IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2003;44:4223-4229.)
© 2003 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.02-1319

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, X. J.
Right arrow Articles by Pflugfelder, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, X. J.
Right arrow Articles by Pflugfelder, S. C.

Neurturin-Deficient Mice Develop Dry Eye and Keratoconjunctivitis Sicca

Xiu Jun Song,1,2 De-Quan Li,1 William Farley,1 Li Hui Luo,1 Robert O. Heuckeroth,3 Jeffrey Milbrandt,4 and Stephen C. Pflugfelder1

1From the Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, Houston, Texas; the 3Departments of Pediatrics and Molecular Biology and Pharmacology and 4Pathology and Internal Medicine, Washington University, St. Louis, Missouri; and the 2Third Hospital of the Hebei Medical University, Shijiazhuang, China.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Neurturin has been identified as a neurotrophic factor for parasympathetic neurons. Neurturin-deficient (NRTN-/-) mice have defective parasympathetic innervation of their lacrimal glands. This study was conducted to evaluate tear function and ocular surface phenotype in NRTN-/- mice.

METHODS. Determined by tail genomic DNA PCR, 25 NRTN-/- mice and 17 neurturin-normal (NRTN+/+) mice aged 6 weeks to 4 months were evaluated. Aqueous tear production, tear fluorescein clearance and corneal sensation were serially measured. Corneal permeability to AlexaFluor dextran (AFD; Molecular Probes, Eugene, OR) was measured by a fluorometric assay at 485 nm excitation and 530 nm emission. Histology was evaluated in PAS-stained sections. Mucin and HLA class II (IA) antigen were assessed by immunofluorescent staining. Tear IL-1ß was measured by ELISA, and tear matrix metalloproteinase (MMP)-9 by zymography. Gene expression in the corneal epithelia was analyzed by semiquantitative RT-PCR.

RESULTS. In comparison to that in age-matched NRTN+/+ mice, aqueous tear production, tear fluorescein clearance, and corneal sensation were significantly reduced in NRTN-/- mice, whereas corneal permeability to AFD was significantly increased. Immunoreactive MUC-4 and -5AC mucin and goblet cell density (P < 0.001) in the conjunctiva of NRTN-/- mice were lower than in NRTN+/+ mice. The expression of MUC-1 and -4 mRNA by the corneal epithelium was reduced in NRTN-/- mice. There were a significantly greater number of IA antigen-positive conjunctival epithelial cells in NRTN-/- mice than NRTN+/+ mice. Tear fluid IL-1ß and MMP-9 concentrations and the expression of IL-1ß, TNF-{alpha}, macrophage inflammatory protein (MIP)-2, cytokine-induced neutrophil chemoattractant (KC), and MMP-9 mRNA by the corneal epithelia were significantly increased in NRTN-/- mice, compared with NRTN+/+ mice.

CONCLUSIONS. Neurturin-deficient mice show phenotypic changes and ocular surface inflammation that mimic human keratoconjunctivitis sicca. This model supports the importance of a functional ocular surface-central nervous system-lacrimal gland sensory-autonomic neural network in maintaining ocular surface health and homeostasis.


Dry eye is a common condition that affects 10% of the population between the ages of 30 and 60 years, increasing in prevalence to 15% of the population aged 65 years or more.1 2 Dry eye results from dysfunction of the integrated ocular surface-secretory glandular functional unit. This may result from disease of the sensory afferent nerves innervating the ocular surface, the autonomic efferent nerves innervating the tear-secreting glands, or the tear-secreting glands themselves. Dysfunction of the integrated functional unit leads to an unstable tear film, ocular surface inflammation, and epithelial disease, termed keratoconjunctivitis sicca (KCS).3 4 5 The pathogenesis of the tear film instability and KCS in dry eye is not well understood. A dry eye animal model with dysfunction of the integrated functional unit mimicking human dry eye disease would be a useful tool for investigating these mechanisms. Animal models of dry eye disease have been created by various means, including surgical removal of the tear-producing glands, ocular surface desiccation by mechanically inhibiting blinking, and pharmacologic inhibition of tear secretion.6 7 8 9 We have reported that inhibiting tear secretion in mice by systemic administration of the muscarinic cholinergic antagonist scopolamine produces KCS that mimics human dry eye disease.9 This model is labor intensive and difficult to continue for prolonged periods; however, it suggests that mice with parasympathetic autonomic nerve dysfunction due to disease or gene deletion may be relevant models for the study of dry eye.

Neurturin is a member of the transforming growth factor-ß family that functions as a neurotrophic factor for several classes of neurons.10 11 Neurturin acts through a two-component receptor system consisting of the ligand-specific GFR{alpha}-2 receptor and the common receptor tyrosine kinase c-Ret.12 Neurturin is essential for the development of specific postganglionic parasympathetic neurons. It has also been shown to support the development and maintenance of cutaneous trigeminal sensory nerves. Neurturin-deficient (NRTN-/-) mice generated by homologous recombination are viable and fertile, but have defects in their autonomic, enteric, and sensory nervous systems.13 Parasympathetic innervation of the lacrimal gland and submandibular salivary glands is dramatically reduced in NRTN-/- mice, as is the number of GFRa2-expressing neurons in the trigeminal ganglion.11 13 The purpose of this study was to evaluate tear function and ocular surface phenotype in NRTN-/- mice. Markers of human KCS (corneal epithelial permeability, conjunctival goblet cell density, and ocular surface inflammation) in neurturin-deficient and wild-type mice were investigated.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Neurturin gene-deficient mice were generated by homologous recombination.13 All studies were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Twenty-five neurturin gene knockout mice (NRTN-/-) and 17 wild-type control mice (NRTN+/+) were used in the study. Genotypes of 1-month-old pups from heterozygous parents were tested by using genomic DNA isolated from their tails (Genomic DNA Isolation kit; Sigma-Aldrich, St. Louis, MO). PCR amplification was performed on a thermal cycler (DNA Thermal Cycler 480; GeneAmp PCR kit; Applied Biosystems, Foster City, CA) with the neurturin gene primer pair 4743: CCGACGCGGTGGAGCTTCGAGAACTT and 4742: AAGGACACCTCGTCCTCATAGGCCGT, resulting in a 330-bp fragment from wild-type mice (NRTN+/+), and the gene primer pair 4743 and 4744: GAGATCAGCAGCCTCTGTTCCACATAC yielding a 200-bp fragment from homozygotes (NRTN-/-). Both fragments were obtained from the heterozygotes (NRTN+/-; Fig. 1 ).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 1. Genotype determination by PCR of mouse tail genomic DNA by using specific neurturin gene primer pairs. The PCR products were analyzed by 1.5% agarose gel electrophoresis. A 330-bp band was obtained from wild-type mice (+/+), a 200 bp band from neurturin gene knockout mice (-/-), and both bands from the heterozygotes (+/-).

 
Aqueous Tear Production
Aqueous tear production was measured with a phenol-red-impregnated cotton thread (Zone-Quick, Oasis, CA), which was placed in the lateral canthus for 20 seconds. Wetting of the thread was measured on a millimeter scale.

Fluorescein Clearance Test
The fluorescein clearance test is a measure of total tear production, tear spread, and tear drainage.14 This test was performed by instilling 1 µL 2% sodium fluorescein into the conjunctival sac. After 15 minutes, 1 µL of phosphate-buffered saline (PBS) was instilled, and the fluorescein-stained tear fluid was collected atraumatically from the lateral tear meniscus for 20 seconds under a surgical microscope by using a porous 1 x 8-mm polyester rod (America Filtrona Co., Richmond, VA). The rod was placed into a 10-µL micropipette tip within a 1.5-mL tube, which was then centrifuged for 5 minutes after addition of 99 µL PBS directly onto the polyester rod. The solution was transferred to a single well in a 96-well plate. The fluorescein concentration was measured with a fluorophotometer (CytoFluor II; Perseptive Biosystems, Framingham, MA), using 485-nm excitation and 530-nm emission filters.

Measurement of Corneal Sensation
A stream of CO2 gas at a pressure of 1 psi through a 1-mm diameter plastic catheter tip was delivered perpendicularly to the corneas of mice. The tip of the catheter was slowly advanced toward the corneal surface, beginning 15 mm away from the cornea. The distance in millimeters where a blink or withdrawal was observed was recorded.

Corneal Permeability to AlexaFluor Dextran
The corneal uptake of 10-kDa AlexaFluor dextran (AFD; Molecular Probes, Eugene, OR) was measured by using a modification of a previously reported technique.9 Briefly, 1 µL of 0.3% AFD was instilled onto the ocular surface 15 minutes before death. Excised corneas were rinsed four times with 200 µL balanced salt solution (BSS; Alcon Lab, Inc., Fort Worth, TX) and placed in 200 µL BSS. The solution containing the corneal tissue was protected from light and placed on an orbital shaker. The concentration of eluted AFD was measured with 485-nm excitation and 530-nm emission filters at 10, 20, and 60 minutes on a fluorophotometer (CytoFluor II; Perseptive Biosystems).

Histology and Immunofluorescent Staining
The whole eyeball together with the eyelids and conjunctiva was embedded in a mixture of 75% (vol/vol) OCT compound (Sakura Finetek USA, Inc., Torrance, CA) and 25% (vol/vol) aqueous mounting medium (Immu-Mount; Thermo-Shandon, Pittsburgh, PA), and then flash frozen in liquid nitrogen. Sections (10 µm thick) were cut and stained with periodic acid-Schiff (PAS) reagent. For immunofluorescent staining, sections were fixed with 100% methanol at 4°C for 10 minutes and blocked with 5% normal goat serum in PBS for 30 minutes. The primary antibody was applied for 1 hour at room temperature. These goat polyclonal antibodies were reactive with MUC-4 ASGP2 C-terminal peptide (C-pep; a gift from Kermit Carraway, University of Miami, Miami, FL), MUC-5AC (a gift from Marcia Jumblatt, University of Louisville, Louisville, KY) or HLA class II antigen (IA; Pharmingen, San Diego, CA). After a wash with PBS, the secondary antibody (AlexaFluor-488 conjugate; 1:100 dilution; Molecular Probes) was applied for 1 hour in a dark incubation chamber. After a wash with PBS, antifade medium (Gel-Mount; Fisher, Atlanta, GA) containing 1 µg/mL Hoechst 33342 dye and a coverslip were applied. Sections were examined and photographed with an epifluorescence microscope (Eclipse 400; Nikon, Tokyo, Japan) and a digital camera (model DMX 1200; Nikon).

Tear Collection
PBS (1.5 µL) containing 0.1% bovine serum albumin (BSA) was instilled into the conjunctival sac. The tear fluid and buffer were collected with a 1-µL volume glass capillary tube (Drummond Scientific Co., Broomhall, PA) by capillary action from the tear meniscus in the lateral canthus. The tear solution was stored at -80°C until zymography and ELISA were performed.

IL-1ß ELISA and Gelatin Zymography
The IL-1ß concentration in tear samples was assayed with ELISA (Quantikine M Murine ELISA kit; R&D Systems, Minneapolis, MN), according to the manufacturer’s protocol.

The level of gelatinolytic enzymes in the tear fluid was measured by SDS-PAGE gelatin zymography, according to a previously reported method.15 A 2-µL tear sample (from both eyes of each mouse) was added to SDS-PAGE sample buffer and fractionated by electrophoresis on an 8% polyacrylamide gel containing gelatin (0.5 mg/mL). The gels were soaked in 0.25% Triton X-100 for 30 minutes at room temperature to remove the SDS and incubated in a digestion buffer containing 50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl2, 2 µM ZnSO4, 0.01% Brij-35, and 5 mM phenylmethylsulfonyl fluoride (PMSF), a serine protease inhibitor, at 37°C overnight, to allow proteinase digestion of its substrate. The gels were rinsed in distilled water and stained with 0.25% Coomassie brilliant blue R-250 in 40% isopropanol for 2 hours and destained with 7% acetic acid.

RNA Isolation and Semiquantitative RT-PCR
Total RNA from the corneal epithelium was isolated by the acid guanidium thiocyanate-phenol-chloroform extraction method,16 and stored at -80°C before use. The gene expression was analyzed by reverse transcription-polymerase chain reaction (RT-PCR)16 with a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), as an internal control. In brief, first-strand cDNAs were synthesized from 0.5 µg of total RNA with murine leukemia virus (MuLV) reverse transcriptase. PCR amplification of the first-strand cDNAs was performed with specific primer pairs for murine cDNA of matrix metalloproteinase (MMP)-9, IL-1ß, TNF-{alpha}, macrophage inflammatory protein (MIP)-2, cytokine-induced neutrophil chemoattractant (KC), MUC-1, MUC-5AC, or GAPDH (Table 1) . Semiquantitative RT-PCR was achieved by terminating reactions at intervals of 24, 28, 32, 36, and 40 cycles for each primer pair to ensure that the PCR products formed were within the linear portion of the amplification curve.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Mouse Primer Sequences Used for RT-PCR

 
Statistical Analysis
Depending on the normality of the data distribution, the t-test or Mann-Whitney test was used for statistical comparison of assay results between groups.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Aqueous Tear Production and Clearance
Aqueous tear production was reduced in NRTN-/- mice (n = 25) compared with age-matched NRTN+/+ mice (n = 17). The difference did not reach statistical significance at 6 weeks (P = 0.126), but did at 8 weeks and in older mice (P < 0.05–0.01, Fig. 2 ). Similarly, NRTN-/- mice from 8 weeks forward had significantly delayed tear fluorescein clearance compared with age-matched NRTN+/+ mice (P < 0.001, Fig. 3 ).



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 2. Comparison of the tear production between wild-type (+/+) and neurturin gene knockout (-/-) mice at different ages (6–20 weeks). Data show mean and SD (error bars). *P < 0.05, ** < 0.01; Mann-Whitney test.

 


View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 3. Comparison of tear fluorescein clearance between wild-type (+/+) and neurturin gene knockout (-/-) mice at different ages (6–20 weeks). Data show mean and SD (error bars) fluorescence units. **P < 0.001; Mann-Whitney test.

 
Corneal Sensation
Corneal sensation was assessed in both groups of 10-week-old mice. The distance of the CO2 stream from the mouse cornea that triggered a blink reflex was significantly less in NRTN-/- mice (mean = 2.40 ± 1.13 cm; n = 34 eyes) than in NRTN+/+ mice (mean = 7.62 ± 2.0 cm, n = 28 eyes; P < 0.001; Mann-Whitney test).

Corneal Epithelial Permeability to AFD
Decreased corneal epithelial barrier function is a key feature of human KCS. Corneal epithelial barrier function was assessed by measuring corneal permeability to AFD. The corneas of 10-week-old NRTN-/- mice were more permeable to AFD (36.11 ± 5.1 U, n = 9) than age related NRTN+/+ mice (22.6 ± 4.1 U, n = 9; P < 0.05 by the Mann-Whitney test). This finding suggests that the corneal epithelial barrier function is altered in NRTN-/- mice.

Histology and Epithelial Mucin Expression
The corneal epithelium of 10-week-old NRTN-/- mice was noted to be markedly thickened, approximately eight epithelial cell layers thick compared with five epithelial cell layers in wild-type mice (Fig. 4 , top). The corneal epithelial cells in NRTN-/- mice had a more basal cell phenotype and often contained PAS-positive granules. RT-PCR showed that the expression of MUC-1 and -4 mRNA by the corneal epithelium was lower in NRTN-/- than in NRTN+/+ mice (Fig. 5) .



View larger version (98K):
[in this window]
[in a new window]
 
FIGURE 4. Representative PAS-stained sections for corneal and conjunctival histology of NRTN+/+ and NTRN-/- mice. K, cornea, BCj, bulbar conjunctiva, TCj, tarsal conjunctiva.

 


View larger version (57K):
[in this window]
[in a new window]
 
FIGURE 5. Representative semiquantitative RT-PCR showing decreased expression of (A) MUC-1 and (B) MUC-4 mRNA by corneal epithelia in NRTN-/- mice, compared with age-matched NRTN+/+ mice, with (C) GAPDH mRNA as an internal control.

 
Differences in mucin expression were observed in the conjunctiva. Immunofluorescent staining for the cell membrane mucin MUC-4 was much less in the bulbar and tarsal conjunctiva of NRTN-/- mice than in NRTN+/+ mice (Fig. 6) . Conjunctival goblet cell density was measured over 100-mm lengths on the tarsal and bulbar conjunctiva (Fig. 4 , bottom). The number of goblet cells in the bulbar (0.68 ± 0.25) and tarsal (10.25 ± 2.3) conjunctiva of NRTN-/- mice was significantly lower than in the bulbar (10.5 ± 3.7) and tarsal (51.6 ± 2.1) conjunctiva of NRTN+/+ mice (n = 3, P < 0.001 for both sites; Mann-Whitney test). This was supported by reduced expression of the goblet cell mucin MUC-5AC by the NRTN-/- mice (Fig. 7) . Leukocytes were observed in the epithelium and surface of the tarsal conjunctiva in many sections of NRTN-/- mice, but rarely in the NRTN+/+ mice. These findings suggest that NRTN-/- mice undergo conjunctival phenotypic changes similar to those in human KCS.



View larger version (70K):
[in this window]
[in a new window]
 
FIGURE 6. Upper panel: representative immunofluorescent staining for MUC-4 in the conjunctiva of NRTN+/+ and NRTN-/- mice. Lower panel: conjunctival sections of respective mouse strains counterstained with Hoechst 33342 dye. Abbreviations are as in Fig 4 .

 


View larger version (91K):
[in this window]
[in a new window]
 
FIGURE 7. Upper panel: representative immunofluorescent staining for MUC-5AC in the conjunctiva of NRTN+/+ and NRTN-/- mice. Lower panel: conjunctival sections of respective mouse strains counterstained with Hoechst 33342 dye. Abbreviations are as in Figure 4 .

 
IA Expression in the Conjunctiva
Aberrant HLA class II (IA) antigen expression by the conjunctival epithelium has been reported to increase in human KCS. Scattered stromal cells and epithelial dendritic cells in the conjunctiva of NTRN+/+ mice were immunofluorescent for IA antigen. In contrast, numerous IA-positive conjunctival epithelial cells (Fig. 8 , arrow) were observed in NTRN-/- mice. This finding indicates there is immune activation of the conjunctival epithelium in NRTN-/- mice.



View larger version (90K):
[in this window]
[in a new window]
 
FIGURE 8. Upper panel: representative immunofluorescent staining for IA in the conjunctiva of NRTN+/+ and NRTN-/- mice. Lower panel: conjunctival sections of respective mouse strains counterstained with Hoechst 33342 dye. Abbreviations as in Figure 4 .

 
Tear Fluid IL-1ß ELISA and Gelatin Zymography
Elevated concentrations of the proinflammatory cytokine IL-1ß and the protease MMP-9 have been detected in the tear fluid of humans with KCS. IL-1ß and MMP-9 were detected in tear fluid of wild-type and NRTN-/- mice by ELISA and gelatin zymography, respectively. Compared with that in NRTN+/+ mice, the IL-1ß concentration in tear fluid of NRTN-/- mice was slightly higher in 2-month-old mice (44.74 ± 9.94 pg/mL vs. 57.79 ± 14.93 pg/mL, n = 10, P > 0.05), and was dramatically increased in 4-month-old mice (29.83 ± 16.16 pg/mL vs. 189.57 ± 67.10 pg/mL, n = 10, P < 0.05 by the t-test, Fig. 9 ). Murine MMP-9 (105 kDa digestion band) was observed in the tear fluid of 88% (22/25) of NRTN-/- mice aged 8 to 12 weeks, compared with a weak MMP-9 band in the tear fluid of 29.4% (5/17) of NRTN+/+ mice at similar ages (Fig. 10) .



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 9. IL-1ß concentration in tear fluid of NRTN-/- and NRTN+/+ mice aged 2 (n = 10) and 4 (n = 10) months and all ages (n = 20) by ELISA. Data are the mean ± SD.

 


View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 10. A representative zymogram showing MMP-9 protein in the tear fluid of NRTN+/+ and NRTN-/- mice aged 8 to 12 weeks.

 
mRNA Expression of IL-1ß, TNF-{alpha}, MIP-2, KC, and MMP-9 by the Corneal Epithelium
The expression of RNA encoding the inflammatory cytokines IL-1ß and TNF-{alpha}, the chemokines MIP-2 and KC, and the protease MMP-9 was evaluated in the corneal epithelia of wild-type and NRTN-/- mice, according to the results of semiquantitative RT-PCR of pooled total RNA from six to eight corneal epithelia in each group of mice aged 12 to 16 weeks. The corneal epithelia of NRTN+/+ mice showed a low level of expression of MMP-9 mRNA, whereas IL-1ß, TNF-{alpha}, MIP-2, and KC mRNA were barely detectable. The corneal epithelium of NRTN-/- mice expressed higher levels of MMP-9, IL-1ß, TNF-{alpha}, MIP-2, and KC mRNAs than did wild-type mice (Fig. 11) . These findings indicate that the expression of these inflammatory cytokines and chemokines was dramatically stimulated in the corneal epithelia of the NRTN-/- mice.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 11. Representative semiquantitative RT-PCR showing increased expression of IL-1ß, TNF-{alpha}, MIP-2, KC, and MMP-9 mRNA by corneal epithelia in NRTN-/- mice, compared with age-matched NRTN+/+ mice, with GAPDH mRNA as an internal control.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In this study we report a naturally occurring and permanent dry eye model in genetically manipulated neurturin-deficient mice. These mice show significantly decreased aqueous tear production and tear fluorescein clearance. Accompanying altered tear function are altered corneal epithelial barrier function, reduced mucin production, and ocular surface inflammation, all phenotypic changes that are observed in human KCS. Based on these findings, we believe that neurturin-deficient mice provide an exciting novel model for the study of the pathogenesis and natural history of dry eye disease.

It is recognized that the ocular surface, the tear secreting glands, the central nervous system and their interconnecting reflex neural pathways function as an integrated functional unit.17 18 Tear flow is engendered through stimulation of ocular surface, eyelid, and nasal mucosal trigeminal sensory afferent nerves.19 20 21 These nerves synapse in the pons with efferent parasympathetic nerves that innervate the lacrimal glands.22 23 24 Disease or damage of the afferent or efferent arms of the integrated ocular surface lacrimal functional unit are common causes of dry eye in humans. Herpes virus infections and surgical amputation of afferent trigeminal nerves in the cornea cause dry eye.21 Efferent parasympathetic dysfunction has been observed in patients with rheumatoid arthritis who have secondary Sjögren syndrome and may be due to circulating autoantibodies to the glandular M3 muscarinic acetylcholine receptors.25 26 Neurturin-deficient mice have defective autonomic nerves, including defective lacrimal gland innervation.13 Immunostaining studies revealed that parasympathetics nerve fibers that were readily identifiable within the lacrimal glands of wild-type mouse were almost completely absent in the glands of NRTN-/- mice.13 Reduced tear production as a result of defective lacrimal gland autonomic innervation is therefore a likely cause of the aqueous tear deficiency that develops in NRTN-/- mice. Another potential cause is reduced afferent stimulation of tear production and tear clearance.27 28 Compared with wild-type mice, NRTN-/- mice were observed to have significantly reduced corneal sensitivity to a stream of CO2 gas that has been reported to stimulate polymodal sensory receptors in the cornea.29 These defects in neural pathways connecting the lacrimal functional unit make neurturin-deficient mice a physiologically relevant animal model of dry eye.

Dry eye produces ocular irritation and ocular surface disease, termed KCS, which results in blurred and fluctuating vision and an increased risk of sight-threatening corneal infection and ulceration.5 30 31 The histologic features of KCS are abnormal proliferation and differentiation of the ocular surface epithelium with decreased density of conjunctival goblet cells and decreased production of mucus by the ocular surface epithelium.32 33 These cellular changes are accompanied by altered corneal epithelial barrier function that is detected clinically as increased corneal uptake of fluorescein dye.34 35 The corneal epithelium of NRTN-/- mice was observed to be thicker than that in NRTN+/+ mice and it showed intracellular accumulation of PAS-positive glycoproteins rather than the homogeneous staining pattern in the apical cells of wild-type mice. These findings suggest that there is abnormal differentiation of the corneal epithelium in these mice. Accompanying these histologic findings was a significantly greater corneal epithelial permeability to 10-kDa AFD in NRTN-/- mice than in NRTN+/+ mice, indicating altered corneal epithelial barrier function. An abnormal PAS staining pattern and dramatically reduced conjunctival goblet cell density were observed on the tarsal and bulbar conjunctiva of NRTN-/- mice, compared with NRTN+/+ mice. Cytological studies have shown that decreased conjunctival goblet cell density is a hallmark of KCS in humans.32 36 Conjunctival goblet cells are the main source of the gel-forming mucin MUC-5AC, which lubricates and protects the ocular surface.37 38 39 Our results showed that immunodetectable MUC-4 and MUC-5AC in the conjunctival epithelium (Figs. 6 7) and MUC-1 and -4 mRNA in the corneal epithelium (Fig. 5) were markedly reduced in NRTN-/- mice. These findings indicate that the NRTN-/- mouse exhibits many of the histologic changes that occur in human KCS.

There is increasing recognition that ocular surface inflammation may play a critical role in the pathogenesis of KCS. Increased expression of several inflammatory mediators has been identified on the ocular surface of eyes with human KCS. These include increased concentrations of proinflammatory cytokines in the conjunctival epithelium and tear fluid18 40 41 42 43 and increased concentration and activity of proteases, such as plasmin and MMP-9 in the tear fluid.41 44 The proinflammatory cytokines IL-1 and TNF-{alpha} are important mediators of inflammation and immunity.45 46 IL-1 is a potent inducer of other inflammatory cytokines, such as IL-6 and TNF-{alpha}, and of chemokines, such as IL-8.47 In mice, IL-1 and TNF-{alpha} induce the key chemoattractants, KC and MIP-2.48 49 MIP-2 is a homologue of human IL-8 that promotes leukocyte recruitment.50 51 52 IL-1 and TNF-{alpha} also stimulate the production of MMP enzymes by epithelial and inflammatory cells.42 53 Our results showed that the concentrations of IL-1ß and MMP-9 proteins in tear fluid were significantly increased, and the mRNA expression of IL-1ß, TNF-{alpha}, and MMP-9, as well as chemokines MIP-2 and KC, by the corneal epithelia was dramatically upregulated in NRTN-/- mice, compared with NRNT+/+ mice. The increase in these soluble inflammatory mediators was accompanied by increased leukocyte infiltration of the conjunctival epithelium in NRTN-/- mice. These findings indicate that the increased inflammatory mediators in our mouse model parallel those in human dry eye.

In conclusion, neurturin-deficient mice exhibit a phenotype of ocular surface disease and inflammation that mimics human KCS. This model supports the importance of a functional ocular surface-central nervous system-lacrimal gland sensory-autonomic neural network for maintenance of ocular surface health and homeostasis. This model may be a useful tool for studying the mechanism of human dry eye disease.


    Footnotes
 
Presented in part at the annual meeting of the Association for Research in Vision and Ophthalmology, Fort Lauderdale, Florida, May 2002.

Supported in part by National Eye Institute Grant EY11915 (SCP), an unrestricted grant from Research to Prevent Blindness, the Oshman Foundation, the William Stamps Farish Fund, National Institute of Diabetes and Digestive and Kidney (NIDDK) diseases Grant R01-DK57038 (ROH), and the Washington University Digestive Diseases Research Core Center Pilot/Feasibility Program (supported by NIDDK Grant DK52574).

Submitted for publication December 20, 2002; revised April 30, 2003; accepted June 2, 2003.

Disclosure: X.J. Song, None; D.-Q. Li, None; W. Farley, None; L.H. Luo, None; R.O. Heuckeroth, None; J. Milbrandt, None; S.C. Pflugfelder, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Stephen C. Pflugfelder, Ocular Surface Center, Cullen Eye Institute, Department of Ophthalmology, Baylor College of Medicine, 6565 Fannin Street, NC-205, Houston, TX 77030; stevenp{at}bcm.tmc.edu.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Schein, OD, Munoz, B, Tielsch, JM, Bandeen-Roche, K, West, S. (1997) Prevalence of dry eye among the elderly Am J Ophthalmol 124,723-728[Medline][Order article via Infotrieve]
  2. Hikichi, T, Yoshida, A, Fukui, Y. (1995) Prevalence of dry eye in Japanese eye centers Graefes Arch Clin Exp Ophthalmol 233,555-558[CrossRef][Medline][Order article via Infotrieve]
  3. Bron, AJ, Mengher, LS. (1989) The ocular surface in keratoconjunctivitis sicca Eye 3,428-437
  4. Fox, RI, Robinson, C, Curd, J. (1994) Sjögren’s syndrome: proposed criteria for classification Arthritis Rheum 29,577-583
  5. Lemp, MA. (2000) Evaluation and differential diagnosis of keratoconjunctivitis sicca J Rheumatol Suppl 61,11-14[Medline][Order article via Infotrieve]
  6. Fujihara, T, Nagano, T, Nakamura, M, Shirasawa, E. (1998) Lactoferrin suppresses loss of corneal epithelial integrity in a rabbit short-term dry eye model J Ocul Pharmacol Ther 14,99-107[Medline][Order article via Infotrieve]
  7. Fujihara, T, Murakami, T, Fujita, H, Nakamura, M, Nakata, K. (2001) Improvement of corneal barrier function by the P2Y(2) agonist INS365 in a rat dry eye model Invest Ophthalmol Vis Sci 42,96-100[Abstract/Free Full Text]
  8. Burgalassi, S, Panichi, L, Chetoni, P, Saettone, MF, Boldrini, E. (1999) Development of a simple dry eye model in the albino rabbit and evaluation of some tear substitutes Ophthalmic Res 31,229-235[CrossRef][Medline][Order article via Infotrieve]
  9. Dursun, D, Wang, M, Monroy, D, et al (2002) A mouse model of keratoconjunctivitis sicca Invest Ophthalmol Vis Sci 43,632-638[Abstract/Free Full Text]
  10. Golden, JP, DeMaro, JA, Osborne, PA, Milbrandt, J, Johnson, EM, Jr (1999) Expression of neurturin, GDNF, and GDNF family-receptor mRNA in the developing and mature mouse Exp Neurol 158,504-528[CrossRef][Medline][Order article via Infotrieve]
  11. Rossi, J, Luukko, K, Poteryaev, D, et al (1999) Retarded growth and deficits in the enteric and parasympathetic nervous system in mice lacking GFR alpha2, a functional neurturin receptor Neuron 22,243-252[CrossRef][Medline][Order article via Infotrieve]
  12. Pezeshki, G, Franke, B, Engele, J. (2001) Evidence for a ligand-specific signaling through GFRalpha-1, but not GFRalpha-2, in the absence of Ret J Neurosci Res 66,390-395[CrossRef][Medline][Order article via Infotrieve]
  13. Heuckeroth, RO, Enomoto, H, Grider, JR, et al (1999) Gene targeting reveals a critical role for neurturin in the development and maintenance of enteric, sensory, and parasympathetic neurons Neuron 22,253-263[CrossRef][Medline][Order article via Infotrieve]
  14. Afonso, AA, Monroy, D, Stern, ME, Feuer, WJ, Tseng, SC, Pflugfelder, SC. (1999) Correlation of tear fluorescein clearance and Schirmer test scores with ocular irritation symptoms Ophthalmology 106,803-810[CrossRef][Medline][Order article via Infotrieve]
  15. Sobrin, L, Liu, Z, Monroy, DC, et al (2000) Regulation of MMP-9 activity in human tear fluid and corneal epithelial culture supernatant Invest Ophthalmol Vis Sci 41,1703-1709[Abstract/Free Full Text]
  16. Li, DQ, Tseng, SC. (1995) Three patterns of cytokine expression potentially involved in epithelial-fibroblast interactions of human ocular surface J Cell Physiol 163,61-79[CrossRef][Medline][Order article via Infotrieve]
  17. Mathers, WD. (2000) Why the eye becomes dry: a cornea and lacrimal gland feedback model CLAO J 26,159-165[Medline][Order article via Infotrieve]
  18. Stern, ME, Beuerman, RW, Fox, RI, Gao, J, Mircheff, AK, Pflugfelder, SC. (1998) The pathology of dry eye: the interaction between the ocular surface and lacrimal glands Cornea 17,584-589[CrossRef][Medline][Order article via Infotrieve]
  19. Jordan, A, Baum, J. (1980) Basic tear flow: does it exist? Ophthalmology 87,920-930[Medline][Order article via Infotrieve]
  20. Pflugfelder, SC. (1998) Tear fluid influence on the ocular surface Adv Exp Med Biol 438,611-617[Medline][Order article via Infotrieve]
  21. Gupta, A, Heigle, T, Pflugfelder, SC. (1997) Nasolacrimal stimulation of aqueous tear production Cornea 16,645-648[Medline][Order article via Infotrieve]
  22. Ehinger, B. (1966) Ocular and orbital vegetative nerves Acta Physiol Scand Suppl 268,1-35
  23. Yasui, T, Karita, K, Izumi, H, Tamai, M. (1997) Correlation between vasodilation and secretion in the lacrimal gland elicited by stimulation of the cornea and facial nerve root of the cat Invest Ophthalmol Vis Sci 38,2476-2482[Abstract/Free Full Text]
  24. Nikkinen, A, Uusitalo, H, Lehtosalo, JI, Palkama, A. (1985) Distribution of adrenergic nerves in the lacrimal glands of guinea-pig and rat Exp Eye Res 40,751-756[CrossRef][Medline][Order article via Infotrieve]
  25. Barendregt, PJ, van der Heijde, GL, Breedveld, FC, Markusse, HM. (1996) Parasympathetic dysfunction in rheumatoid arthritis patients with ocular dryness Ann Rheum Dis 55,612-615[Abstract/Free Full Text]
  26. Bacman, S, Berra, A, Sterin-Borda, L, Borda, E. (2001) Muscarinic acetylcholine receptor antibodies as a new marker of dry eye Sjögren syndrome Invest Ophthalmol Vis Sci 42,321-327[Abstract/Free Full Text]
  27. Collins, M, Seeto, R, Campbell, L, Ross, M. (1989) Blinking and corneal sensitivity Acta Ophthalmol (Copenh) 67,525-531
  28. Toda, I, Asano-Kato, N, Komai-Hori, Y, Tsubota, K. (2001) Dry eye after laser in situ keratomileusis Am J Ophthalmol 132,1-7[CrossRef][Medline][Order article via Infotrieve]
  29. Belmonte, C, Acosta, MC, Schmelz, M, Gallar, J. (1999) Measurement of corneal sensitivity to mechanical and chemical stimulation with a CO2 esthesiometer Invest Ophthalmol Vis Sci 40,513-519[Abstract/Free Full Text]
  30. Nelson, JD. (1994) Diagnosis of keratoconjunctivitis sicca Int Ophthalmol Clin 34,37-56[CrossRef][Medline][Order article via Infotrieve]
  31. Pflugfelder, SC. (1996) Differential diagnosis of dry eye conditions Adv Dent Res 10,9-12[Abstract/Free Full Text]
  32. Pflugfelder, SC, Tseng, SCG, Yoshino, K, Monroy, D, Felix, C, Reis, BL. (1997) Correlation of goblet cell density and mucosal epithelial membrane mucin expression with rose bengal staining in patients with ocular irritation Ophthalmology 104,223-235[Medline][Order article via Infotrieve]
  33. Pflugfelder, SC. (1998) Advances in the diagnosis and management of keratoconjunctivitis sicca Curr Opin Ophthalmol 9,50-53[CrossRef]
  34. Gobbels, M, Spitznas, M. (1992) Corneal epithelial permeability of dry eyes before and after treatment with artificial tears Ophthalmology 99,873-878[Medline][Order article via Infotrieve]
  35. Yokoi, N, Kinoshita, S. (1995) Clinical evaluation of corneal epithelial barrier function with the slit-lamp fluorophotometer Cornea 14,485-489[Medline][Order article via Infotrieve]
  36. Nelson, JD, Wright, JC. (1984) Conjunctival goblet cell densities in ocular surface disorders Arch Ophthalmol 102,1049-1051[Abstract/Free Full Text]
  37. Gipson, IK, Inatomi, T. (1998) Cellular origin of mucins of the ocular surface tear film Adv Exp Med Biol 438,221-227[Medline][Order article via Infotrieve]
  38. Inatomi, T, Spurr-Michaud, S, Tisdale, AS, Zhan, Q, Feldman, ST, Gipson, IK. (1996) Expression of secretory mucin genes by human conjunctival epithelia Invest Ophthalmol Vis Sci 37,1684-1692[Abstract/Free Full Text]
  39. Pflugfelder, SC, Solomon, A, Stern, ME. (2000) The diagnosis and management of dry eye: a twenty-five-year review Cornea 19,644-649[CrossRef][Medline][Order article via Infotrieve]
  40. Barton, K, Nava, A, Monroy, DC, Pflugfelder, SC. (1998) Cytokines and tear function in ocular surface disease Adv Exp Med Biol 438,461-469[Medline][Order article via Infotrieve]
  41. Afonso, AA, Sobrin, L, Monroy, DC, Selzer, M, Lokeshwar, B, Pflugfelder, SC. (1999) Tear fluid gelatinase B activity correlates with IL-1{alpha} concentration and fluorescein clearance in ocular rosacea Invest Ophthalmol Vis Sci 40,2506-2512[Abstract/Free Full Text]
  42. Solomon, A, Dursun, D, Liu, Z, Xie, Y, Macri, A, Pflugfelder, SC. (2001) Pro- and anti-inflammatory forms of interleukin-1 in the tear fluid and conjunctiva of patients with dry-eye disease Invest Ophthalmol Vis Sci 42,2283-2292[Abstract/Free Full Text]
  43. Tishler, M, Yaron, I, Geyer, O, Shirazi, I, Naftaliev, E, Yaron, M. (1998) Elevated tear interleukin-6 levels in patients with Sjogren syndrome Ophthalmology 105,2327-2329[CrossRef][Medline][Order article via Infotrieve]
  44. Virtanen, T, Konttinen, YT, Honkanen, N, Harkonen, M, Tervo, T. (1997) Tear fluid plasmin activity of dry eye patients with Sjögren’s syndrome Acta Ophthalmol Scand 75,137-141[Medline][Order article via Infotrieve]
  45. Dinarello, CA. (1996) Biologic basis for interleukin-1 in disease Blood 87,2095-2147[Abstract/Free Full Text]
  46. Dinarello, CA, Wolff, SM. (1993) The role of interleukin-1 in disease N Engl J Med 328,106-113[Free Full Text]
  47. Selvan, RS, Kapadia, HB, Platt, JL. (1998) Complement-induced expression of chemokine genes in endothelium: regulation by IL-1-dependent and -independent mechanisms J Immunol 161,4388-4395[Abstract/Free Full Text]
  48. Calkins, CM, Bensard, DD, Shames, BD, et al (2002) IL-1 regulates in vivo C-X-C chemokine induction and neutrophil sequestration following endotoxemia J Endotoxin Res 8,59-67[CrossRef]
  49. Tessier, PA, Naccache, PH, Clark-Lewis, I, Gladue, RP, Neote, KS, McColl, SR. (1997) Chemokine networks in vivo: involvement of C-X-C and C-C chemokines in neutrophil extravasation in vivo in response to TNF-alpha J Immunol 159,3595-3602[Abstract]
  50. Xue, ML, Thakur, A, Willcox, M. (2002) Gene expression of pro-inflammatory cytokines and chemokines in mouse eye infected with Pseudomonas aeruginosa Clin Exp Ophthalmol 30,196-199[CrossRef][Medline][Order article via Infotrieve]
  51. Kernacki, KA, Barrett, RP, Hobden, JA, Hazlett, LD. (2000) Macrophage inflammatory protein-2 is a mediator of polymorphonuclear neutrophil influx in ocular bacterial infection J Immunol 164,1037-1045[Abstract/Free Full Text]
  52. Yan, XT, Tumpey, TM, Kunkel, SL, Oakes, JE, Lausch, RN. (1998) Role of MIP-2 in neutrophil migration and tissue injury in the herpes simplex virus-1-infected cornea Invest Ophthalmol Vis Sci 39,1854-1862[Abstract/Free Full Text]
  53. Li, DQ, Lokeshwar, BL, Solomon, A, Monroy, D, Ji, Z, Pflugfelder, SC. (2001) Regulation of MMP-9 production by human corneal epithelial cells Exp Eye Res 73,449-459[CrossRef][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
Arch OphthalmolHome page
I. S. Zagon, M. S. Klocek, J. W. Sassani, and P. J. McLaughlin
Dry Eye Reversal and Corneal Sensation Restoration With Topical Naltrexone in Diabetes Mellitus
Arch Ophthalmol, November 1, 2009; 127(11): 1468 - 1473.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
T. D. Blalock, S. J. Spurr-Michaud, A. S. Tisdale, and I. K. Gipson
Release of Membrane-Associated Mucins from Ocular Surface Epithelia
Invest. Ophthalmol. Vis. Sci., May 1, 2008; 49(5): 1864 - 1871.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
H. Toshida, D. H. Nguyen, R. W. Beuerman, and A. Murakami
Evaluation of Novel Dry Eye Model: Preganglionic Parasympathetic Denervation in Rabbit
Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4468 - 4475.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. K. Swamynathan, J. P. Katz, K. H. Kaestner, R. Ashery-Padan, M. A. Crawford, and J. Piatigorsky
Conditional Deletion of the Mouse Klf4 Gene Results in Corneal Epithelial Fragility, Stromal Edema, and Loss of Conjunctival Goblet Cells
Mol. Cell. Biol., January 1, 2007; 27(1): 182 - 194.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
R. M. Corrales, M. E. Stern, C. S. De Paiva, J. Welch, D.-Q. Li, and S. C. Pflugfelder
Desiccating stress stimulates expression of matrix metalloproteinases by the corneal epithelium.
Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3293 - 3302.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
O. Suwan-apichon, M. Rizen, R. Rangsin, S. Herretes, J. M. G. Reyes, K. Lekhanont, and R. S. Chuck
Botulinum Toxin B-Induced Mouse Model of Keratoconjunctivitis Sicca
Invest. Ophthalmol. Vis. Sci., January 1, 2006; 47(1): 133 - 139.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. A. Bosman, A. C. Penn, J. C. Ambrose, R. Kettleborough, D. L. Stemple, and K. P. Steel
Multiple mutations in mouse Chd7 provide models for CHARGE syndrome
Hum. Mol. Genet., November 15, 2005; 14(22): 3463 - 3476.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S. Barabino, L. Shen, L. Chen, S. Rashid, M. Rolando, and M. R. Dana
The Controlled-Environment Chamber: A New Mouse Model of Dry Eye
Invest. Ophthalmol. Vis. Sci., August 1, 2005; 46(8): 2766 - 2771.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Y. Fang, D. Choi, R. P. Searles, and W. D. Mathers
A Time Course Microarray Study of Gene Expression in the Mouse Lacrimal Gland after Acute Corneal Trauma
Invest. Ophthalmol. Vis. Sci., February 1, 2005; 46(2): 461 - 469.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
L. Luo, D.-Q. Li, A. Doshi, W. Farley, R. M. Corrales, and S. C. Pflugfelder
Experimental Dry Eye Stimulates Production of Inflammatory Cytokines and MMP-9 and Activates MAPK Signaling Pathways on the Ocular Surface
Invest. Ophthalmol. Vis. Sci., December 1, 2004; 45(12): 4293 - 4301.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, X. J.
Right arrow Articles by Pflugfelder, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, X. J.
Right arrow Articles by Pflugfelder, S. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS