intracellular localization pattern with V5-NYX localizing to the perinuclear ER and a reticular network in the cell body—consistent with the NYX synthesis at the ER (Fig. 2E) . In addition, colocalization of V5-NYX (Fig. 3D) and the Golgi-specific marker golgin-97 (Fig. 3C) was observed (Fig. 3A) , suggesting that NYX protein is transported to the Golgi. In control experiments with the empty vector or secondary antibodies alone, no specific fluorescence signals were observed (data not shown). Hence, it appears that NYX undergoes membrane-bound synthesis at the ER, is transported through the Golgi apparatus, and finally localizes to the cell surface in both cell culture systems investigated. This was consistent for both the mouse and human V5-NYX proteins.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 3. Colocalization studies of expressed V5-tagged NYX and golgin-97 in COS-7 cells. (A) Merged image (magenta) of the fluorescent signal of V5-NYX (red) and of the anti-golgin antibody signal (blue). (B) Anti-V5 NYX FITC (green) revealed only a few signals at the cell surface, indicating that these cells have not yet implemented the protein in the extraplasmatic face of the plasma membrane. (C) Localization of the Golgi marker protein golgin-97 by Cy5-labeled secondary antibodies (blue). (D) V5-NYX protein signals (red) in overexpressing COS-7 cells. These cells were chosen for display because the moderate expression allowed for unequivocal identification of the Golgi compartment.

 
Internal Versus External Protein Pools by Retarded Live Cell Staining
To study the functional relevance of the GPI anchor domain of NYX in mouse and human, expression constructs without the human anchor motif and mouse C-terminal sequence were generated and transfected in COS-7 and HeLa cells. Subsequently, living cells were stained for V5-NYX and fixed directly (0 minutes) or after additional 30 minutes of culturing in antibody-free medium. If the GPI anchor motif in the two proteins is functional, the protein would be expected to be retained at the extraplasmatic face of the plasma membrane. Protein with a nonfunctional GPI anchor was expected to be seen at the surface at time 0, but should have been reduced or lost from the surface at the later time point. In agreement with this reasoning, both wild-type and mutant cells immediately fixed after V5-NYX staining on live cells displayed a similar staining pattern at the surface. In cells transfected with wild-type V5-tagged DNA, the majority (75.5%) of the cells exhibited V5-NYX at the surface and in the cytoplasm (Fig. 4) , whereas only a few cells showed exclusively intracellular staining. Only 50% of cells transfected with V5-NYX constructs with the GPI anchor (NYX{Delta}GPI) showed mutant V5-NYX at the cell surface at time 0.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 4. Measurement of internal versus cell surface protein pools by retarded live cell staining in HeLa cells. Live cells were incubated with first and second antibody in medium. () Internal and surface stained protein; ({blacksquare}) exclusively internal protein. At 0 min 75.5% of the transfected cells expressing wild-type V5-NYX showed internal staining, as well as surface staining. 24.5% of the transfected cells showed exclusively internal staining. In contrast, 55.5% of the transfected cells expressing mutant V5-NYX{Delta}GPI showed internal staining, as well as surface staining. 54.5% showed exclusively internal distribution. Thirty minutes after incubation in antibody-free medium 76.5% of the transfected cells expressing wild-type V5-NYX still showed surface and internal staining. Of the V5-NYX-transfected cells, 23.5% showed exclusively internal staining. In contrast, only 21.5% of the V5-NYX{Delta}GPI-transfected cells showed surface staining and internal staining at 30 minutes, whereas 78.5% showed exclusively internal staining.

 
A more dramatic effect was seen when live cells were stained for V5-NYX by culturing in antibody-free medium for an additional 30 minutes before fixation. Whereas most of the cells expressing wild-type V5-NYX still showed membrane localization of the protein after 30 minutes of cultivation, nearly all of the cells expressing the GPI-deleted variant had not retained the protein at the surface of the plasma membrane (Fig. 4) . Only approximately 20% of these cells showed surface staining, but this pattern appeared to be very weak. That the remaining 20% of the transfected cells still showed surface staining, even though weak, can be explained by the fact that 30 minutes of additional incubation with antibody-free medium is not sufficient for the complete dissociation of mutant V5-NYX from the surface in cells strongly expressing this protein. However, the weak surface staining and the significant reduction of the surface pattern suggest that V5-NYX without the membrane anchor is synthesized at the ER and transported by the Golgi complex to the plasma membrane, where it fails to attach to the membrane. The V5-NYX staining pattern obtained in COS-7 was identical with that in HeLa cells (data not shown).

To determine whether the localization of mouse Nyx differs from that of human NYX, the same series of experiments were performed with the wild-type mouse construct and a construct without the C-terminal sequence. Again, in cells transfected with the mouse wild-type construct, most of the cells exhibited V5-Nyx at the surface and in their interior, whereas only a few cells showed exclusively intracellular staining (data not shown). This was seen at time 0 of live cell staining and after 30 minutes of further antibody-free cultivation and fixation. In cells transfected with V5-Nyx constructs without the C-terminal sequence (V5-Nyx{Delta}GPI) that contained the hydrophilic microdomain that was predicted to be too short to function as a GPI anchor, a reduced number of V5-NYX{Delta}GPI-expressing cells showed the protein at the surface and in their interior only when fixed immediately after protein staining (t = 0; Fig. 5A 5B 5C ). After 30 minutes of further cultivation nearly all of the transfected cells showed exclusive intracellular staining (Fig. 5E 5F 5G) . In summary, our results show that despite low sequence conservation in the N- and C-terminal region of human NYX and mouse Nyx and although no GPI anchor motif was predicted to occur in the mouse protein, the corresponding protein motifs are functionally homologous.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 5. Immunofluorescence staining of HeLa cells expressing V5-Nyx without the C-terminal sequence. (AC) A cell that expresses Nyx without the C-terminal sequence showed intracellular localization (red) and a reduced speckled surface staining pattern (green) directly after in vivo immunostaining. (EG) Cell that lost surface staining after 30 minutes of cultivation in antibody-free medium. Most of the expressing cells showed intracellular protein localization exclusively. (C, G) Intracellular V5-Nyx{Delta}GPI was present in a clear reticular staining (most obvious in the periphery) which indicates accumulation of the protein without the C-terminal sequence in the ER. (D, H) Counterstaining of DNA (DAPI) reveals the nuclei of transfected cells above.

 
Subcellular Localization of V5-Nyx without the ER Signaling Peptide
To investigate whether the predicted signal sequence is required for the intracellular transport of the mRNA to the ER membrane, constructs either without the signal sequence alone or without the signal sequence and the GPI motif were transfected in HeLa cells. Sequential immunofluorescence staining against surface and intracellular V5-Nyx protein without the signal sequence showed that the plasma membrane staining was abolished in HeLa cells (Figs. 6B 6F , respectively). For V5-Nyx proteins without the signaling sequence alone or the signaling sequence and membrane anchor, a diffuse granular cytosolic distribution was detected (Figs. 6A 6C 6E 6G) . No fluorescence staining was found in control experiments where plasmid without insert was used for the transfection (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. Functional analysis of the signal sequence and the GPI anchor. (A) Diffuse cytosolic distribution of V5-Nyx without the putative ER signal sequence and (E) the signal sequence and the last 26 amino acids of Nyx in HeLa cells. (B, F) Deletion of the signal sequence of Nyx causes loss of protein at the plasma membrane in HeLa cells. (C, G) Intracellular protein shows a granular cytoplasmic staining, with the typical ER "honeycomb" structure and the perinuclear Golgi staining being absent (compare Figs. 2 and 3 with Fig. 6 ). (D, H) Cells were embedded in mounting medium containing DAPI to stain the nuclei of transfected cells.

 
Subcellular Localization of Mutant V5-NYX
To study the consequences of mutations previously identified in CSNB1, we expressed V5-tagged mutated variants in COS-7 and HeLa cells. Mutations were introduced by direct amplification of the open reading frame on the DNA of patients. In this way, a deletion of the amino acid sequence AELP at position 243-246, a missense mutation leading to an L->P exchange at position 347 in the LRR core and another missense mutation leading to a G->V at position 370 were studied. None of them altered the subcellular localization of the protein (data not shown).


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Rod-mediated vision depends on the transmission of visual information from the photoreceptor outer segment through the retina. Visual information is transmitted postreceptorally to a depolarizing class of bipolar cells.25

The complete type of congenital stationary night blindness is characterized by the absence of postreceptoral rod-mediated function.2 This information suggests a defect in synaptic transmission between photoreceptors and second-order neurons—in particular, bipolar cells. The role in this process of NYX, the gene defective in patients with CSNB1, is not clear. However, because of specific domains of the predicted protein, it has been speculated that NYX encodes an extracellular membrane-anchored protein with leucine-rich motifs, presumably responsible for protein-protein interactions.7 Several adhesive proteins belonging to the leucine-rich repeat family (e.g., connectin and chaoptin) have been shown to be attached to the plasma membrane through a GPI anchor.8 To study the subcellular synthesis and localization of NYX, we expressed V5-tagged fusion constructs in COS-7 cells. Using live cell staining we localized V5-NYX to the extraplasmatic face of the plasma membrane where it displayed a speckled distribution. This specific localization of V5-NYX is consistent with previous findings which showed that GPI-anchored proteins are localized in microdomains (200–300 nm) or "rafts" on the plasma membrane.14 26 These rafts could dictate the sorting of associated proteins and/or provide sites for assembly of cytoplasmic signaling molecules.27 Next, we were interested in the intracellular distribution of NYX. Therefore, we differentially stained V5-NYX—first, on the surface of live cells and then after fixation within the same cell. V5-NYX is first localized to the perinuclear ER and is subsequently accumulated in the Golgi apparatus, as verified by colocalization experiments with ER- and Golgi-specific markers. These findings are in accordance with the ER-bound synthesis of membrane-bound proteins that are attached to the inner ER membranes before modification and transport to the cell surface through the secretory pathway.11 The Golgi apparatus, which serves as the central organelle within the secretory pathway, plays an important role in processing, maturation, and sorting of newly synthesized proteins received from the ER.12 13 Colocalization of V5-NYX with the Golgi suggests that the protein may be modified (e.g., glycosylated), an assumption that requires further analysis.

To exclude cell-type-specific differences in subcellular distribution of fusion proteins that have been observed for other proteins,28 29 we investigated the distribution of nyctalopin, not only in COS-7 but also in HeLa cells. V5-NYX was found to localize to the extracellular surface in both cell types. Thus, our results indicate that the localization of V5-NYX at the plasma membrane is probably cell-type independent.

Amino acid sequence alignment of NYX to its mouse orthologue showed that the LRR core is most highly conserved (>90%), whereas the signal sequence and the GPI anchor region showed lower sequence identity (62% and 52%, respectively).21 24 Previously, the gene and the mutation responsible for the mouse nob (no b-wave) phenotype was identified.30 The investigators confirmed that the nob mouse is a model for human CSNB1 and showed that the similar phenotype is caused by an 85-bp deletion in the mouse Nyx gene. Based on computer prediction, Gregg et al.30 also suggested that the putative GPI anchor site in the human has no counterpart in the mouse Nyx protein. However, these conclusions hitherto remained untested. Our data now provide firm evidence that the subcellular locations of both the human and mouse wild-type NYX proteins are identical. V5-NYX in both species localizes at the extraplasmatic face of the plasma membrane and to the ER and Golgi apparatus inside the cells. Therefore, it is possible that the computer-based predictions are not of relevance for the mouse Nyx protein.

In vivo localization analysis of a protein deleted for the C-terminal sequence of the mouse V5-Nyx protein showed that this domain is required for membrane binding, clearly indicating functional conservation of the respective protein motifs in human and mouse NYX. A similar situation has been reported in which a GPI anchor motif had been predicted for only one of the functionally conserved homologous cell surface proteins, whereas both proteins were capable of mediating GPI anchor attachments.31

Time-course cell staining is a powerful method for analysis of functionality of GPI anchors. The typical punctate staining for wild-type V5-NYX on the cell surface was retained after in vivo staining and subsequent 30-minute culturing in antibody-free medium. In contrast, removal of the GPI anchor resulted in a reduction of surface-bound V5-NYX protein: only 50% of transfected cells showed staining at the cell surface when stained in vivo for V5-NYX. When cells were cultured for an additional 30 minutes in antibody-free medium before detection of V5-NYX, they displayed a defect in protein retention. Only 20% of expressing cells showed a few punctate V5-NYX{Delta}GPI signals at the plasma membrane, suggesting that the V5-NYX{Delta}GPI protein seen directly after immunostaining was unable to bind tightly at the cell surface. This is probably due to a constant flow of overexpressed protein through the secretory pathway, which cannot be anchored to the cell surface. Intracellular, anchorless V5-NYX protein was associated with the reticulate ER network. These findings are consistent with the assumption that the absence of the GPI anchor results in the failure of the folded polypeptide to attach the glycolipid anchor that is essential for binding to the inner ER membrane and to the extraplasmatic face of the plasma membrane. The remaining protein at the surface of expressing cells is presumably due to the high amount of protein expressed in single cells. It is still trafficked through the ER (targeted by the N-terminal ER signal sequence) and Golgi to the cell surface but it fails to attach.

Deletion of the N-terminal amino acids alone or in addition to the removal of the GPI anchor resulted in a failure of membrane-bound V5-NYX synthesis, leading to an enrichment of this protein in the cytosol. The typical perinuclear, reticulate, and surface staining pattern obtained with the full-length constructs was completely lost. This is consistent with the N-terminal amino acids containing an essential part of the ER signal sequence for the secretory pathway through an ER-Golgi-like compartment.

Our results agree with the expectation that correct processing of the GPI anchor in the ER-Golgi network is essential for the successful secretion of nyctalopin, which is additionally dependent on an N-terminal sequence. To study the effect on the localization of mutations, we synthesized three different mutant constructs (Leu347Pro, {Delta}AELP, and Gly370Val) and transfected them in the same way as wild-type constructs. These mutations were chosen because they are all found in the LRR region, which has been described to contain most of the disease-associated mutations in humans.7 However, we observed no obvious change in the distribution of the mutated proteins (data not shown). Because these mutations did not show any effect on the localization, our data suggest that the location per se of NYX is necessary but not sufficient for function. Further studies will have to show which proteins may interact with nyctalopin and determine whether mutations disrupt these interactions leading to the complete type of XLCNSB and a similar phenotype in the nob mouse. However, our findings add NYX to a number of other GPI-anchored LRR proteins such as chaoptin and connectin, which have a pivotal role as cell adhesion molecules in neuronal development in Drosophila.20 32 Whereas chaoptin is located on photoreceptor cells,32 connectin is distributed on the surface of a subset of embryonic muscles, on the growth cones and axons of the motor neurons that innervate theses muscles, and on several associated glial cells.20 Biochemical analysis revealed that chaoptin is linked to the extracellular surface of the plasma membrane by covalent attachment to glycosylphosphatidylinositol. It has been suggested that chaoptin plays an important role in photoreceptor cell morphogenesis to organize closely opposed membranes of photoreceptor cells by direct adhesive interactions.19 Connectin has been shown to reveal a repulsive function during motor neuron growth cone guidance and synapse formation.20

In the current study, we showed that NYX is a GPI-anchored, LRR-cell surface protein that localizes in vivo in foci over the cell surface. One could thus hypothesize that NYX plays an important role in the human retina by establishing and/or specifying contacts between rod photoreceptors and postsynaptic neurons, including bipolar, amacrine, and ganglion cells. Alternatively, this protein could act as a ligand and/or a receptor molecule in a cell-signaling pathway in the human retina. Future studies are needed to show whether NYX is able to mediate homophilic adhesion of retinal cells.


    Acknowledgements
 
CZ thanks Thomas Haaf for introduction to fluorescence microscopy. The authors thank Barbara Kloeckener for helpful discussions and critical reading of the manuscript, and Hans-Hilger Roper for support.


    Footnotes
 
4 Contributed equally to the work and therefore should be considered equivalent first authors. Back

Supported by Grant T-GE-0602-0222 from The Foundation Fighting Blindness.

Submitted for publication March 11, 2003; revised May 7, 2003; accepted May 29, 2003.

Disclosure: C. Zeitz, None; H. Scherthan, None; S. Freier, None; S. Feil, None; V. Suckow, None; S. Schweiger, None; W. Berger, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Christina Zeitz, Division of Medical Molecular Genetics and Gene Diagnostics, Institute of Medical Genetics, University of Zurich, Schorenstrasse 16, CH-8603 Schwerzenbach, Switzerland; zeitz{at}medgen.unizh.ch.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Heon, E, Musarella, MA. (1994) Congenital stationary night blindness: a critcal review for molecular approaches Wright, AF Jay, B eds. Molecular Genetics of Inherited Eye Disorders ,277-301 Harwood Academic Chur, Switzerland.
  2. Miyake, Y, Yagasaki, K, Horiguchi, M, Kawase, Y, Kanada, T. (1986) Congenital stationary night blindness with negative electroretinogram: a new classification Arch Ophthalmol 104,1013-1020[Abstract]
  3. Boykott, KM, Pearce, WG, Musarella, MA, et al (1998) Evidence for genetic heterogeneity in X-linked congenital stationary night-blindness J Hum Genet 62,865-875
  4. Bech-Hansen, NT, Taylor, MJ, Maybaum, TA, et al (1998) Loss-of-function mutations in a calcium-channel alpha-1-subunit gene in Xp11.23 cause incomplete X-linked congenital stationary night blindness Nat Genet 19,264-267[CrossRef][Medline][Order article via Infotrieve]
  5. Strom, TM, Nyakatura, G, Apfelstedt-Sylla, E, et al (1998) An L-type channel gene is mutated in incomplete X-linked congenital stationary night blindness Nat Genet 19,260-263[CrossRef][Medline][Order article via Infotrieve]
  6. Bech-Hansen, NT, Naylor, MJ, Maybaum, TA, et al (2000) Mutations in NYX, encoding the leucine-rich proteoglycan nyctalopin, cause X-linked complete congenital stationary night blindness Nat Genet 26,319-323[CrossRef][Medline][Order article via Infotrieve]
  7. Pusch, CM, Zeitz, C, Brandau, O, et al (2000) The complete form of X-linked congenital stationary night blindness is caused by mutations in a gene encoding a leucine-rich repeat protein Nat Genet 26,324-327[CrossRef][Medline][Order article via Infotrieve]
  8. Kobe, B, Deisenhofer, J. (1994) The leucine-rich repeat: a versatile binding motif Trends Biochem Sci 19,415-421[CrossRef][Medline][Order article via Infotrieve]
  9. Ferguson, MA. (1992) Glycosyl-phosphatidyinositol membrane anchors: the tale of a tail Biochem Soc Trans 20,243-256[Medline][Order article via Infotrieve]
  10. Takeda, J, Kinoshita, T. (1995) GPI-anchor biosynthesis Trends Biochem Sci 20,367-371[CrossRef][Medline][Order article via Infotrieve]
  11. Barz, WP, Walter, P. (1999) Two endoplasmatic reticulum (ER) membrane proteins that facilitate ER-to-Golgi transport of glycosylphosphatidylinositol-anchored proteins Mol Cell Biol 10,1043-1059
  12. Palade, G. (1975) Intracellular aspects of the process of protein secretion Science 189,347-358[Free Full Text]
  13. Rothman, JE. (1994) Mechanisms of intracellular transport Nature 372,55-63[CrossRef][Medline][Order article via Infotrieve]
  14. Friedrichson, T, Kurzchalia, TV. (1998) Microdomains of GPI-anchored proteins in living cells revealed by crosslinking Nature 394,802-805[CrossRef][Medline][Order article via Infotrieve]
  15. Brown, DA, Rose, JK. (1992) Sorting of GPI-anchored proteins to glycolipid-enriched membrane subdomains during transport to the apical cell surface Cell 68,533-544[CrossRef][Medline][Order article via Infotrieve]
  16. Resta, R, Thompson, LF. (1997) T cell signaling through CD73 Cell Signalling 9,131-139[CrossRef][Medline][Order article via Infotrieve]
  17. Stulnig, R, Berger, M, Sigmund, T, Stockinger, H, Horejsi, V, Waldhäusl, W. (1997) Signal transduction via glycosyl phosphatidylinositol-anchored proteins in T cells is inhibited by lowering cellular cholesterol J Biol Chem 272,19232-19247
  18. Rodgers, W, Crise, B, Rose, JK. (1994) Signals determining protein tyrosine kinase and glycosyl-phosphatidylinositol-anchored protein targeting to a glycolipid-enriched membrane fraction Mol Cell Biol 14,5384-5391[Abstract/Free Full Text]
  19. Krantz, DE, Zipursky, SL. (1990) Drosophila chaoptin, a member of the leucine-rich repeat family, is a photoreceptor cell-specific adhesion molecule EMBO J 6,1969-1977
  20. Nose, A, Takeichi, M, Goodman, CS. (1994) Ectopic expression of connectin reveals a repulsive function during growth cone guidance and synapse formation Neuron 13,525-539[CrossRef][Medline][Order article via Infotrieve]
  21. Pesch, K, Zeitz, C, Fries, JE, et al (2003) Isolation of the mouse nyctalopin gene Nyx and expression studies in mouse and rat retina Invest Ophthalmol Vis Sci 44,2260-2266[Abstract/Free Full Text]
  22. Scherthan, H, Jerratsch, M, Li, B, et al (2000) Mammalian meiotic telomeres: protein composition and redistribution in relation to nuclear pores Mol Biol Cell 11,4189-4203[Abstract/Free Full Text]
  23. Southern, JA, Young, DF, Heaney, F, Baumgartner, W, Randall, RE. (1991) Identification of an epitope on the P and V proteins of simian virus 5 that distinguishes between two isolates with different biological characteristics J Gen Virol 72,1551-1557[Abstract/Free Full Text]
  24. Zeitz, C, Schweiger, S, Scherthan, H, Freier, S, Berger, W. (2002) Functional characterization of protein domains in NYX (nyctalopin on chromosome X) (Abstract) Am J Hum Genet 71,326
  25. Daw, NW, Jensen, RJ, Brunken, WJ. (1990) Rod pathways in mammalian retinae Trends Neurosci 1,110-115
  26. Varma, R, Mayor, S. (1998) GPI-anchored proteins are organized in submicron domains at the cell surface Nature 394,798-801[CrossRef][Medline][Order article via Infotrieve]
  27. Simon, K, Ikonen, E. (1997) Functional rafts in membranes Nature 387,569-570[CrossRef][Medline][Order article via Infotrieve]
  28. Schwahn, U, Paland, N, Techritz, S, Lenzner, S, Berger, W. (2001) Mutations in the X-linked RP2 gene cause intracellular misrouting and loss of the protein Hum Mol Gen 10,1177-1183[Abstract/Free Full Text]
  29. Mayor, S, Rothberg, KG, Maxfield, FR. (1994) Sequestration of GPI-anchored proteins in caveolae triggered by cross-linking Science 264,1948-1951[Abstract/Free Full Text]
  30. Gregg, RG, Mukhopadhyay, S, Candille, SP, et al (2003) Identification of the gene and the mutation responsible for the mouse nob phenotype Invest Ophthalmol Vis Sci 44,378-384[Abstract/Free Full Text]
  31. Voth, BR, Kell, BL, Phalgun, BJ, Ivens, AC, McMaster, WR. (1998) Differentially expressed Leishmania major gp63 genes encode cell surface leishmanolysin with distinct signals for glycosylphosphatidylinositol attachment Mol Biochem Parasitol 93,31-41[CrossRef][Medline][Order article via Infotrieve]
  32. Zipursky, S, Venkatesh, T, Teplow, DB, Benzer, S. (1984) Neuronal development in the Drosophila retina: monoclonal antibodies as molecular probes Cell 36,15-26[CrossRef][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
Br. J. Ophthalmol.Home page
D Q Nguyen, C Hemmerdinger, R P Hagan, M C Brown, S A Quah, and S B Kaye
Keratoconus associated with CSNB1
Br. J. Ophthalmol., January 1, 2007; 91(1): 116 - 117.
[Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. O'Connor, B. Eisenhaber, J. Dalley, T. Wang, C. Missen, N. Bulleid, P. N. Bishop, and D. Trump
Species specific membrane anchoring of nyctalopin, a small leucine-rich repeat protein
Hum. Mol. Genet., July 1, 2005; 14(13): 1877 - 1887.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. P. Dryja, T. L. McGee, E. L. Berson, G. A. Fishman, M. A. Sandberg, K. R. Alexander, D. J. Derlacki, and A. S. Rajagopalan
Night blindness and abnormal cone electroretinogram ON responses in patients with mutations in the GRM6 gene encoding mGluR6
PNAS, March 29, 2005; 102(13): 4884 - 4889.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
N. W. Khan, M. Kondo, K. T. Hiriyanna, J. A. Jamison, R. A. Bush, and P. A. Sieving
Primate Retinal Signaling Pathways: Suppressing ON-Pathway Activity in Monkey With Glutamate Analogues Mimics Human CSNB1-NYX Genetic Night Blindness
J Neurophysiol, January 1, 2005; 93(1): 481 - 492.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zeitz, C.
Right arrow Articles by Berger, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeitz, C.
Right arrow Articles by Berger, W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS