IOVS Arteriosclerosis, Thrombosis, and Vascular Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2003;44:4247-4254.)
© 2003 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.03-0219

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, J.
Right arrow Articles by Yu, F.-S. X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, J.
Right arrow Articles by Yu, F.-S. X.

Toll-like Receptor 5-Mediated Corneal Epithelial Inflammatory Responses to Pseudomonas aeruginosa Flagellin

Jing Zhang,1 Keping Xu,1 Balamurali Ambati,2 and Fu-Shin X. Yu1,2

1From the Departments of Cellular Biology and Anatomy and 2Ophthalmology, Medical College of Georgia, Augusta, Georgia.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Flagellin is the major structural protein of the flagella of Gram-negative bacteria and is a potent trigger of innate immune responses in a number of eukaryotic cells and organisms. In this study, we sought to determine whether flagellin induces an inflammation response in cultured human corneal epithelial (HCE) cells and to determine the underlying mechanisms.

METHODS. Flagellin was purified from Pseudomonas aeruginosa (PA) strain PAO1 with ammonium sulfate gradient precipitation and lipopolysaccharide in flagellin preparation was removed by ion exchange chromatography. Purified flagellin was used to challenge HUCL, a telomerase-immortalized HCE cell line, and primarily cultured HCE cells. Inhibitory (I){kappa}B-{alpha} phosphorylation and degradation were detected by Western blot. Interleukin (IL)-6 and -8 expression in mRNA levels and secretion were assessed using RT-PCR and enzyme-linked immunosorbent assay, respectively. TLR5 localization in human cornea was analyzed by immunohistochemistry using anti-TLR5 antibody. Anti-flagellum antiserum and anti-TLR5 antibody were used for functional blocking of flagellin stimulation and TLR5 activation.

RESULTS. Exposure of both HUCL and primary HCE cells to purified PA flagellin (250 ng/mL) resulted in I{kappa}B-{alpha} phosphorylation and degradation in a time-dependent manner. Concomitant with NF-{kappa}B activation, transcriptional expression and subsequent secretion of IL-6 and -8 in these cells were also induced by flagellin. Toll-like receptor (TLR)-5, an innate immunity receptor for flagellin, was expressed in HUCL cells and located at the cell surface of the basal and wing, but not in superficial, cells of human corneal epithelium. Presence of flagellum- or TLR5-antisera in culture medium attenuated flagellin-induced I{kappa}B-{alpha} phosphorylation and degradation as well as IL-6 and -8 production.

CONCLUSIONS. Flagellin of Gram-negative pathogens such as PA contributes to the inflammatory responses of corneal epithelium in a TLR5-NF-{kappa}B signaling pathway-dependent manner.


An opportunistic bacterial pathogen, Pseudomonas aeruginosa (PA), can cause bacterial keratitis in patients who use extended-wear contact lenses.1 If untreated, infection with PA can lead to perforation of the cornea, resulting in permanent loss of vision and even loss of the eye.2 PA elaborates a multitude of factors including glycocalyx, lipopolysaccharide (LPS), exotoxin, and flagellin.3 These factors, notably LPS, may induce the release of a number of proinflammatory cytokines in resident corneal cells that can augment or prolong the inflammatory response, a consequence necessary to contain the infection.3 4 The host inflammatory response, however, also contributes to corneal destruction.

Recent studies have shown that flagella, surface structures that confer motility, enhance the pathogenicity of certain organisms including PA, either by promoting adhesion to the host tissues or by directly activating host inflammatory signal pathways.5 6 7 8 Most Gram-negative bacteria express flagella. Flagellin is the major structural protein of the flagella. Alterations in flagellar expression are associated with decreased virulence in several animal models of bacterial pathogenesis, including PA lung9 10 11 and corneal infection.5 It has been demonstrated that flagella bind specifically to the host cell glycosphingolipid asialo-GM1, and that binding is essential for epithelial cell invasion and cytotoxicity.3 10 Recent reports also indicate that flagella elicit host immune responses and that the responsible component is the filament protein flagellin. Intravenous flagellin causes a systemic inflammatory response in mice.7 In vitro, flagellated bacteria, purified flagellin, and medium conditioned by flagellated bacteria all readily induce inhibitory (I){kappa}B-{alpha} degradation, NF-{kappa}B activation, inducible nitric oxide synthetase expression, and the release of proinflammatory cytokines and chemokines such as interleukin (IL)-6, IL-8, CCL20, and TNF{alpha} in a variety of epithelial cells and cell lines.7 8 12 13 14 15 The effect of flagellin was shown to be caused by activation of toll-like receptor (TLR)-5 and in flagellin-challenged mice in a myeloid differentiation factor 88-dependent manner.8 13

TLRs are an evolutionarily conserved family of receptors that function in innate immunity through recognition of pathogen-associated molecular patterns.16 17 Pattern recognition by TLRs then leads to cytokine production and expression of costimulatory molecules, which can constitute protective innate and adaptive immunity.18 To date, 10 TLRs have been identified.19 20 Agonists have been identified for some (TLR2, -3, -4, -5, and -9), but not all, of these TLR proteins. TLR2 agonists include a variety of bacterial cell wall products,20 whereas TLR3 agonists are the double-stranded RNAs (dsRNA) associated with viral infection.21 TLR4 agonists include Gram-negative bacterial LPS, respiratory syncytial virus protein F, and the plant product taxol.22 23 Bacterial flagellin has been identified as a TLR5 agonist13 and unmethylated CpG-containing DNA as a TLR9 agonist.24 In the cornea, the expression and function of TLR4 in endotoxin-induced keratitis, in LPS-induced proinflammatory cytokine production, and in the inflammatory response induced by insoluble extracts of filarial nematodes have been documented.25 26 27 Although PA flagella have been shown to be involved in PA internalization in corneal epithelial cells,5 whether flagellin induces inflammatory responses through TLR5 signaling pathway and, if it does, how TLR5 discriminates between pathogenic and nonpathogenic bacteria in the cornea remain to be determined.

In this study, we investigated the effect of PA flagellin in cultured HCE cells on NF-{kappa}B activation and proinflammatory cytokine production. We also determined the role of flagellin-TLR5 interaction in induction of epithelial inflammatory responses by using anti-flagellum antiserum and anti-TLR5 antibody. Based on this study, we propose that flagellin plays a role, through TLR5, in induction of Gram-negative bacterial infection-associated inflammatory responses in the human cornea.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Flagellin Purification
PA strain PAO1 was injected into 2000 mL of tryptic soy broth medium (Sigma-Aldrich, St. Louis, MO) and incubated overnight at 37°C in a shaking incubator (New Brunswick Scientific, Edison, NJ) to a stationary phase (1012 CFU/mL). Bacteria were collected by centrifugation at 7000g at 4°C for 20 minutes and resuspended in 50 mM sodium phosphate buffer (pH 7.0). The bacterial suspension was blended to remove the flagellin from the cells. The homogenate was centrifuged at 12,000g at 4°C for 20 minutes to remove the cells from the supernatant. The supernatant was then mixed with ammonium sulfate in 5% increments. The differentially saturated supernatants were centrifuged at 12,000g at 4°C for 30 minutes to remove the insoluble materials from solution. The 15% and 20% insoluble fractions that contained the greatest amount of flagellin with the least amount of contaminants, were dissolved in 50 mM sodium phosphate buffer (pH 8.0) and dialyzed against the same buffer.28 The flagellin-containing sample was applied to diethylaminoethyl (DEAE)-Sephadex A-50 (Amersham Pharmacia Biotech Inc., Piscataway, NJ). The column was washed with 10x 50 mM sodium phosphate buffer (pH 8.0) and then eluted with 6x 0.6 mM NaCl and 50 mM sodium phosphate buffer (pH 8.0). The protein-containing fractions were collected, concentrated on filters (Amicon Centriplus YM-3; Millipore, Bedford, MA),14 and applied to 1 mL prepacked gel affinity columns (Detoxi-Gel Affinity Pak; Pierce, Rockford, IL). The amount of LPS was determined with a quantitative limulus amebocyte lysate kit (QCL-1000; BioWhittaker, Walkersville, MD). The amount of LPS in the flagellin samples after the two steps of chromatography was 2.7 endotoxin units (EU)/mg protein, comparable to that in the LPS-free flagellin preparation reported by Rudner et al.29 Identity of flagellin was confirmed with immunoblot analysis with rabbit anti-PA flagellum B antiserum, kindly provided by Dan Wozniak (Wake Forest University, Winston-Salem, NC).

Human Corneal Epithelial Cell Culture and Flagellin Challenge
Human telomerase-immortalized corneal epithelial (HUCL) cells, kindly provided by JG Rheinwald and Ilene Gipson (Harvard Medical School),30 were maintained in defined keratinocyte serum-free medium (SFM; Invitrogen-Life Technologies, Carlsbad, CA) in a humidified 5% CO2 incubator at 37°C. Cells were grown to 80% to 90% confluence in defined keratinocyte-SFM. Before treatment, the medium was replaced with keratinocyte basic medium (KBM; BioWhittaker) for 16 hours (growth factor starvation overnight). At the time of treatment, culture medium was replaced with fresh KBM containing flagellin and/or antibodies. At the indicated time, cells were processed for RNA preparation and immunoblot analysis, and conditioned media were collected for cytokine determination.

To conform the results obtained from HUCL cells, primary HCE cells were isolated from human donor corneas obtained from the Georgia Eye Bank. The epithelial sheet was separated from underlying stroma after overnight dispase (2.5 U/mL, Sigma-Aldrich) treatment at 4°C. The dissected epithelial sheet were trypsinized and cells collected by centrifugation (500g, 5 minutes). HCE cells were cultured in T25 flasks coated with fibronectin-collagen (FNC; 1:3 mixture) coating mix (Biological Research Faculty and Facility) and used at passage 3.

RNA Extraction and RT-PCR Analysis
RNA was isolated with extraction reagent (TRIzol; Invitrogen), and 2 µg of total RNA was reverse-transcribed with a first-strand synthesis system for RT-PCR (SuperScript; Invitrogen). cDNA was amplified by PCR with specific primers for human IL-6 (sense: CTCCTTCTCCACAAGCGCCTTC and antisense: GCGCAGAATGAGATGAGTTGTC; product: 583 bp), IL-8 (sense: CACCGGAAGGAACCATCTCA and antisense: GGAAGGCTGCCAAGAGAGC; product: 72 bp), 18S (sense: ACATCCAAGGAAGGCAGCAG and antisense: TTTTCGTCACTACCTCCCCG, product: 65 bp), and GAPDH (sense: CACCACCAACTGCTTAGCAC and antisense CCCTGTTGCTGTAGCCAAAT; product: 515 bp). IL-6 was amplified 25 cycles with annealing temperature 58°C, and IL-8 was amplified 20 cycles with annealing temperature 60°C. The PCR products (5 µL) for IL-6 and its internal control GAPDH were subjected to electrophoresis on 1% agarose gels containing ethidium bromide. Products for IL-8 and its internal control 18S were separated on a 12% polyacrylamide gel and stained with nucleic acid green dye (SYBR green; Molecular Probes, Inc., Eugene, OR). Staining was captured by digital camera (EDAS 290 system; Eastman Kodak, Rochester, NY).

Determination of IL-6 and -8 Secretion from HUCL Cells
Secretion of IL-6 and -8 was determined by ELISA. HUCL cells were plated 4 x 105 cells/well in 12-well plates. After growth factor starvation, cells were treated with flagellin for the indicated time and supernatants harvested for measurement of IL-6 and -8. IL-6 and -8 ELISAs were performed according to the manufacturer’s instructions (R&D Systems, Minneapolis, MN). The amount of IL-6 and -8 in culture media was normalized with the total amount of cellular protein lysed with radioimmunoprecipitation assay (RIPA) buffer (150 mM NaCl, 100 mM Tris-HCl [pH 7.5], 1% deoxycholate, 0.1% SDS, 1% Triton X-100, 50 mM NaF, 100 mM sodium pyrophosphate, 3.5 mM sodium orthovanadate, proteinase inhibitor cocktails, and 0.1 mM phenylmethylsulfonyl fluoride [PMSF]). Protein concentration of cell lysate was determined with a bicinchoninic acid assay (Micro BCA; Pierce Biotechnology, Rockford, IL). Results were expressed as mean picograms of cytokine per milligram cell lysate ± SE (n = 3). Probabilities were determined via ANOVA.

Cell Surface Biotinylation
HUCL cells were grown in cell migration assay filters (Costar Transwell; Corning, Inc., Corning, NY) until the formation of a monolayer, as evidenced by stable transepithelial electric resistance. The filter-grown cells were rinsed twice with PBS supplemented with 0.1 mM CaCl2 and 1 mM MgCl2 and then incubated with freshly prepared NHS-LC-Biotin (Pierce) diluted in the same solution (1 mg/mL), applied either to the basal or to apical side of the migration assay filters, for 5 minutes at room temperature or 30 minutes at 4°C. The reaction was quenched with 50 mM NH4Cl, and cells were lysed with a solution containing 1% Triton X-100, 20 mM Tris (pH 8.0), 50 mM NaCl, 5 mM EDTA, and 0.2% BSA supplemented with protease inhibitors. Cell extracts were centrifuged to remove detergent-insoluble material, and detergent-soluble supernatant was incubated with immobilized streptavidin agarose (Pierce) for 16 hours at 4°C to bind biotinylated proteins. Proteins bound to the agarose slurry were solubilized with Laemmli buffer. The samples were then analyzed by SDS-PAGE and immunoblot with affinity purified rabbit antibodies against TLR5 from Santa Cruz Biotechnology (Santa Cruz, CA).

Western Blot Analysis
Flagellin-treated HUCL cells were lysed with RIPA buffer, and protein concentration was determined with the BCA assay (Micro BCA; Pierce). I{kappa}B-{alpha} phosphorylation and degradation were detected with rabbit anti-I{kappa}B-{alpha} and anti-phospho-I{kappa}B-{alpha} purchased from Cell Signaling Technology (Beverly, MA) and developed with reagents (SuperSignal; Pierce).

Immunohistochemistry of TLRs in Human Cornea Sections
Cryostat sections (8 µm) of a human cornea after limbal transplantation were blocked with 5% goat serum for 1 hour. The affinity purified TLR5 antibody (5 µg/mL) was incubated at 4°C in a moist chamber overnight. After the slides were washed in PBS-BSA, fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (1:200 dilution; Jackson ImmunoResearch Laboratory; West Grove, PA) was applied for 1 hour at room temperature in a moist chamber. After the coverslips were washed, they were mounted with antifade mounting medium with DAPI (Vectashield; Vector Laboratories, Burlingame, CA). Negative control experiments included incubation of tissue sections with secondary antibodies alone.

Application of Neutralizing Antibodies
To neutralize flagellin, 250 ng/mL flagellin in KBM was mixed with 1:1000 diluted anti-flagellum antiserum and incubated at 37°C for 30 minutes, the same dilutions of normal rabbit serum were added to the medium as a negative control. HUCL cells were treated with KBM-serum mix at 37°C for various times.

To neutralize TLR5, HUCL cells were preincubated with KBM containing 10 µg/mL anti-TLR5 antibody or the same concentration of purified rabbit IgG (Sigma-Aldrich) for 30 minutes at 37°C. Cells were then treated with 250 ng/mL flagellin in KBM at 37°C for various times.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Effect of Flagellin on NF-{kappa}B Activation in HUCL Cells
To determine whether flagellin stimulates an epithelial inflammatory response, we purified flagellin from PA strain PAO1 with ammonium sulfate gradient precipitation and removed endotoxin LPS by two chromatography steps. The final preparation contains 2.7 endotoxin units (or 5.4 ng LPS) per milligram of purified flagellin. SDS-PAGE-Coomassie blue or silver staining revealed a predominant band at approximately 60 kDa, consistent with the known molecular weight of PA flagellin (Fig. 1) . Immunoblotting with PA flagellin antibody31 detected a single immunoreactive band coincident in molecular weight with the Coomassie blue/silver-stained band, suggesting that the purified protein is PA flagellin.



View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 1. SDS-PAGE and immunoblot analysis of purified PA flagellin. Flagellin was prepared from PAO1 cell extracts by 15% and 20% ammonium sulfate precipitation. The indicated amounts of isolated proteins were resolved on 5% to 15% polyacrylamide gels and either stained with Coomassie blue (lanes 1 and 2) or probed with anti-PA flagellum antiserum (1:25,000 dilution; lane 3) after transferring to nitrocellulose. Lane 4: purified flagellin after removal of potential lipopolysaccharide contamination with silver staining.

 
Activation of NF-{kappa}B in HCE cells in response to flagellin challenge was assessed by immunodetection of I{kappa}B-{alpha} phosphorylation and degradation (Fig. 2) . HUCL cells (Fig. 2A) stimulated by 250 ng/mL of purified LPS removed flagellin resulted in I{kappa}B-{alpha} phosphorylation and degradation in a time-dependent manner. Phosphorylated I{kappa}B-{alpha} was detected at 5 minutes and reached a peak at 60 minutes after stimulation, followed by slow decline up to 4 hours, at which time the phospho-I{kappa}B-{alpha} was still detectable. The increase in I{kappa}B{alpha} phosphorylation preceded I{kappa}B-{alpha} degradation, which was detectable 10 minutes after stimulation. By 30 minutes, the I{kappa}B-{alpha} level was almost undetectable and thereafter increased steadily up to hour 2 after stimulation (Fig. 2A) , suggesting an increase in I{kappa}B{alpha} expression when its cellular level is down. Figure 2B showed a similar response of primary culture of HCE cells to the challenge of LPS-free flagellin (250 ng/mL). Nuclear translocation of NF-{kappa}B, detected by immunohistochemistry with anti-p65 (a NF-{kappa}B subunit), was also observed in flagellin-challenged HUCL cells (data not shown). Taking the findings together, we conclude that HCE cells respond to flagellin and activate the NF-{kappa}B signaling pathway.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 2. PA flagellin stimulated I{kappa}B-{alpha} degradation and phosphorylation in HUCL or primary HCE cells. HUCL cells (A) or primary HCE cells (B), isolated from a 49-year-old white male without any known ocular abnormality, were stimulated with flagellin (250 ng/mL) or medium alone (control) for the indicated times. Total protein was extracted, and 20 µg of protein was subjected to SDS-PAGE followed by phospho-I{kappa}B-{alpha} (p-I{kappa}B-{alpha}) and I{kappa}B-{alpha} immunoblotting using a chemiluminescence technique. These results are representative for two independent experiments.

 
Effect of PA Flagellin on IL-6 and -8 Expression and Secretion in HUCL Cells
To assess the biological relevance of induced NF-{kappa}B activation, we measured the effect of PA flagellin on HCE proinflammatory cytokine expression and production (secretion). The effect of flagellin on IL-6 and -8 mRNA expression was determined by RT-PCR. IL-6 mRNA was not detectable in control nontreated cells (Fig. 3) . A PCR product of the expected size (583 bp) was observed 30 minutes after stimulation; the band intensity increased, reached a peak at 60 minutes, and was still detectable at 2 hours. IL-8 transcripts (65 bp) were observed in control HUCL cells, but its level was elevated in flagellin-treated cells, starting 30 minutes after stimulation and peaking at 1 hour. The levels of GAPDH and 18S (controls for RT-PCR) remained unchanged in control and in flagellin-challenged cells. Similar results were obtained when primary HCE cells and/or LPS-free flagellin was used (data not shown).



View larger version (88K):
[in this window]
[in a new window]
 
FIGURE 3. Flagellin-induced IL-6 and -8 mRNA expression in HCE cells. HUCL cells grown overnight in KBM (lacking growth factors) were stimulated with 250 ng/mL purified PA flagellin for the indicated times. Total RNA was extracted, reverse transcribed, and amplified using IL-6 primers with GAPDH as the control and IL-8 primers with 18S RNA as the control. PCR products were separated and stained. Results are a representative of three independent experiments.

 
The effects of flagellin on IL-6 and -8 secretion by HUCL cells were assessed by ELISA (Fig. 4) . At each time point tested, HUCL cells secreted increased amounts of IL-6 and -8 after exposure to flagellin. The differences in the amount of secreted IL-6 and -8 between control and flagellin-challenged cells were more apparent after prolonged incubation (8 hours). The amounts of IL-6 and -8 accumulated in 8-hour culture media of flagellin-challenged cells was 2.5 and 3 times more than that in control cell medium, respectively.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 4. Time course of flagellin-induced IL-6 and -8 secretion in HCE cells. HUCL cells grown overnight in KBM were stimulated with 250 ng/mL purified PA flagellin for the indicated times. The effects of flagellin (250 ng/mL) on IL-6 and -8 secretion were measured in cell culture supernatants by ELISA. Data are representative of triplicate experiments and are expressed as the mean ± SD. Statistically significant differences in secreted IL-6 and -8 in flagellin-treated HCE-T cells were determined by ANOVA with probabilities shown both for overall significance and pair-wise comparison (*P < 0.001).

 
Taken together, these data suggest that flagellin stimulates IL-6 and -8 expression and secretion in cultured HCE cells.

Cellular Distribution of TLR5 in Human Cornea and in Corneal Epithelial Cells
TLR5 has been shown to be the receptor for flagellin. Our initial studies using PCR and Western blot analysis revealed the expression of TLR5 in HUCL cells. In intestinal epithelial cells, TLR5 was found to be expressed exclusively on the basolateral surface of intestinal epithelia.8 To determine the distribution of TLR5 in HCE cells, we used cell surface biotinylation. HUCL cells were grown on cell migration assay filters (Costar Transwell; Corning) until a consistent reading of transepithelial electric resistance was reached (120 {Omega}, usually 7–10 days). Epithelia were treated apically or basolaterally with cell membrane-impermeable NHS-LC-biotin, lysed, and immunoprecipitated with streptavidin-Sepharose. Immunoprecipitates were probed by SDS-PAGE and immunoblot with anti-TLR5 antibody (Fig. 5) . Unlike in intestinal epithelia,8 TLR5 in corneal epithelial cells was labeled on both the apical and basal sides.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 5. Cell surface biotinylation of TLR5. HUCL cells were cultured on cell migration assay filters, and formation of an impermeable monolayer was monitored with measurement of transepithelial electric resistance.32 The monolayers were labeled with NHS-LC-biotin added either to the upper (lanes 1 and 3) or to the bottom (lanes 2 and 4) chambers. Biotinylated proteins were either directly analyzed by Western blot (lanes 1 and 2) or were precipitated from the cell lysate by streptavidin-conjugated agarose and analyzed using Western blot (lanes 3 and 4) with TLR5-specific antibodies. Results are representative of four independent experiments.

 
To determine the cellular distribution of TLR5 in stratified corneal epithelium, we performed immunohistochemistry using human corneal sections (Fig. 6) . Consistent with apical and basal labeling of TLR5 in cultured corneal epithelial cells, staining of TLR5 was found at the cell surface of basal and wing layers of human corneal epithelium. No specific staining was observed in the apical layer.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 6. Immunolocalization of TLR5 in a human cornea. TLR5 was detected by immunofluorescence staining. Frozen cryostat sections of a human cornea were incubated with (10 µg/mL) anti-TLR5 antibody (A, C) or no antibody incubation as a negative control (B, D). The bound antibodies were visualized after incubation with fluorescein isothiocyanate-conjugated goat anti-mouse IgG and nuclei by DAPI staining. (C, D) Merged staining of TLR5 and DAPI to indicate no TLR5 staining associated with the apical layer of the epithelium.

 
Effects of Flagellum Antiserum and Anti-TLR5 Antibody on Flagellin-Induced Epithelial Responses
To determine the role of the flagellin-TLR5 interaction in the initiation of innate inflammatory responses of corneal epithelial cells, flagellum antiserum and anti-TLR5 antibody (raised against amino acids 154-280 of human TLR5) were used to block function. Incubation of purified flagellin with flagellin antiserum or HUCL cells with anti-TLR5 antibody for 30 minutes before 250 ng/mL flagellin challenge resulted in inhibition of flagellin-induced I{kappa}B-{alpha} phosphorylation and degradation, whereas the control normal rabbit serum or purified rabbit IgG exhibited no effects (Fig. 7) .



View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 7. Requirement of flagellin-TLR5 interaction for flagellin-induced NF-{kappa}B activation. (A) Antiserum to flagellin inhibits flagellin-induced NF-{kappa}B activation. Purified flagellin (250 ng/mL) in KBM was incubated with 1:1000 diluted normal rabbit serum (lane 3) or flagellum antiserum (lane 4) at room temperature for 30 minutes and then used to treat HUCL cells (lane 1, no stimulation; lane 2, flagellin alone to stimulate cells). (B) TLR5 antibody attenuated flagellin-induced NF-{kappa}B activation. HUCL cells were treated with 10 µg/mL purified rabbit IgG (lane 3) or TLR5 antibody (lane 4) for 30 minutes and then challenged with 250 ng/mL flagellin (lane 1, no stimulation; lane 2, stimulation with flagellin alone). After 30 minutes in culture, total protein was extracted, and 40 µg of protein was subjected to SDS-PAGE, followed by Western blot analysis with I{kappa}B-{alpha} and phospho-I{kappa}B-{alpha} antibodies. Results are representative of three independent experiments.

 
Similarly, flagellin antiserum or TLR5 antibody also significantly inhibited the flagellin-induced secretion of IL-6 and -8 from HUCL cells. As shown in Figure 8 , compared with normal rabbit serum treatment, preincubation of flagellin with flagellin antiserum (1:1000 dilution) decreased flagellin-induced IL-6 accumulation in culture medium by 38% and IL-8 by 65% (P < 0.001). Preincubation of HUCL cells with TLR5 antibody (10 µg/mL), compared with preincubation with equivalent amounts of rabbit IgG, resulted in 42% and 40% reduction of flagellin-induced release of IL-6 and -8 release, respectively, in 4 hours. These data indicate that upregulation of IL-6 and -8 in HCE cells depends on a flagellin-TLR5 interaction.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 8. Requirement of flagellin-TLR5 interaction for flagellin-induced IL-6 and -8 production. Flagellin and HUCL cells were pretreated as described in Figure 7 . HUCL cell culture media were collected 4 hours after flagellin challenge, and released IL-6 (A) and IL-8 (B) were measured by ELISA. The data shown are representative of triplicate experiments. All values are expressed as mean ± SD. Statistical analysis was performed with ANOVA, and each pair showed a significant difference in IL-6 and -8 secretion in flagellin-treated HUCL cells (P < 0.001).

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In this study, the flagellin in PA had the ability to signal the NF-{kappa}B system in HCE cells by inducing phosphorylation and degradation of I{kappa}B-{alpha} and expression and secretion of proinflammatory cytokines IL-6 and -8. The concentration of purified flagellin used (250 ng/mL) to elicit the in vitro corneal epithelial response was several times lower than the concentration of free flagellin circulating in the blood of septic rats (~1000 ng/mL),7 suggesting that the effects of flagellin on corneal epithelial cells are physiologically relevant. Furthermore, we demonstrated that corneal epithelial cells express TLR5, an innate immunity receptor of flagellin and that TLR5 is able to recognize flagellin and subsequently elicit inflammatory responses. Thus, our data indicate that flagellin, through its receptor TLR5, may play a role in causing innate immune responses in epithelium and subsequent inflammation in corneal diseases such as Gram-negative bacterial keratitis.

Early studies revealed that flagella play an important role in corneal infection as adhesions.5 Flagellins, structural components of flagellated bacteria, from different Gram-negative bacteria share homology in two regions.33 34 Thus, flagellin provides a pattern that can be recognized by host cells. Indeed, cells of species ranging from mammals to plants can generate a defense response when challenged with flagellin.13 35 Our studies revealed that corneal epithelial cells also respond to flagellin challenge and initiate a rapid innate immune response by the activation of NF-{kappa}B and the production of proinflammatory cytokines and chemokines such as IL-6 and -8.36 37 38 Although the inflammatory response is necessary to clear the organism from the infected tissue, it may also be destructive to the host corneas, leading to corneal scarring, melting, and blindness.4 36 39 Thus, blocking flagellin’s effects on epithelial cells should be part of a therapeutic strategy for preventing some of the destructive consequences of ocular, Gram-negative infections.

The eye is relatively impermeable to microorganisms.4 39 40 However, if corneal integrity is breached by trauma or contact lens wear, a sight-threatening bacterial infection may occur.41 42 Corneal epithelial cells constitute the first line of defense against microbial pathogens and, therefore, must possess the ability to sense the presence of pathogenic bacteria. The evolutionarily conserved TLRs play a key role in recognition of conserved microbial molecular patterns, thus activating the innate immune responses.16 18 Recently recorded data have shown that bacterial flagellin is the ligand for TLR5, not only in cells of the myeloid lineage, but also in epithelial cells at mucosal surfaces.6 8 13 43 In the cornea, we observed that epithelia express TLR5, as assessed by immunohistochemistry and immunoblotting, and that TLR5 recognizes PA flagellin and elicits an epithelial response through activation of the NF-{kappa}B signaling pathway. Thus, as has been proposed for other epithelial cells, TLR5 is the innate receptor for flagellin and can function as a Gram-negative bacterial sensor in the cornea, recognizing the presence of bacteria or bacterial products and mediating corneal innate immune responses that result in the clearing of pathogen by corneal host mechanisms.

Corneal epithelial cells are in the unique position of being in constant contact with bacteria and bacterial products.39 Those factors that are normally proinflammatory for other cell types do not induce epithelial cells to initiate a defensive response.6 The refractory nature of epithelial cells to bacteria or bacterial products is important, because mounting an inflammatory response to the presence of nonpathogenic bacteria would indeed be detrimental to the host. This is true even more so of the avascular and transparent cornea, where formation of scar tissue due to a host inflammatory reaction results in loss of vision.4 44 Thus, the ability to discriminate between pathogenic and nonpathogenic bacteria is extremely important for corneal epithelial cells. A recent study reported that flagellin promotes inflammation only if it crosses the intestinal epithelial and contacts the basolateral membrane.14 Furthermore, TLR5 has been found to be expressed exclusively on the basolateral surface of intestinal epithelia,8 thus providing a molecular mechanism by which epithelial cells discriminate between pathogens and nonpathogens. However, using the same approach,8 we found that TLR5 can be labeled from both apical and basal sides of HCE cells cultured on cell migration assay filters (Costar Transwell; Corning), suggesting that TLR5 is not restricted to the basolateral surface of corneal epithelium. Consistent with this in vitro labeling, we observed TLR5 staining at the entire surface of basal and wing cell layers of human corneal epithelium. However, no TLR5 staining was observed in the apical layers of stratified corneal epithelium. Thus, the presence of flagellin receptors only in internal cell layers of stratified epithelium would maintain the epithelium, which is in contact with bacteria or bacterial products at the apical surface, in a refractory state. Either bacterial entry into epithelium or breach of the epithelial barrier leads to exposure of the TLR5 to bacteria or bacterial products that can then trigger recognition systems, which initiate a defensive response by the cornea, including the synthesis of defensins (Yu et al., unpublished results, 2003) and production of proinflammatory cytokines and chemokines such as IL-6 and -8.

In summary, our studies and others examining TLR425 26 27 suggest that corneal epithelial cells can recognize multiple Gram-negative bacterial components and initiate innate immune responses that result in clearing of pathogen and, potentially, an excessive inflammatory response that results in corneal scarring and loss of vision. Understanding the molecular events of bacterial-epithelial interactions and the inflammatory consequences of TLR activation may permit the development of novel, specific therapies that can promote innate defense and prevent some of the destructive consequences of ocular Gram-negative infections.


    Footnotes
 
Supported by National Eye Institute Grants EY14080 and EY10869.

Submitted for publication March 4, 2003; revised June 23, 2003; accepted June 25, 2003.

Disclosure: J. Zhang, None; K. Xu, None; B. Ambati, None; F.-S.X. Yu, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Fu-Shin X. Yu, Department of Cellular Biology and Anatomy, Medical College of Georgia, 1459 Laney-Walker Boulevard, CB2916, Augusta, GA 30912; fyu{at}mail.mcg.edu.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cohen, E, Laibson, P, Arentsen, J, Clemons, C. (1987) Corneal ulcers associated with cosmetic extended wear soft contact lenses Ophthalmology 94,109-114[Medline][Order article via Infotrieve]
  2. Ogawa, G, Hyndiuk, R. (1994) Bacterial keratitis and conjunctivitis Smolin, G Thoft, R eds. The Cornea ,125-167 Little, Brown Boston.
  3. Lyczak, JB, Cannon, CL, Pier, GB. (2000) Establishment of Pseudomonas aeruginosa infection: lessons from a versatile opportunist Microbes Infect 2,1051-1060[CrossRef][Medline][Order article via Infotrieve]
  4. Kurpakus-Wheater, M, Kernacki, KA, Hazlett, LD. (2001) Maintaining corneal integrity how the "window" stays clear Prog Histochem Cytochem 36,185-259[Medline][Order article via Infotrieve]
  5. Fleiszig, S, Arora, S, Van, R, Ramphal, R. (2001) FlhA, a component of the flagellum assembly apparatus of Pseudomonas aeruginosa, plays a role in internalization by corneal epithelial cells Infect Immun 69,4931-4937[Abstract/Free Full Text]
  6. Philpott, DJ, Girardin, SE, Sansonetti, PJ. (2001) Innate immune responses of epithelial cells following infection with bacterial pathogens Curr Opin Immunol 13,410-416[CrossRef][Medline][Order article via Infotrieve]
  7. Eaves-Pyles, T, Murthy, K, Liaudet, L, et al (2001) Flagellin, a novel mediator of Salmonella-induced epithelial activation and systemic inflammation: I kappa B alpha degradation, induction of nitric oxide synthase, induction of proinflammatory mediators, and cardiovascular dysfunction J Immunol 166,1248-1260[Abstract/Free Full Text]
  8. Gewirtz, AT, Navas, TA, Lyons, S, Godowski, PJ, Madara, JL. (2001) Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression J Immunol 167,1882-1885[Abstract/Free Full Text]
  9. DiMango, E, Zar, HJ, Bryan, R, Prince, A. (1995) Diverse Pseudomonas aeruginosa gene products stimulate respiratory epithelial cells to produce interleukin-8 J Clin Invest 96,2204-2210
  10. Feldman, M, Bryan, R, Rajan, S, et al (1998) Role of Flagella in pathogenesis of Pseudomonas aeruginosa pulmonary infection Infect Immun 66,43-51[Abstract/Free Full Text]
  11. Ramphal, R, Arora, SK, Ritchings, BW. (1996) Recognition of mucin by the adhesin-flagellar system of Pseudomonas aeruginosa Am J Respir Crit Care Med 154,S170-S174
  12. Steiner, TS, Nataro, JP, Poteet-Smith, CE, Smith, JA, Guerrant, RL. (2000) Enteroaggregative Escherichia coli expresses a novel flagellin that causes IL-8 release from intestinal epithelial cells J Clin Invest 105,1769-1777[Medline][Order article via Infotrieve]
  13. Hayashi, F, Smith, KD, Ozinsky, A, et al () The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5 Nature 410,1099-1103
  14. Gewirtz, AT, Simon, PO, Jr, Schmitt, CK, et al (2001) Salmonella typhimurium translocates flagellin across intestinal epithelia, inducing a proinflammatory response J Clin Invest 107,99-109[Medline][Order article via Infotrieve]
  15. Sierro, F, Dubois, B, Coste, A, Kaiserlian, D, Kraehenbuhl, JP, Sirard, JC. () Flagellin stimulation of intestinal epithelial cells triggers CCL20-mediated migration of dendritic cells Proc Natl Acad Sci USA 98,13722-13727
  16. Medzhitov, R. (2001) Toll-like receptors and innate immunity Nat Rev Immunol 1,135-145[CrossRef][Medline][Order article via Infotrieve]
  17. Medzhitov, R, Janeway, C, Jr (2000) Innate immunity N Engl J Med 343,338-344[Free Full Text]
  18. Janeway, CA, Jr, Medzhitov, R. (2002) Innate immune recognition Annu Rev Immunol 20,197-216[CrossRef][Medline][Order article via Infotrieve]
  19. Medvedev, AE, Kopydlowski, KM, Vogel, SN. (2000) Inhibition of lipopolysaccharide-induced signal transduction in endotoxin-tolerized mouse macrophages: dysregulation of cytokine, chemokine, and toll-like receptor 2 and 4 gene expression J Immunol 164,5564-5574[Abstract/Free Full Text]
  20. Akira, S, Takeda, K, Kaisho, T. (2001) Toll-like receptors: critical proteins linking innate and acquired immunity Nat Immunol 2,675-680[CrossRef][Medline][Order article via Infotrieve]
  21. Alexopoulou, L, Holt, AC, Medzhitov, R, Flavell, RA. (2001) Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3 Nature 413,732-738[CrossRef][Medline][Order article via Infotrieve]
  22. Chow, JC, Young, DW, Golenbock, DT, Christ, WJ, Gusovsky, F. (1999) Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction J Biol Chem 274,10689-106892[Abstract/Free Full Text]
  23. Kawasaki, K, Akashi, S, Shimazu, R, Yoshida, T, Miyake, K, Nishijima, M. (2000) Mouse toll-like receptor 4. MD-2 complex mediates lipopolysaccharide-mimetic signal transduction by Taxol J Biol Chem 275,2251-2254[Abstract/Free Full Text]
  24. Hemmi, H, Takeuchi, O, Kawai, T, et al (2000) A toll-like receptor recognizes bacterial DNA Nature 408,740-745[CrossRef][Medline][Order article via Infotrieve]
  25. Khatri, S, Lass, JH, Heinzel, FP, et al (2002) Regulation of endotoxin-induced keratitis by PECAM-1, MIP-2, and toll-like receptor 4 Invest Ophthalmol Vis Sci 43,2278-2284[Abstract/Free Full Text]
  26. Saint Andre, A, Blackwell, NM, Hall, LR, et al (2002) The role of endosymbiotic Wolbachia bacteria in the pathogenesis of river blindness Science 295,1892-1895[Abstract/Free Full Text]
  27. Song, PI, Abraham, TA, Park, Y, et al (2001) The expression of functional LPS receptor proteins CD14 and toll-like receptor 4 in human corneal cells Invest Ophthalmol Vis Sci 42,2867-2877[Abstract/Free Full Text]
  28. Brett, P, Mah, D, Woods, D. (1994) Isolation and characterization of Pseudomonas pseudomallei flagellin proteins Infect Immun 62,1914-1919[Abstract/Free Full Text]
  29. Rudner, XL, Berk, RS, Hazlett, LD. (1993) Immunization with homologous Pseudomonas aeruginosa pili protects against ocular disease Reg Immunol 5,245-252[Medline][Order article via Infotrieve]
  30. Rheinwald, JG, Hahn, WC, Ramsey, MR, et al (2002) A two-stage, p16(INK4A)- and p53-dependent keratinocyte senescence mechanism that limits replicative potential independent of telomere status Mol Cell Biol 22,5157-5172[Abstract/Free Full Text]
  31. Garrett, ES, Perlegas, D, Wozniak, DJ. (1999) Negative control of flagellum synthesis in Pseudomonas aeruginosa is modulated by the alternative sigma factor AlgT (AlgU) J Bacteriol 181,7401-7404[Abstract/Free Full Text]
  32. Yi, X, Wang, Y, Yu, FS. (2000) Corneal epithelial tight junctions and their response to lipopolysaccharide challenge Invest Ophthalmol Vis Sci 41,4093-4100[Abstract/Free Full Text]
  33. Samatey, FA, Imada, K, Nagashima, S, et al (2001) Structure of the bacterial flagellar protofilament and implications for a switch for supercoiling Nature 410,331-337[CrossRef][Medline][Order article via Infotrieve]
  34. Donnelly, MA, Steiner, TS. (2002) Two nonadjacent regions in enteroaggregative Escherichia coli flagellin are required for activation of toll-like receptor 5 J Biol Chem 277,40456-40461[Abstract/Free Full Text]
  35. Gomez-Gomez, L, Bauer, Z, Boller, T. (2001) Both the extracellular leucine-rich repeat domain and the kinase activity of FSL2 are required for flagellin binding and signaling in Arabidopsis Plant Cell 13,1155-1163[Abstract/Free Full Text]
  36. Cole, N, Krockenberger, M, Bao, S, Beagley, KW, Husband, AJ, Willcox, M. (2001) Effects of exogenous interleukin-6 during Pseudomonas aeruginosa corneal infection Infect Immun 69,4116-4119[Abstract/Free Full Text]
  37. Hobden, JA, Masinick, SA, Barrett, RP, Hazlett, LD. (1997) Proinflammatory cytokine deficiency and pathogenesis of Pseudomonas aeruginosa keratitis in aged mice Infect Immun 65,2754-2758[Abstract]
  38. Rosenbaum, J, Planck, S, Huang, X, Rich, L, Ansel, J. (1995) Detection of mRNA for the cytokines, interleukin-1 alpha and interleukin-8, in corneas from patients with pseudophakic bullous keratopathy Invest Ophthalmol Vis Sci 36,2151-2155[Abstract/Free Full Text]
  39. Williams, JM, Fini, ME, Cousins, SW, Repose, JS. (1997) Corneal responses to infection Krachmer, JH Mannis, MJ Holland, EJ eds. Cornea ,128-162 Mosby St. Louis.
  40. Gipson, I, Sugrue, S. (1994) Cell biology of the corneal epithelium Albert, D Jakobiec, F eds. Principles and Practice of Ophthalmology ,3-16 WB Saunders Philadelphia.
  41. Stapleton, F, Dart, JK, Seal, DV, Matheson, M. (1995) Epidemiology of Pseudomonas aeruginosa keratitis in contact lens wearers Epidemiol Infect 114,395-402[Medline][Order article via Infotrieve]
  42. Schein, OD, Glynn, RJ, Poggio, EC, Seddon, JM, Kenyon, KR. (1989) The relative risk of ulcerative keratitis among users of daily-wear and extended-wear soft contact lenses. a case-control study N Engl J Med 321,773-778[Abstract]
  43. Cario, E, Podolsky, DK. (2000) Differential alteration in intestinal epithelial cell expression of toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease Infect Immun 68,7010-7017[Abstract/Free Full Text]
  44. Laibson, PR. (1972) Cornea and sclera Arch Ophthalmol 88,553-574[Free Full Text]



This article has been cited by other articles:


Home page
Innate ImmunityHome page
Jie Zhao, X.-y. Wu, and F.-S. X. Yu
Activation of Toll-like receptors 2 and 4 in Aspergillus fumigatus keratitis
Innate Immunity, June 1, 2009; 15(3): 155 - 168.
[Abstract] [PDF]


Home page
IOVSHome page
Y. Sun and E. Pearlman
Inhibition of Corneal Inflammation by the TLR4 Antagonist Eritoran Tetrasodium (E5564)
Invest. Ophthalmol. Vis. Sci., March 1, 2009; 50(3): 1247 - 1254.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. R. Chinnery, E. C. Carlson, Y. Sun, M. Lin, S. H. Burnett, V. L. Perez, P. G. McMenamin, and E. Pearlman
Bone Marrow Chimeras and c-fms Conditional Ablation (Mafia) Mice Reveal an Essential Role for Resident Myeloid Cells in Lipopolysaccharide/TLR4-Induced Corneal Inflammation
J. Immunol., March 1, 2009; 182(5): 2738 - 2744.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Ophthalmol.Home page
K Kojima, M Ueta, J Hamuro, Y Hozono, S Kawasaki, N Yokoi, and S Kinoshita
Human conjunctival epithelial cells express functional Toll-like receptor 5
Br. J. Ophthalmol., March 1, 2008; 92(3): 411 - 416.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. C. Johnson, X. Li, and E. Pearlman
MyD88 Functions as a Negative Regulator of TLR3/TRIF-induced Corneal Inflammation by Inhibiting Activation of c-Jun N-terminal Kinase
J. Biol. Chem., February 15, 2008; 283(7): 3988 - 3996.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Kumar, L. D. Hazlett, and F.-S. X. Yu
Flagellin Suppresses the Inflammatory Response and Enhances Bacterial Clearance in a Murine Model of Pseudomonas aeruginosa Keratitis
Infect. Immun., January 1, 2008; 76(1): 89 - 96.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
X. Huang, W. Du, R. P. Barrett, and L. D. Hazlett
ST2 Is Essential for Th2 Responsiveness and Resistance to Pseudomonas aeruginosa Keratitis
Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4626 - 4633.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Kumar, J. Yin, J. Zhang, and F.-S. X. Yu
Modulation of Corneal Epithelial Innate Immune Response to Pseudomonas Infection by Flagellin Pretreatment
Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4664 - 4670.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
N. Ebihara, S. Yamagami, L. Chen, T. Tokura, M. Iwatsu, H. Ushio, and A. Murakami
Expression and Function of Toll-like Receptor-3 and -9 in Human Corneal Myofibroblasts
Invest. Ophthalmol. Vis. Sci., July 1, 2007; 48(7): 3069 - 3076.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
C. Soscia, A. Hachani, A. Bernadac, A. Filloux, and S. Bleves
Cross Talk between Type III Secretion and Flagellar Assembly Systems in Pseudomonas aeruginosa
J. Bacteriol., April 15, 2007; 189(8): 3124 - 3132.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
J. W. Du, F. Zhang, J. E. Capo-Aponte, S. D. Tachado, J. Zhang, F.-S. X. Yu, R. A. Sack, H. Koziel, and P. S. Reinach
AsialoGM1-Mediated IL-8 Release by Human Corneal Epithelial Cells Requires Coexpression of TLR5
Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 4810 - 4818.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
X. Huang, W. Du, S. A. McClellan, R. P. Barrett, and L. D. Hazlett
TLR4 Is Required for Host Resistance in Pseudomonas aeruginosa Keratitis
Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 4910 - 4916.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
Y. Sun, A. G. Hise, C. M. Kalsow, and E. Pearlman
Staphylococcus aureus-Induced Corneal Inflammation Is Dependent on Toll-Like Receptor 2 and Myeloid Differentiation Factor 88
Infect. Immun., September 1, 2006; 74(9): 5325 - 5332.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. Verma, M. Schirm, S. K. Arora, P. Thibault, S. M. Logan, and R. Ramphal
Glycosylation of b-Type Flagellin of Pseudomonas aeruginosa: Structural and Genetic Basis.
J. Bacteriol., June 1, 2006; 188(12): 4395 - 4403.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
F.-S. X. Yu and L. D. Hazlett
Toll-like Receptors and the Eye.
Invest. Ophthalmol. Vis. Sci., April 1, 2006; 47(4): 1255 - 1263.
[Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
R. Sharma, S. Tesfay, F. L. Tomson, R. P. Kanteti, V. K. Viswanathan, and G. Hecht
Balance of bacterial pro- and anti-inflammatory mediators dictates net effect of enteropathogenic Escherichia coli on intestinal epithelial cells
Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G685 - G694.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Tseng, J. Do, J. H. Widdicombe, and T. E. Machen
Innate immune responses of human tracheal epithelium to Pseudomonas aeruginosa flagellin, TNF-{alpha}, and IL-1beta
Am J Physiol Cell Physiol, March 1, 2006; 290(3): C678 - C690.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Ophthalmol.Home page
J H Chang, P J McCluskey, and D Wakefield
Toll-like receptors in ocular immunity and the immunopathogenesis of inflammatory eye disease
Br. J. Ophthalmol., January 1, 2006; 90(1): 103 - 108.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. H. Travassos, L. A. M. Carneiro, S. E. Girardin, I. G. Boneca, R. Lemos, M. T. Bozza, R. C. P. Domingues, A. J. Coyle, J. Bertin, D. J. Philpott, et al.
Nod1 Participates in the Innate Immune Response to Pseudomonas aeruginosa
J. Biol. Chem., November 4, 2005; 280(44): 36714 - 36718.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. C. Lane, V. Lockatell, G. Monterosso, D. Lamphier, J. Weinert, J. R. Hebel, D. E. Johnson, and H. L. T. Mobley
Role of Motility in the Colonization of Uropathogenic Escherichia coli in the Urinary Tract
Infect. Immun., November 1, 2005; 73(11): 7644 - 7656.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
X. Huang, R. P. Barrett, S. A. McClellan, and L. D. Hazlett
Silencing Toll-like Receptor-9 in Pseudomonas aeruginosa Keratitis
Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4209 - 4216.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
D. R. Blais, S. G. Vascotto, M. Griffith, and I. Altosaar
LBP and CD14 Secreted in Tears by the Lacrimal Glands Modulate the LPS Response of Corneal Epithelial Cells
Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4235 - 4244.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
T.-H. Ueng, C.-C. Hung, M.-L. Kuo, P.-K. Chan, S.-H. Hu, P.-C. Yang, and L. W. Chang
Induction of Fibroblast Growth Factor-9 and Interleukin-1{alpha} Gene Expression by Motorcycle Exhaust Particulate Extracts and Benzo(a)pyrene in Human Lung Adenocarcinoma Cells
Toxicol. Sci., October 1, 2005; 87(2): 483 - 496.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Ramphal, V. Balloy, M. Huerre, M. Si-Tahar, and M. Chignard
TLRs 2 and 4 Are Not Involved in Hypersusceptibility to Acute Pseudomonas aeruginosa Lung Infections
J. Immunol., September 15, 2005; 175(6): 3927 - 3934.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Ophthalmol.Home page
S Rodriguez-Martinez, M E Cancino-Diaz, L Jimenez-Zamudio, E Garcia-Latorre, and J C Cancino-Diaz
TLRs and NODs mRNA expression pattern in healthy mouse eye
Br. J. Ophthalmol., July 1, 2005; 89(7): 904 - 910.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
C. Winstanley, S. B Kaye, T. J Neal, H. J Chilton, S. Miksch, C A. Hart, and and the Microbiology Ophthalmic Group
Genotypic and phenotypic characteristics of Pseudomonas aeruginosa isolates associated with ulcerative keratitis
J. Med. Microbiol., June 1, 2005; 54(6): 519 - 526.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. S. Miller, O. E. Sorensen, P. T. Liu, H. R. Jalian, D. Eshtiaghpour, B. E. Behmanesh, W. Chung, T. D. Starner, J. Kim, P. A. Sieling, et al.
TGF-{alpha} Regulates TLR Expression and Function on Epidermal Keratinocytes
J. Immunol., May 15, 2005; 174(10): 6137 - 6143.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. P. West, B. A. Dancho, and S. B. Mizel
Gangliosides Inhibit Flagellin Signaling in the Absence of an Effect on Flagellin Binding to Toll-like Receptor 5
J. Biol. Chem., March 11, 2005; 280(10): 9482 - 9488.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. Ueta, J. Hamuro, M. Yamamoto, K. Kaseda, S. Akira, and S. Kinoshita
Spontaneous Ocular Surface Inflammation and Goblet Cell Disappearance in I{kappa}B{zeta} Gene-Disrupted Mice
Invest. Ophthalmol. Vis. Sci., February 1, 2005; 46(2): 579 - 588.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. C. Johnson, F. P. Heinzel, E. Diaconu, Y. Sun, A. G. Hise, D. Golenbock, J. H. Lass, and E. Pearlman
Activation of Toll-Like Receptor (TLR)2, TLR4, and TLR9 in the Mammalian Cornea Induces MyD88-Dependent Corneal Inflammation
Invest. Ophthalmol. Vis. Sci., February 1, 2005; 46(2): 589 - 595.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. R. Power, Y. Peng, E. Maydanski, J. S. Marshall, and T.-J. Lin
The Development of Early Host Response to Pseudomonas aeruginosa Lung Infection Is Critically Dependent on Myeloid Differentiation Factor 88 in Mice
J. Biol. Chem., November 19, 2004; 279(47): 49315 - 49322.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Kumar, J. Zhang, and F.-S. X. Yu
Innate Immune Response of Corneal Epithelial Cells to Staphylococcus aureus Infection: Role of Peptidoglycan in Stimulating Proinflammatory Cytokine Secretion
Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3513 - 3522.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. A. Urban, A. Griffith, A. M. Torok, M. E. Smolkin, J. L. Burns, and J. B. Goldberg
Contribution of Burkholderia cenocepacia Flagella to Infectivity and Inflammation
Infect. Immun., September 1, 2004; 72(9): 5126 - 5134.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
J. Zhang, H. Li, J. Wang, Z. Dong, S. Mian, and F.-S. X. Yu
Role of EGFR Transactivation in Preventing Apoptosis in Pseudomonas aeruginosa-Infected Human Corneal Epithelial Cells
Invest. Ophthalmol. Vis. Sci., August 1, 2004; 45(8): 2569 - 2576.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, J.
Right arrow Articles by Yu, F.-S. X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, J.
Right arrow Articles by Yu, F.-S. X.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS