|
|
||||||||
From the Department of Ophthalmology, University of Alabama at Birmingham, Birmingham, Alabama.
| Abstract |
|---|
|
|
|---|
METHODS. Müller cells were isolated from papain-DNasedigested human retina. Cell identity and changes in cell phenotype were confirmed by immunodetection of glial fibrillary acidic protein (GFAP), cellular retinaldehyde-binding protein (CRALBP), vimentin, and
-smooth muscle actin (
-SMA). Generation of tractional force was assessed with a tissue culture assay involving incubation of cells on three-dimensional collagen gels. The effects of contraction-promoting growth factors were examined by adding these directly to the culture medium. Müller cell expression and the involvement of specific integrin receptors were assessed by immunodetection, RT-PCR, and subunit-specific blocking antibodies.
RESULTS. During maintenance in culture, human Müller cells adopted a fibroblast-like phenotype capable of generating tractional forces. Matrix contraction was stimulated in a dose-dependent fashion by insulin-like growth factor I and platelet-derived growth factor. Modest responses were observed with high concentrations of transforming growth factor (TGF)-ß1 and -ß2. Müller cells express all four integrin subunits that comprise the collagen-binding receptors including
1,
2,
3, and ß1. Blocking antibodies against receptor subunits
2 and ß1 significantly reduced the overall rate of matrix contraction. Antibodies against the
1 subunit were modestly inhibitory, whereas anti-
3 was without effect.
CONCLUSIONS. Human Müller cells acquire the capacity to generate tractional forces in vitro and the contraction-promoting growth factors insulin-like growth factor (IGF)-I and platelet-derived growth factor (PDGF) are potent stimuli. Generation of tractional force by Müller cells primarily involves integrin receptors containing
2 and ß1 subunits.
Tissue culture studies performed with Müller cells harvested from porcine retina demonstrated that cell phenotype varies dramatically after isolation and introduction into culture. Changes include cell morphology, proliferation, loss of certain constitutively expressed proteins, and acquisition of myoid markers yielding a phenotype that superficially resembles fibroblasts.16 Most interesting, the fibroblast-like phenotype possesses the ability to generate tractional forces in response to members of the insulin-like growth factor (IGF) and platelet-derived growth factor (PDGF) families.17 Subsequent studies revealed that vitreous contraction-promoting activity attributable to IGF-I and PDGF-related species increases in human proliferative vitreoretinal disorders, thus extending the evidence for a Müller cell role in fibroproliferative diseases.18
Although compelling, the evidence for Müller cell involvement in human fibroproliferative diseases is still primarily circumstantial. To date, the capacity of Müller cells to generate tractional forces has been systematically demonstrated in cells isolated from juvenile porcine retina, the relevance of which to human cell biology is uncertain.17 The only study of human Müller-cellgenerated tractional forces to date reported modest responses stimulated by exposure to TGFß2 and did not examine the relative effects of IGF-I or PDGF.19 Porcine Müller cells, in contrast, are minimally responsive to TGFß1 and -ß2, suggesting that there may be important species-related differences in growth factor sensitivities.17 If so, this would significantly influence the conclusions drawn regarding IGF-I and PDGF biological activity in human vitreoretinal disease and redirect emphasis toward TGFß species as the causative factors. With this in mind, several important questions remain unanswered that should be addressed directly. Are there significant age- or species-related differences between human and porcine Müller cell contraction potentials that might influence the perceived role of these cells in fibrocontractive disorders? If capable of generating tractional force, do human Müller cells respond differently from porcine cells to the contraction-promoting growth factors?
Another question not previously investigated in Müller cell biology is the involvement of the three collagen-binding integrin receptors in tractional force generation.20 In classic studies performed with dermal fibroblasts, it was determined that the
2ß1 heterodimer is the only collagen-binding integrinessential to collagen matrix contraction and included the tacit assumption that this relationship would be consistent among contraction-capable cell types.21 22 However, recent studies with cells of other origins have yielded variable results that place increasing emphasis on the
1ß1 heterodimer and undermine confidence about the presumed role of the
2ß1 in the Müller cell generation of tractional force.23 24 25 26 Studies of the other collagen-binding integrins suggest that these receptors are not merely redundant but mediate different downstream events and use different cytoplasmic signal-transduction pathways to accomplish these effects.27 28 29 Identification of the functional, and thus target, integrin receptor is essential for studies of growth-factorinduced signal transduction pathways leading to Müller cell generation of tractional force.
The goal of this study was to extend the available evidence for or against human Müller cells as a causative element in traction retinal detachment. To accomplish this, Müller cells were isolated from human retina, introduced into culture, and examined systematically for changes in cell phenotype. The capacity of human Müller cells to generate tractional forces and their responses to growth factors were examined in tissue culture assays involving incubation on three-dimensional collagen gels. Müller cells were examined for expression of the relevant integrin receptor subunits, and experiments were performed with subunit-specific blocking antibodies to determine the involvement of these in generation of tractional force.
| Methods |
|---|
|
|
|---|
Immunofluorescence Microscopy
Cells attached to coverslips were rinsed and fixed in 2% paraformaldehyde in 0.1 M phosphate buffer at pH 7.0 for 60 minutes at room temperature. The coverslips were permeabilized by a 10-minute treatment with 0.1% Triton X-100 in phosphate-buffered saline (PBS; 0.01 M Na2HPO4, 0.15 M NaCl; pH 7.4). In experiments to localize integrin subunits, fixation was with 95% ethanol and 5% acetic acid for 5 minutes at -20°C without subsequent permeabilization. All coverslips were blocked for 60 minutes with 20% serum from the same species as the secondary antibody in PBS. Cells were treated with primary and secondary antibodies in PBS with 2% serum for 60 minutes each with three 5-minute washes between and after antibody treatments. Photomicrographs were taken with a microscope (Optiphot; Nikon, Tokyo, Japan) equipped with epifluorescence illumination and phase-contrast optics, using a 35-mm camera (Delta 100 and 400 film; Ilford, Cheshire, UK). Images were scanned from negatives (SprintScan 4000; Polaroid, Cambridge, MA) and assembled into composite photomicrographs (Photodeluxe; Adobe, San Jose, CA).
Contraction Assays
Collagen gels were prepared from native type I collagen isolated from rat tail tendons by limited pepsin digestion and sequential salt precipitation.30 Acid-soluble collagen dissolved in 12 mM HCl was adjusted to physiologic pH and ionic strength using 10x PBS (0.1 M Na2HPO4, 1.5 M NaCl) and 0.1 M NaOH, while maintained on ice. Aliquots (0.2 mL) of the collagen solution were added to circular scores on the bottom of 24-well tissue culture plates and incubated at 37°C for 90 minutes to allow the gels to polymerize. Cells harvested with trypsin and EDTA as for subculture were washed with growth medium to inactivate the trypsin and again with contraction medium composed of DMEM with reduced sodium bicarbonate (2.7 g/L) and 1 mg/mL crystalline BSA (A-7511; Sigma, St. Louis, MO). Aliquots of cells (50 µL) suspended in contraction medium at 200,000 cells per milliliter were applied to the gel surface and then incubated at 37°C to permit cell adhesion. The wells are then flooded with an additional 0.75 mL of contraction medium containing test substances. The initial thickness of each gel was measured with an inverted, phase-contrast microscope equipped with a z-axis digitizer (LaSico, Los Angeles, CA) by adjusting the plane of focus from the surface of the culture vessel to the cell layer. This measurement provided the initial gel thickness against which all subsequent measurements were compared. The subsequent gel thickness was divided by the initial gel thickness, multiplied by 100, and then subtracted from 100 to yield the percentage reduction in gel thickness, reported as percentage contraction. Repeated measurements of this type indicate that these values are reproducible to 1.25% of the original gel thickness.31 Differences between experimental and control samples were compared by paired Students t-test.
RT-PCR Reactions
RNA was isolated from actively growing cultures of human Müller cells and human dermal fibroblasts, with an extraction reagent used according to the manufacturers instructions (TRIzol; Life Technologies, Grand Island, NY). Integrin subunit-specific primers were designed using the GeneFisher program (available at www.genefisher.de)32 and human sequence data available from the National Center for Biotechnology Information (Bethesda, MD). This included accession numbers XM032902 for
1, XM003913 for
2, XM008432 for
3, and NM002211 for ß1. The resultant primers and predicted product sizes were:
1, forward (f)CTCCAGACGCTCAGTGGA, reverse (r)TCTGTCAGACCGTCACCA, 518 base pairs;
2, fCCTTCAAGTGAACAGTTTGG, rTTGCTCCGAATGTGTTTGTG, 640 base pairs;
3, fACGAAGTCAGCAATGGCAAG, rCAGCCACAGCTCGATTTCG, 518 base pairs; and ß1, fGGGTTTCACTTTGCTGGA, rCCTCCGTAAAGCCCAGA, 517 base pairs.
RT-PCR reactions were performed with 1 µg total RNA, 20 pM each primer and commercial RT-PCR reagents (Ready-To-Go, Amersham Pharmacia Biotech, Piscataway, NJ). Reaction programs using a minicycler (PTC-150; MJ Research, Watertown, MA) included (1) a reverse transcription program of 20 minutes at 42°C and 5 minutes at 95°C; (2) 35 cycles of 1 minute at 95°C, 45 seconds at the appropriate annealing temperature, and 45 seconds at 72°C; and (3) 5 minutes at 72°C. For negative control reactions, reverse transcriptase was inactivated at 95°C for 10 minutes before addition of the primer and template. PCR products were separated on 2% agarose gels, visualized with ethidium bromide and photodocumented (Polaroid camera; fitted with a Tiffen 40.5 mm Deep Yellow 15 filter; FisherBiotech, Pittsburgh, PA).
Reagents
Tissue culture media and sera were obtained from Life Technologies (Rockville, MD). Recombinant human growth factors obtained from commercial suppliers included IGF-I (Upstate Biotechnology, Lake Placid, NY), PDGF-AB (Upstate Biotechnology), and TGFß1 and -ß2 (R&D Systems, Minneapolis, MN). Antibodies obtained from commercial suppliers included rabbit anti-GFAP (Dako, Glostrup, Denmark), mouse anti-
SMA (clone 1A4, Sigma Chemical Co.), anti-integrin
1 (clone 5E8D9, Upstate Biotechnology), anti-integrin
2 (clone A2-IIE10; Upstate Biotechnology), anti-integrin
3 (clone P1B5; Life Technologies), anti-integrin ß1 (clone DE9, Upstate Biotechnology), rhodamine-conjugated donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories, West Grove, PA), and rhodamine-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories). Rabbit anti-CRALBP was a generous gift from John Saari (University of Washington School of Medicine, Seattle, WA). Normal goat and donkey sera were obtained from The Binding Site, Ltd. (Birmingham, UK). Other chemicals and reagents were obtained from Sigma Chemical Co.
| Results |
|---|
|
|
|---|
SMA. At this stage, more than 95% of the cells were positive for GFAP (Fig. 1B) and CRALBP (Fig. 1C) , but were uniformly negative for
SMA (not shown). Cells maintained in culture for 3 days had begun to spread, proliferate, and assume an elongate, bipolar morphology (Fig. 1D) . Cells probed with the same panel of antibodies demonstrated intense reactivity for GFAP (Fig. 1E) , relatively weak nuclear staining with anti-CRALBP (Fig. 1F) , and uniform negativity for
SMA (not shown). Cultures maintained for 14 days were typically near confluence (Fig. 1G) . We were interested to note that the cells were not organized into a monolayer, but existed in two morphologies: a basal layer of well-spread polygonal cells covered in regions by a second, poorly organized layer of cells with long, thin processes (Fig 1G) . Differences in antigen content were also observed between these two cell types. The upper layer of cells was intensely reactive with anti-GFAP (Fig. 1H) . The lower polygonal cells were also GFAP positive, but the fluorescence intensity was generally lower. In the case of
SMA localization, cells in the upper layer were uniformly negative, whereas expression was detectable in the lower polygonal cells (Fig. 1I) . At this stage, reactivity to anti-CRALBP was still limited to faint nuclear fluorescence (not shown). Subcultivation induced further changes in human Müller cell phenotype. Trypsin-released cells were plated onto collagen-coated coverslips and incubated for an additional 2 weeks before fixation. The cells were uniformly large and flat and proliferated slowly, with some cultures not achieving confluence for several weeks (Fig. 1J) . GFAP expression appeared to decrease with this phenotype, as many of the cells were negative and even the cells with positive fibrillar localization were not intensely fluorescent (Fig. 1K) . In contrast, expression of
SMA continued to increase in the cell population; all cells contained
SMA-positive stress fibers of various intensities (Fig. 1L) . Reactivity to anti-CRALBP was unchanged from the previous examination (not shown). Continued subculture did not induce additional changes in cell phenotype except to complete the trends apparent at passage 2. The cells became uniformly negative for GFAP and uniformly positive for
SMA (not shown). However, significant differences in proliferative potential between the different isolates were apparent. Cultures isolated from three older donor retinas did not achieve confluence at passage 4, indicating that the cells ceased proliferation. The Müller cell preparation from the 20-year-old donor proliferated continuously, albeit slowly, until passage 6.
|
|
|
|
|
1 (Fig. 5A) and
2 (Fig. 5B) subunits was primarily perinuclear and relatively weak compared with
3 (Fig. 5C) or ß1 (Fig. 5D) . However, in both cases, the localization pattern and fluorescence intensity differed from that in the negative control (Fig. 5E) . These results differed somewhat from similar experiments with human dermal fibroblasts (not shown). Although the patterns and fluorescence intensities achieved with
1 and ß1 were similar,
2 fluorescence was more intense in fibroblasts than in Müller cells.
|
1,
2, and ß1 subunits (Fig. 6A) . The effect varied between the different antibodies and was most pronounced at measurements taken at or before 8 hours of incubation, after which the relative rates of matrix contraction did not differ substantially. The most pronounced effects were observed with antibodies against the
2 and ß1 subunits. Anti-
1 was marginally inhibitory and anti-
3 was without effect. Inhibition by subunit-blocking antibodies was also dose dependent (Fig. 6B) . Data collected at 8 hours of incubation indicated that maximal effects were achieved with antibody concentrations of approximately 0.8 µg/mL, suggesting that the failure of these antibodies to completely inhibit matrix contraction was not related to antibody concentration. Consistent with the kinetic data, no effects were detected with anti-
3 at any concentration examined.
|
2 and ß1 subunits were additive and thus unique. Cells were exposed to 10 µg/mL anti-
2, 10 µg/mL anti-ß1, 5 µg/mL each of anti-
2 and -ß1, or no antibodies. As was observed previously, cultures incubated with anti-
2 or -ß1 were retarded in the matrix contraction compared with the control (Fig. 6C) . Matrix contraction by cultures containing an equivalent amount of both antibodies was further retarded in both rate and extent. Cell morphologies at 8 hours of incubation were consistent with the matrix contraction data. Actively contractile cells incubated without antibodies were generally well spread, with long processes from which lines of matrix under tension were evident (Fig. 7A) . Cells incubated with 10 µg/mL anti-
2 (Fig. 7B) or 10 µg/mL anti-ß1 (Fig. 7C) were attached and spread, but the extended processes were shorter, and evidence of matrix contraction was still apparent. Cells exposed to 5 µg/mL of each antibody were attached, but remained rounded with little evidence of matrix contraction (Fig. 7D) . Together, these data suggest that matrix contraction by Müller cells is mediated primarily through integrin receptors containing
2 and ß1 subunits.
|
| Discussion |
|---|
|
|
|---|
We observed that isolated human Müller cells undergo phenotype changes similar to those reported for porcine cells with respect to changes in expression of GFAP, CRALBP, and
SMA.16 17 Several functional differences were observed, including minor variations in cell morphology, slower rates of cell rounding and adhesion, and accelerated phenotype change with expression of the myoid marker
SMA evident in primary cultures. In addition, the overall rates of proliferation and ultimate proliferation potential, measured by the number of successful subcultivations or passages after isolation, was substantially lower. However, based on our observations with the five isolates examined in this study, the latter difference is most likely attributable to the age of the source tissue rather than species.
Consistent with previous studies of porcine cells, human Müller cells are capable of significant extracellular matrix contraction. On a per-cell basis, the capacity of human Müller cells to reorganize extracellular matrices is equal to that of porcine Müller cells17 and exceeds that of contraction-capable retinal pigmented epithelial cells.36 Further, human Müller cells respond to contraction-promoting growth factors known to be present in human vitreous and produced by ocular cells.18 37 As with porcine cells, potent responses to IGF-I and, to a lesser extent PDGF, were observed.17 Consistent with previous reports,19 but unlike porcine cells, we observed modest, but nonetheless statistically significant responses to both TGFß species at concentrations of 4 nM or higher. However, this concentration is approximately four orders of magnitude higher than is necessary to induce a comparable response in dermal fibroblasts38 and 10 times higher than that detected in pathologic vitreous,39 leading to the conclusion that stimulation by TGFß species alone is of lesser importance as an inducer of tractional force generation by human Müller cells. Together, these data extend the direct evidence for Müller cell involvement in fibroproliferative disorders and confirm the potential for this cell type as a causative element in traction retinal detachment.
RT-PCR and immunolocalization studies led to the conclusion that fibrocontractive Müller cells express all four subunits that comprise the collagen-binding receptors. Further, functional studies indicated that the
2 and ß1 subunits are components of the receptor involved in transmitting tractional forces generated by human Müller cells. In this respect, Müller cells are consistent with most other matrix contraction-capable cells.21 22 Modest inhibitory effects were also observed with antibodies against the integrin
1 subunit, suggesting limited involvement of other heterodimers, as has been reported of other cell types.23 24 25 Investigators using a hepatic model of wound contraction suggested that expression of the
2 subunit and its function in matrix contraction is largely a tissue culture phenomenon, because of the limited expression of this subunit during wound repair in situ.24 This is not the case with either PVR or PDR, because
2 subunits have been convincingly localized to cells present in proliferative tissues from both disorders.40 It is unclear whether cells present in proliferative tissues express
1 subunits, which leaves the significance of functional inhibition with antibodies against the
1 subunit uncertain.
One observation of interest was that most of the inhibition achieved with three of the function-blocking antibodies was apparent at a low concentration of 0.8 µg/mL and did not improve with a 250-fold increase in antibody concentration to 20 µg/mL. Careful consideration of this result led us to conclude that neither the degree of inhibition observed nor the absence of complete inhibition can be attributed to confounding elements such as antibody cross-reactivity or the persistence of the antibody in the culture environment. In either case, levels of inhibition would have continued to increase with antibody concentration. The observed synergy between
2 and ß1 antibodies, causing greater levels of inhibition than an identical concentration of either antibody alone, is also consistent with these conclusions. Similarly, the additive effects of antibodies against integrin
2 and ß1 subunits preclude speculation about limited antibody penetrance or otherwise limited functional access to the relevant integrin dimer. We propose that these results arise from one of two functional features. The first suggests that functional inhibition resulting from binding of blocking antibody is incomplete. However unlikely, given the relative differences in molecular mass, this would explain both the early saturation characteristics of the doseresponse profile and the additive features of the
2 and ß1 antibodies. A second explanation is that
2 association with other ß integrin subunits yields receptors functional in generation of tractional force. As before, this would explain incomplete inhibition with ß1 blocking antibodies as well as the additive effects of
2 and ß1 antibodies. Unfortunately, we are aware of no studies that can be used to substantiate or refute either possibility at this time.
| Footnotes |
|---|
Submitted for publication January 15, 2002; revised September 30, 2002; accepted October 25, 2002.
Commercial relationships policy: N.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Clyde Guidry, Department of Ophthalmology, University of Alabama at Birmingham, EFH DB105, 1530 3rd Avenue S, Birmingham, AL 35294; guidry{at}vision.vsrc.uab.edu.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. Zahn, K. Volk, G. P. Lewis, D. Vossmeyer, R. Stragies, J. S. Heier, P. E. Daniel Jr, A. P. Adamis, E. A. Chapin, S. K. Fisher, et al. Assessment of the Integrin {alpha}5{beta}1 Antagonist JSM6427 in Proliferative Vitreoretinopathy Using In Vitro Assays and a Rabbit Model of Retinal Detachment Invest. Ophthalmol. Vis. Sci., February 1, 2010; 51(2): 1028 - 1035. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Burmeister, D. Hartwig, G. A. Limb, C. Kremling, H. Hoerauf, M. Muller, and G. Geerling Effect of Various Platelet Preparations on Retinal Muller Cells Invest. Ophthalmol. Vis. Sci., October 1, 2009; 50(10): 4881 - 4886. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Guidry, J. L. King, and J. O. Mason III Fibrocontractive Muller Cell Phenotypes in Proliferative Diabetic Retinopathy Invest. Ophthalmol. Vis. Sci., April 1, 2009; 50(4): 1929 - 1939. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mukherjee and C. Guidry The Insulin-Like Growth Factor System Modulates Retinal Pigment Epithelial Cell Tractional Force Generation Invest. Ophthalmol. Vis. Sci., April 1, 2007; 48(4): 1892 - 1899. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fuchs, V. Forster, E. Balse, J.-A. Sahel, S. Picaud, and L.-H. Tessier Retinal-Cell-Conditioned Medium Prevents TNF-{alpha}-Induced Apoptosis of Purified Ganglion Cells Invest. Ophthalmol. Vis. Sci., August 1, 2005; 46(8): 2983 - 2991. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. King and C. Guidry Muller Cell Production of Insulin-like Growth Factor-Binding Proteins In Vitro: Modulation with Phenotype and Growth Factor Stimulation Invest. Ophthalmol. Vis. Sci., December 1, 2004; 45(12): 4535 - 4542. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Wall, R. L. Gendron, W. V. Good, E. Miskiewicz, M. Woodland, K. Leblanc, and H. Paradis Conditional Knockdown of Tubedown-1 in Endothelial Cells Leads to Neovascular Retinopathy Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3704 - 3712. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Guidry, R. Feist, R. Morris, and C. W. Hardwick Changes in IGF Activities in Human Diabetic Vitreous Diabetes, September 1, 2004; 53(9): 2428 - 2435. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. King and C. Guidry Insulin-Like Growth Factor Binding Proteins Modulate Muller Cell Responses to Insulin-Like Growth Factors Invest. Ophthalmol. Vis. Sci., August 1, 2004; 45(8): 2848 - 2855. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Casson, G. Chidlow, J. P. M. Wood, M. Vidal-Sanz, and N. N. Osborne The Effect of Retinal Ganglion Cell Injury on Light-Induced Photoreceptor Degeneration Invest. Ophthalmol. Vis. Sci., February 1, 2004; 45(2): 685 - 693. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |