IOVS Am. J. Pathology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2003;44:1355-1363.)
© 2003 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.02-0046

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guidry, C.
Right arrow Articles by King, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guidry, C.
Right arrow Articles by King, J. L.

Tractional Force Generation by Human Müller Cells: Growth Factor Responsiveness and Integrin Receptor Involvement

Clyde Guidry, Kelley M. Bradley, and Jeffery L. King

From the Department of Ophthalmology, University of Alabama at Birmingham, Birmingham, Alabama.


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
PURPOSE. To assess the ability of human Müller cells to generate tractional forces and to determine the role of growth factors and collagen binding integrins in this process.

METHODS. Müller cells were isolated from papain-DNase–digested human retina. Cell identity and changes in cell phenotype were confirmed by immunodetection of glial fibrillary acidic protein (GFAP), cellular retinaldehyde-binding protein (CRALBP), vimentin, and {alpha}-smooth muscle actin ({alpha}-SMA). Generation of tractional force was assessed with a tissue culture assay involving incubation of cells on three-dimensional collagen gels. The effects of contraction-promoting growth factors were examined by adding these directly to the culture medium. Müller cell expression and the involvement of specific integrin receptors were assessed by immunodetection, RT-PCR, and subunit-specific blocking antibodies.

RESULTS. During maintenance in culture, human Müller cells adopted a fibroblast-like phenotype capable of generating tractional forces. Matrix contraction was stimulated in a dose-dependent fashion by insulin-like growth factor I and platelet-derived growth factor. Modest responses were observed with high concentrations of transforming growth factor (TGF)-ß1 and -ß2. Müller cells express all four integrin subunits that comprise the collagen-binding receptors including {alpha}1, {alpha}2, {alpha}3, and ß1. Blocking antibodies against receptor subunits {alpha}2 and ß1 significantly reduced the overall rate of matrix contraction. Antibodies against the {alpha}1 subunit were modestly inhibitory, whereas anti-{alpha}3 was without effect.

CONCLUSIONS. Human Müller cells acquire the capacity to generate tractional forces in vitro and the contraction-promoting growth factors insulin-like growth factor (IGF)-I and platelet-derived growth factor (PDGF) are potent stimuli. Generation of tractional force by Müller cells primarily involves integrin receptors containing {alpha}2 and ß1 subunits.


It is generally accepted that tractional forces of the type that cause retinal detachment in proliferative vitreoretinopathy (PVR) and proliferative diabetic retinopathy (PDR) result from extracellular matrix contraction by individual cells.1 2 Müller cells, the principal retinal glia, play important roles in normal retinal physiology and have been implicated in these fibrocontractive disorders.3 Müller cells react to a variety of seemingly unrelated retinal insults, including photic damage, mechanical injury, detachment, ischemia, diabetes-associated stress4 and, described more recently, age-related macular degeneration.5 Reported Müller cell responses can vary with type or severity of insult to include changes in electrophysiology, protein expression, cellular hypertrophy, proliferation, and migration.6 7 8 9 10 11 Consistent with the latter two responses, immunocytochemical studies have localized Müller cells to fibroproliferative tissues associated with PVR and PDR, providing compelling evidence for their participation in these disorders.12 13 14 15

Tissue culture studies performed with Müller cells harvested from porcine retina demonstrated that cell phenotype varies dramatically after isolation and introduction into culture. Changes include cell morphology, proliferation, loss of certain constitutively expressed proteins, and acquisition of myoid markers yielding a phenotype that superficially resembles fibroblasts.16 Most interesting, the fibroblast-like phenotype possesses the ability to generate tractional forces in response to members of the insulin-like growth factor (IGF) and platelet-derived growth factor (PDGF) families.17 Subsequent studies revealed that vitreous contraction-promoting activity attributable to IGF-I and PDGF-related species increases in human proliferative vitreoretinal disorders, thus extending the evidence for a Müller cell role in fibroproliferative diseases.18

Although compelling, the evidence for Müller cell involvement in human fibroproliferative diseases is still primarily circumstantial. To date, the capacity of Müller cells to generate tractional forces has been systematically demonstrated in cells isolated from juvenile porcine retina, the relevance of which to human cell biology is uncertain.17 The only study of human Müller-cell–generated tractional forces to date reported modest responses stimulated by exposure to TGFß2 and did not examine the relative effects of IGF-I or PDGF.19 Porcine Müller cells, in contrast, are minimally responsive to TGFß1 and -ß2, suggesting that there may be important species-related differences in growth factor sensitivities.17 If so, this would significantly influence the conclusions drawn regarding IGF-I and PDGF biological activity in human vitreoretinal disease and redirect emphasis toward TGFß species as the causative factors. With this in mind, several important questions remain unanswered that should be addressed directly. Are there significant age- or species-related differences between human and porcine Müller cell contraction potentials that might influence the perceived role of these cells in fibrocontractive disorders? If capable of generating tractional force, do human Müller cells respond differently from porcine cells to the contraction-promoting growth factors?

Another question not previously investigated in Müller cell biology is the involvement of the three collagen-binding integrin receptors in tractional force generation.20 In classic studies performed with dermal fibroblasts, it was determined that the {alpha}2ß1 heterodimer is the only collagen-binding integrinessential to collagen matrix contraction and included the tacit assumption that this relationship would be consistent among contraction-capable cell types.21 22 However, recent studies with cells of other origins have yielded variable results that place increasing emphasis on the {alpha}1ß1 heterodimer and undermine confidence about the presumed role of the {alpha}2ß1 in the Müller cell generation of tractional force.23 24 25 26 Studies of the other collagen-binding integrins suggest that these receptors are not merely redundant but mediate different downstream events and use different cytoplasmic signal-transduction pathways to accomplish these effects.27 28 29 Identification of the functional, and thus target, integrin receptor is essential for studies of growth-factor–induced signal transduction pathways leading to Müller cell generation of tractional force.

The goal of this study was to extend the available evidence for or against human Müller cells as a causative element in traction retinal detachment. To accomplish this, Müller cells were isolated from human retina, introduced into culture, and examined systematically for changes in cell phenotype. The capacity of human Müller cells to generate tractional forces and their responses to growth factors were examined in tissue culture assays involving incubation on three-dimensional collagen gels. Müller cells were examined for expression of the relevant integrin receptor subunits, and experiments were performed with subunit-specific blocking antibodies to determine the involvement of these in generation of tractional force.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Cell Isolation and Culture
The protocol for research involving human tissue complied with the guidelines set forth by the Declaration of Helsinki. Human Müller cells were isolated from papain and DNase-digested retina, with a protocol based on that reported previously for use in porcine cells.16 17 Human donor eyes with negative ophthalmic histories (ages 20, 47, 62, 68, and 70) were provided by the Alabama Eye and Tissue Bank (Birmingham, AL). Eyes were dissected and the retina isolated within 4 hours of death. Isolated retinas were washed several times with growth medium composed of Dulbecco’s modified Eagle’s medium (DMEM) containing 20 mM HEPES and 10% fetal bovine serum (FBS) and then incubated in growth medium overnight at 37°C in a humidified atmosphere composed of 5% CO2 and 95% air. In four of the five retinas, a dense layer of cortical vitreous remained attached to the retina after rinsing. The vitreous was detached by gentle trituration through a 10-mL pipette, which also resulted in partial fragmentation of the tissue. After overnight incubation, the retinas were rinsed with several changes of Leibovitz L-15 medium, digested with papain and DNase, and dissociated by successive trituration through a 10-mL borosilicate tissue culture pipette, as described previously.16 After the remaining tissue fragments were allowed to settle, the supernatants were removed and examined by phase-contrast microscopy. Five such triturations were typically sufficient to completely dissociate the retina resulting in two or three fractions (usually fractions 3, 4, and 5) enriched in morphologically recognizable Müller cells. These cells were pelleted, washed, resuspended in growth medium, incubated on a rocking platform for 60 minutes at room temperature, and introduced into two uncoated 10-cm diameter tissue culture dishes. Nonadherent cells were removed after 2 hours of incubation at 37°C. Primary cultures were permitted to achieve confluence, after which they were released with trypsin and EDTA and replated into two identical tissue culture dishes coated with 0.1 mg/mL type I collagen dissolved in 12 mM HCl. Human foreskin fibroblasts were purchased from BioWhittaker (Walkersville, MD) and maintained in culture with the same reagents used for human Müller cells, except that the cells were maintained in uncoated tissue culture dishes.

Immunofluorescence Microscopy
Cells attached to coverslips were rinsed and fixed in 2% paraformaldehyde in 0.1 M phosphate buffer at pH 7.0 for 60 minutes at room temperature. The coverslips were permeabilized by a 10-minute treatment with 0.1% Triton X-100 in phosphate-buffered saline (PBS; 0.01 M Na2HPO4, 0.15 M NaCl; pH 7.4). In experiments to localize integrin subunits, fixation was with 95% ethanol and 5% acetic acid for 5 minutes at -20°C without subsequent permeabilization. All coverslips were blocked for 60 minutes with 20% serum from the same species as the secondary antibody in PBS. Cells were treated with primary and secondary antibodies in PBS with 2% serum for 60 minutes each with three 5-minute washes between and after antibody treatments. Photomicrographs were taken with a microscope (Optiphot; Nikon, Tokyo, Japan) equipped with epifluorescence illumination and phase-contrast optics, using a 35-mm camera (Delta 100 and 400 film; Ilford, Cheshire, UK). Images were scanned from negatives (SprintScan 4000; Polaroid, Cambridge, MA) and assembled into composite photomicrographs (Photodeluxe; Adobe, San Jose, CA).

Contraction Assays
Collagen gels were prepared from native type I collagen isolated from rat tail tendons by limited pepsin digestion and sequential salt precipitation.30 Acid-soluble collagen dissolved in 12 mM HCl was adjusted to physiologic pH and ionic strength using 10x PBS (0.1 M Na2HPO4, 1.5 M NaCl) and 0.1 M NaOH, while maintained on ice. Aliquots (0.2 mL) of the collagen solution were added to circular scores on the bottom of 24-well tissue culture plates and incubated at 37°C for 90 minutes to allow the gels to polymerize. Cells harvested with trypsin and EDTA as for subculture were washed with growth medium to inactivate the trypsin and again with contraction medium composed of DMEM with reduced sodium bicarbonate (2.7 g/L) and 1 mg/mL crystalline BSA (A-7511; Sigma, St. Louis, MO). Aliquots of cells (50 µL) suspended in contraction medium at 200,000 cells per milliliter were applied to the gel surface and then incubated at 37°C to permit cell adhesion. The wells are then flooded with an additional 0.75 mL of contraction medium containing test substances. The initial thickness of each gel was measured with an inverted, phase-contrast microscope equipped with a z-axis digitizer (LaSico, Los Angeles, CA) by adjusting the plane of focus from the surface of the culture vessel to the cell layer. This measurement provided the initial gel thickness against which all subsequent measurements were compared. The subsequent gel thickness was divided by the initial gel thickness, multiplied by 100, and then subtracted from 100 to yield the percentage reduction in gel thickness, reported as percentage contraction. Repeated measurements of this type indicate that these values are reproducible to 1.25% of the original gel thickness.31 Differences between experimental and control samples were compared by paired Student’s t-test.

RT-PCR Reactions
RNA was isolated from actively growing cultures of human Müller cells and human dermal fibroblasts, with an extraction reagent used according to the manufacturer’s instructions (TRIzol; Life Technologies, Grand Island, NY). Integrin subunit-specific primers were designed using the GeneFisher program (available at www.genefisher.de)32 and human sequence data available from the National Center for Biotechnology Information (Bethesda, MD). This included accession numbers XM032902 for {alpha}1, XM003913 for {alpha}2, XM008432 for {alpha}3, and NM002211 for ß1. The resultant primers and predicted product sizes were: {alpha}1, forward (f)CTCCAGACGCTCAGTGGA, reverse (r)TCTGTCAGACCGTCACCA, 518 base pairs; {alpha}2, fCCTTCAAGTGAACAGTTTGG, rTTGCTCCGAATGTGTTTGTG, 640 base pairs; {alpha}3, fACGAAGTCAGCAATGGCAAG, rCAGCCACAGCTCGATTTCG, 518 base pairs; and ß1, fGGGTTTCACTTTGCTGGA, rCCTCCGTAAAGCCCAGA, 517 base pairs.

RT-PCR reactions were performed with 1 µg total RNA, 20 pM each primer and commercial RT-PCR reagents (Ready-To-Go, Amersham Pharmacia Biotech, Piscataway, NJ). Reaction programs using a minicycler (PTC-150; MJ Research, Watertown, MA) included (1) a reverse transcription program of 20 minutes at 42°C and 5 minutes at 95°C; (2) 35 cycles of 1 minute at 95°C, 45 seconds at the appropriate annealing temperature, and 45 seconds at 72°C; and (3) 5 minutes at 72°C. For negative control reactions, reverse transcriptase was inactivated at 95°C for 10 minutes before addition of the primer and template. PCR products were separated on 2% agarose gels, visualized with ethidium bromide and photodocumented (Polaroid camera; fitted with a Tiffen 40.5 mm Deep Yellow 15 filter; FisherBiotech, Pittsburgh, PA).

Reagents
Tissue culture media and sera were obtained from Life Technologies (Rockville, MD). Recombinant human growth factors obtained from commercial suppliers included IGF-I (Upstate Biotechnology, Lake Placid, NY), PDGF-AB (Upstate Biotechnology), and TGFß1 and -ß2 (R&D Systems, Minneapolis, MN). Antibodies obtained from commercial suppliers included rabbit anti-GFAP (Dako, Glostrup, Denmark), mouse anti-{alpha}SMA (clone 1A4, Sigma Chemical Co.), anti-integrin {alpha}1 (clone 5E8D9, Upstate Biotechnology), anti-integrin {alpha}2 (clone A2-IIE10; Upstate Biotechnology), anti-integrin {alpha}3 (clone P1B5; Life Technologies), anti-integrin ß1 (clone DE9, Upstate Biotechnology), rhodamine-conjugated donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories, West Grove, PA), and rhodamine-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories). Rabbit anti-CRALBP was a generous gift from John Saari (University of Washington School of Medicine, Seattle, WA). Normal goat and donkey sera were obtained from The Binding Site, Ltd. (Birmingham, UK). Other chemicals and reagents were obtained from Sigma Chemical Co.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Characterization of Human Müller Cell Phenotype Changes
To examine potential morphologic and antigenic changes, human Müller cells were released from papain-digested retina, and trituration fractions enriched with Müller cells were combined for culture studies. At this stage, human Müller cells were easily recognizable by their distinct, elongate morphology (Fig. 1A) . Cells from these preparations were incubated in growth medium to permit rounding, attached to uncoated coverslips, and incubated in growth medium for various times. Cells incubated for 2 hours after cell adhesion were fixed, permeabilized, and probed with antibodies against known or potential Müller cell markers, including GFAP, CRALBP and {alpha}SMA. At this stage, more than 95% of the cells were positive for GFAP (Fig. 1B) and CRALBP (Fig. 1C) , but were uniformly negative for {alpha}SMA (not shown). Cells maintained in culture for 3 days had begun to spread, proliferate, and assume an elongate, bipolar morphology (Fig. 1D) . Cells probed with the same panel of antibodies demonstrated intense reactivity for GFAP (Fig. 1E) , relatively weak nuclear staining with anti-CRALBP (Fig. 1F) , and uniform negativity for {alpha}SMA (not shown). Cultures maintained for 14 days were typically near confluence (Fig. 1G) . We were interested to note that the cells were not organized into a monolayer, but existed in two morphologies: a basal layer of well-spread polygonal cells covered in regions by a second, poorly organized layer of cells with long, thin processes (Fig 1G) . Differences in antigen content were also observed between these two cell types. The upper layer of cells was intensely reactive with anti-GFAP (Fig. 1H) . The lower polygonal cells were also GFAP positive, but the fluorescence intensity was generally lower. In the case of {alpha}SMA localization, cells in the upper layer were uniformly negative, whereas expression was detectable in the lower polygonal cells (Fig. 1I) . At this stage, reactivity to anti-CRALBP was still limited to faint nuclear fluorescence (not shown). Subcultivation induced further changes in human Müller cell phenotype. Trypsin-released cells were plated onto collagen-coated coverslips and incubated for an additional 2 weeks before fixation. The cells were uniformly large and flat and proliferated slowly, with some cultures not achieving confluence for several weeks (Fig. 1J) . GFAP expression appeared to decrease with this phenotype, as many of the cells were negative and even the cells with positive fibrillar localization were not intensely fluorescent (Fig. 1K) . In contrast, expression of {alpha}SMA continued to increase in the cell population; all cells contained {alpha}SMA-positive stress fibers of various intensities (Fig. 1L) . Reactivity to anti-CRALBP was unchanged from the previous examination (not shown). Continued subculture did not induce additional changes in cell phenotype except to complete the trends apparent at passage 2. The cells became uniformly negative for GFAP and uniformly positive for {alpha}SMA (not shown). However, significant differences in proliferative potential between the different isolates were apparent. Cultures isolated from three older donor retinas did not achieve confluence at passage 4, indicating that the cells ceased proliferation. The Müller cell preparation from the 20-year-old donor proliferated continuously, albeit slowly, until passage 6.



View larger version (191K):
[in this window]
[in a new window]
 
FIGURE 1. Phase-contrast microscopy and indirect immunofluorescence localization of GFAP, CRALBP, and {alpha}SMA in human Müller cell cultures. Dissociated Müller cells (A) were seeded on coverslips, maintained under normal culture conditions, and fixed after 2 hours (B, C), 3 days (DF), 14 days (GI), and at passage 2 (JL). Cell were visualized by phase-contrast microscopy (A, D, G, J) or probed with polyclonal anti-GFAP (B, E, H, K), polyclonal anti-CRALBP (C, F) or monoclonal anti-{alpha}SMA (I, L). Primary antibodies were detected with rhodamine-conjugated secondary antibodies. Magnification, x112.5.

 
Tractional Force Generation and Growth Factor Responsiveness
To assess the ability of human Müller cells to generate tractional forces, cells from passage 3 cultures were harvested and placed in various numbers on the surface of collagen gels. After incubation for 60 minutes to permit cell adhesion to the gels, wells were flooded with growth medium containing 3% FBS, a known source of contraction-promoting activity.33 Changes in gel thickness were then measured at intervals. Gel contraction was measurable within 1 hour in cultures containing 20,000 cells per gel and continued to advance throughout the incubation (Fig. 2 A) . Measurements taken after 24 hours of incubation revealed an obvious cell number–dependent response, with significant matrix contraction at concentrations above 1250 cells per gel (Fig. 2B) . To permit comparison, responses achieved in similar experiments with porcine cells are presented in the same figure (Fig. 2 , dotted line).17 Based on these data the capacity of human Müller cells to generate tractional forces was judged to be comparable to that of porcine cells.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 2. Extracellular matrix contraction by human Müller cells. Passage 3 Müller cells were released with trypsin, placed on collagen gels in varying numbers and incubated in DMEM containing 3% FBS. (A) Kinetics of extracellular matrix contraction by 20,000 cells per gel; (B) Cell number–dependent responses achieved after 24 hours ({circ}). Data are the mean ± SD of results obtained from triplicate cultures under each condition. Results achieved in a similar experiment with porcine Müller cells are presented for comparison.17 Significant differences were observed at times of 1 hour or more (top, P < 0.0004) and cell numbers greater than 1250 per gel (bottom, P < 0.002).

 
To examine human Müller cell responses to growth factors, experiments were performed in which cells were incubated in serum-free medium containing various concentrations of growth factors known to stimulate matrix contraction in other cell types. Data obtained after 24 hours of incubation revealed an obvious dose-dependent response to increasing concentrations of IGF-I and PDGF-AB (Fig. 3) . On a molar basis, cell responses to IGF-I exceeded that of PDGF by approximately 10-fold (Table 1) . Overall, human Müller cell responsiveness to IGF-I and PDGF were comparable to that previously reported for porcine cells (Table 1) .17 Müller cells also responded in a dose-dependent fashion to both TGFß1 and -ß2. Statistically significant responses, compared with cultures without added growth factors, were observed at concentrations above 0.1 nM. However, the potency of these growth factors, in concentration and overall magnitude of the induced response, was significantly lower than that of IGF-I and PDGF.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 3. Human Müller cell responses to contraction-promoting growth factors. Müller cells attached to collagen gels were incubated in growth medium containing various concentrations of IGF-I ({circ}), PDGF-AB (•), TGFß1 ({square}), or TGFß2 ({blacksquare}). Presented are the dose-dependent responses achieved at 24 hours of incubation. Data are the mean ± SD of results obtained from triplicate cultures under each condition. Responses measured in cultures without added growth factor varied from 3.4% to 9.5%, with a maximum SD of 1.2%. Significant differences were observed at all growth factor concentrations above 1 x 10-10 M (P < 0.01).

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Growth Factor Stimulated Contractile Activity in Human and Porcine Müller Cells

 
Integrin Receptor Expression and Involvement
To determine which of the integrin heterodimers are potentially involved in generation of tractional force we first examined potential expression of the subunits that comprise the three collagen-binding heterodimers. RNA preparations from cultures of human Müller cells and dermal fibroblasts (which reportedly express all four subunits) were amplified by RT-PCR using integrin subunit-specific primers. Products consistent with the predicted sizes were detected in reactions in RNA preparations from both Müller cells (Fig. 4A) and fibroblasts (Fig. 4B) . Control reactions with attenuated reverse transcriptase activity confirmed amplification of RNA rather than genomic DNA (Fig. 4C) .



View larger version (70K):
[in this window]
[in a new window]
 
FIGURE 4. Human Müller cells expressed collagen-binding integrins. RNA preparations from human Müller cells (A) and human dermal fibroblasts (B) were amplified by RT-PCR and integrin subunit–specific primers for {alpha}1 (lane 1), {alpha}2 (lane 2), {alpha}3 (lane 3), and ß1 (lane 4). Control reactions to detect amplification of genomic DNA (C) were performed under conditions identical with those in (B) except that reverse transcriptase activity was attenuated by heat treatment.

 
Müller cell expression of collagen-binding integrin subunits were also examined by indirect immunofluorescence. Cells attached to coverslips and maintained under routine culture conditions for 4 days were fixed and probed with a panel of integrin subunit-specific monoclonal antibodies. Müller cells were positive for all four subunits, although the fluorescence intensity varied considerably. Fluorescence resulting from incubation with antibodies against the {alpha}1 (Fig. 5A) and {alpha}2 (Fig. 5B) subunits was primarily perinuclear and relatively weak compared with {alpha}3 (Fig. 5C) or ß1 (Fig. 5D) . However, in both cases, the localization pattern and fluorescence intensity differed from that in the negative control (Fig. 5E) . These results differed somewhat from similar experiments with human dermal fibroblasts (not shown). Although the patterns and fluorescence intensities achieved with {alpha}1 and ß1 were similar, {alpha}2 fluorescence was more intense in fibroblasts than in Müller cells.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 5. Indirect immunofluorescence localization of integrin subunits in human Müller cell cultures. Trypsin-released cells were seeded onto coverslips and maintained under normal culture conditions for 4 days, after which the coverslips were fixed and probed with monoclonal antibodies against integrin subunits {alpha}1 (A), {alpha}2 (B), {alpha}3 (C), ß1 (D) or no antibody (E). Primary antibodies were detected with rhodamine-conjugated secondary antibodies and visualized by epifluorescence microscopy. Magnification, x167.

 
To examine the involvement of these same integrin receptor subunits in generation of tractional force by Müller cells we tested the effects of the same panel of integrin subunit-specific monoclonal antibodies, as they are also reportedly capable of blocking receptor function. In separate assays Müller cells attached to collagen gels were incubated in medium containing 3% FBS as a contraction promoter source and various concentrations of anti-integrin antibodies. Changes in gel thickness were measured at intervals throughout the experiments. Gel contraction was retarded to various degrees in cultures containing 20 µg/mL of neutralizing antibodies against the {alpha}1, {alpha}2, and ß1 subunits (Fig. 6A) . The effect varied between the different antibodies and was most pronounced at measurements taken at or before 8 hours of incubation, after which the relative rates of matrix contraction did not differ substantially. The most pronounced effects were observed with antibodies against the {alpha}2 and ß1 subunits. Anti-{alpha}1 was marginally inhibitory and anti-{alpha}3 was without effect. Inhibition by subunit-blocking antibodies was also dose dependent (Fig. 6B) . Data collected at 8 hours of incubation indicated that maximal effects were achieved with antibody concentrations of approximately 0.8 µg/mL, suggesting that the failure of these antibodies to completely inhibit matrix contraction was not related to antibody concentration. Consistent with the kinetic data, no effects were detected with anti-{alpha}3 at any concentration examined.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 6. Generation of tractional force by human Müller cells was differentially labile to integrin-blocking antibodies. In separate assays, Müller cells attached to collagen gels were incubated in media containing 3% FBS and various concentrations of anti-integrin subunit antibodies. (A) Representative kinetics of matrix contraction for cultures containing 20 µg/mL anti-ß1 ({circ}), anti-{alpha}1 ({square}), anti-{alpha}2 (•), anti-{alpha}3 ({blacksquare}), or no antibody ({triangleup}). (B) Antibody dose–response profiles achieved at 8 hours with anti-ß1, -{alpha}1, -{alpha}2, and -{alpha}3 (symbols as in A) normalized to maximal observed responses with no antibody controls. (C) Kinetics of matrix contraction for Müller cells incubated in 10 µg/mL anti-ß1, 10 µg/mL anti-{alpha}2, 5 µg/mL each anti-ß1 and anti-{alpha}2 ({square}) or no additions ({blacksquare}). Except as noted, symbols are as in (A). The data presented represent the average and range of responses achieved with duplicate wells for each antibody concentration. Significant differences were observed at anti-ß1 and -{alpha}2 concentrations of 0.8 µg/mL or more (P < 0.05) and anti-{alpha}1 concentrations of 4 µg/mL or more (P < 0.05). Inhibition by anti-{alpha}3 was not significant at any concentration.

 
A final series of experiments were performed to determine whether the inhibitory effects of the antibodies against {alpha}2 and ß1 subunits were additive and thus unique. Cells were exposed to 10 µg/mL anti-{alpha}2, 10 µg/mL anti-ß1, 5 µg/mL each of anti-{alpha}2 and -ß1, or no antibodies. As was observed previously, cultures incubated with anti-{alpha}2 or -ß1 were retarded in the matrix contraction compared with the control (Fig. 6C) . Matrix contraction by cultures containing an equivalent amount of both antibodies was further retarded in both rate and extent. Cell morphologies at 8 hours of incubation were consistent with the matrix contraction data. Actively contractile cells incubated without antibodies were generally well spread, with long processes from which lines of matrix under tension were evident (Fig. 7A) . Cells incubated with 10 µg/mL anti-{alpha}2 (Fig. 7B) or 10 µg/mL anti-ß1 (Fig. 7C) were attached and spread, but the extended processes were shorter, and evidence of matrix contraction was still apparent. Cells exposed to 5 µg/mL of each antibody were attached, but remained rounded with little evidence of matrix contraction (Fig. 7D) . Together, these data suggest that matrix contraction by Müller cells is mediated primarily through integrin receptors containing {alpha}2 and ß1 subunits.



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 7. Morphologies of Müller cells causing contraction of collagen gels in the presence of anti-integrin subunit antibodies, as described in the legend to Figure 4C . Phase-contrast photomicrographs were taken of human Müller cells after 8 hours of incubation in medium containing no antibodies (A), 10 µg/mL anti-ß1 (B), 10 µg/mL anti-{alpha}2 (C), or 5 µg/mL each anti-ß1 and anti-{alpha}2 (D). Magnification, x144.

 

    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
The primary goal of this study was to extend the evidence for or against the direct involvement of Müller cells in human fibroproliferative disorders. Of particular interest was whether human Müller cells possess the capacity to generate significant tractional forces in response to contraction-promoting growth factors, particularly those known to be present in human vitreous in association with fibroproliferative disease. Whereas these same questions have been successfully investigated with Müller cells isolated from juvenile porcine retina,16 17 reported dissimilarities in growth factor responsiveness and the considerable potential for age- and species-related differences in cell behavior provided the impetus for this direct examination.19 Finally, although recent studies have localized integrin receptor subunits to Müller cells in normal and developing retina, expression by fibrocontractive Müller cells and the involvement of collagen-binding integrins in generation of tractional force have not been examined in this cell type, regardless of species.34 35

We observed that isolated human Müller cells undergo phenotype changes similar to those reported for porcine cells with respect to changes in expression of GFAP, CRALBP, and {alpha}SMA.16 17 Several functional differences were observed, including minor variations in cell morphology, slower rates of cell rounding and adhesion, and accelerated phenotype change with expression of the myoid marker {alpha}SMA evident in primary cultures. In addition, the overall rates of proliferation and ultimate proliferation potential, measured by the number of successful subcultivations or passages after isolation, was substantially lower. However, based on our observations with the five isolates examined in this study, the latter difference is most likely attributable to the age of the source tissue rather than species.

Consistent with previous studies of porcine cells, human Müller cells are capable of significant extracellular matrix contraction. On a per-cell basis, the capacity of human Müller cells to reorganize extracellular matrices is equal to that of porcine Müller cells17 and exceeds that of contraction-capable retinal pigmented epithelial cells.36 Further, human Müller cells respond to contraction-promoting growth factors known to be present in human vitreous and produced by ocular cells.18 37 As with porcine cells, potent responses to IGF-I and, to a lesser extent PDGF, were observed.17 Consistent with previous reports,19 but unlike porcine cells, we observed modest, but nonetheless statistically significant responses to both TGFß species at concentrations of 4 nM or higher. However, this concentration is approximately four orders of magnitude higher than is necessary to induce a comparable response in dermal fibroblasts38 and 10 times higher than that detected in pathologic vitreous,39 leading to the conclusion that stimulation by TGFß species alone is of lesser importance as an inducer of tractional force generation by human Müller cells. Together, these data extend the direct evidence for Müller cell involvement in fibroproliferative disorders and confirm the potential for this cell type as a causative element in traction retinal detachment.

RT-PCR and immunolocalization studies led to the conclusion that fibrocontractive Müller cells express all four subunits that comprise the collagen-binding receptors. Further, functional studies indicated that the {alpha}2 and ß1 subunits are components of the receptor involved in transmitting tractional forces generated by human Müller cells. In this respect, Müller cells are consistent with most other matrix contraction-capable cells.21 22 Modest inhibitory effects were also observed with antibodies against the integrin {alpha}1 subunit, suggesting limited involvement of other heterodimers, as has been reported of other cell types.23 24 25 Investigators using a hepatic model of wound contraction suggested that expression of the {alpha}2 subunit and its function in matrix contraction is largely a tissue culture phenomenon, because of the limited expression of this subunit during wound repair in situ.24 This is not the case with either PVR or PDR, because {alpha}2 subunits have been convincingly localized to cells present in proliferative tissues from both disorders.40 It is unclear whether cells present in proliferative tissues express {alpha}1 subunits, which leaves the significance of functional inhibition with antibodies against the {alpha}1 subunit uncertain.

One observation of interest was that most of the inhibition achieved with three of the function-blocking antibodies was apparent at a low concentration of 0.8 µg/mL and did not improve with a 250-fold increase in antibody concentration to 20 µg/mL. Careful consideration of this result led us to conclude that neither the degree of inhibition observed nor the absence of complete inhibition can be attributed to confounding elements such as antibody cross-reactivity or the persistence of the antibody in the culture environment. In either case, levels of inhibition would have continued to increase with antibody concentration. The observed synergy between {alpha}2 and ß1 antibodies, causing greater levels of inhibition than an identical concentration of either antibody alone, is also consistent with these conclusions. Similarly, the additive effects of antibodies against integrin {alpha}2 and ß1 subunits preclude speculation about limited antibody penetrance or otherwise limited functional access to the relevant integrin dimer. We propose that these results arise from one of two functional features. The first suggests that functional inhibition resulting from binding of blocking antibody is incomplete. However unlikely, given the relative differences in molecular mass, this would explain both the early saturation characteristics of the dose–response profile and the additive features of the {alpha}2 and ß1 antibodies. A second explanation is that {alpha}2 association with other ß integrin subunits yields receptors functional in generation of tractional force. As before, this would explain incomplete inhibition with ß1 blocking antibodies as well as the additive effects of {alpha}2 and ß1 antibodies. Unfortunately, we are aware of no studies that can be used to substantiate or refute either possibility at this time.


    Footnotes
 
Supported by the Juvenile Diabetes Research Foundation International, New York, New York; the International Retinal Research Foundation, Birmingham, Alabama; National Eye Institute Grant EY13258; and a departmental award from Research to Prevent Blindness.

Submitted for publication January 15, 2002; revised September 30, 2002; accepted October 25, 2002.

Commercial relationships policy: N.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Clyde Guidry, Department of Ophthalmology, University of Alabama at Birmingham, EFH DB105, 1530 3rd Avenue S, Birmingham, AL 35294; guidry{at}vision.vsrc.uab.edu.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. Wiedemann, P, Weller, M. (1988) The pathophysiology of proliferative vitreoretinopathy Acta Ophthalmol (Copenh) 189,4-15
  2. Pastor, JC. (1998) Proliferative vitreoretinopathy: an overview Surv Ophthalmol 43,3-18[CrossRef][Medline][Order article via Infotrieve]
  3. Reichenbach, A, Stolzenburg, JU, Eberhardt, W, Chao, TI, Dettmer, D, Hertz, L. (1993) What do retinal Müller (glial) cells do for their neuronal "small siblings"? J Chem Neurol 6,201-213
  4. Bringmann, A, Reichenbach, A. (2001) Role of Müller cells in retinal degenerations Front Biosci 6,E72-E92[Medline][Order article via Infotrieve]
  5. Guidry, C, Medeiros, NE, Curcio, CA. (2002) Phenotypic variation of retinal pigment epithelium in age-related macular degeneration Invest Ophthalmol Vis Sci 43,267-273[Abstract/Free Full Text]
  6. Lewis, GP, Erickson, PA, Guerin, CJ, Anderson, DH, Fisher, SK. (1989) Changes in the expression of specific Müller cell proteins during long-term retinal detachment Exp Eye Res 49,93-111[CrossRef][Medline][Order article via Infotrieve]
  7. Mizutani, M, Gerhardinger, C, Lorenzi, M. (1998) Muller cell changes in human diabetic retinopathy Diabetes 47,445-449[Abstract]
  8. Dyer, MA, Cepko, CL. (2000) Control of Muller glial cell proliferation and activation following retinal injury Nat Neurosci 3,873-880[CrossRef][Medline][Order article via Infotrieve]
  9. Lewis, GP, Fisher, SK. (2000) Muller cell outgrowth after retinal detachment: association with cone photoreceptors Invest Ophthalmol Vis Sci 41,1542-1545[Abstract/Free Full Text]
  10. Rungger-Brandle, E, Dosso, AA, Leuenberger, PM. (2000) Glial reactivity, an early feature of diabetic retinopathy Invest Ophthalmol Vis Sci 41,1971-1980[Abstract/Free Full Text]
  11. Geller, SF, Lewis, GP, Fisher, SK. (2001) FGFR1, signaling, and AP-1 expression after retinal detachment: reactive Müller and RPE cells Invest Ophthalmol Vis Sci 42,1363-1369[Abstract/Free Full Text]
  12. Nork, TM, Wallow, IHL, Sramek, SJ, Anderson, G. (1987) Müller’s cell involvement in proliferative diabetic retinopathy Arch Ophthalmol 105,1424-1429[Abstract/Free Full Text]
  13. Sramek, SJ, Wallow, IH, Stevens, TS, Nork, TM. (1989) Immunostaining of preretinal membranes for actin, fibronectin, and glial fibrillary acidic protein Ophthalmology 96,835-841[Medline][Order article via Infotrieve]
  14. Guerin, CJ, Wolfshagen, RW, Eifrig, DE, Anderson, DH. (1990) Immunocytochemical identification of Müller’s glia as a component of human epiretinal membranes Invest Ophthalmol Vis Sci 31,1483-1491[Abstract]
  15. Vinores, SA, Derevjanik, NL, Mahlow, J, et al (1995) Class III beta-tubulin in human retinal pigment epithelial cells in culture and in epiretinal membranes Exp Eye Res 60,385-400[CrossRef][Medline][Order article via Infotrieve]
  16. Guidry, C. (1996) Isolation and characterization of porcine Müller cells: myofibroblastic dedifferentiation in culture Invest Ophthalmol Vis Sci 37,740-752[Abstract/Free Full Text]
  17. Guidry, C. (1997) Tractional force generation by porcine Müller cells: development and differential stimulation by growth factors Invest Ophthalmol Vis Sci 38,456-468[Abstract/Free Full Text]
  18. Hardwick, C, Feist, R, Morris, R, et al (1997) Tractional force generation by porcine Müller cells: stimulation by growth factors in human vitreous Invest Ophthalmol Vis Sci 38,2053-2063[Abstract/Free Full Text]
  19. Hatta, S, Hakajima, N, Matumoto, Y, Ikeda, T, Kinosita, S, Puro, DG. (1998) Effect of TGF-ß2 on contraction of human Müller cells [ARVO Abstract] Invest Ophthalmol Vis Sci 39(4),S123Abstract nr 567
  20. Hynes, R. (1987) Integrins, a family of cell surface receptors Cell 48,549-555[CrossRef][Medline][Order article via Infotrieve]
  21. Gullberg, D, Tingstrom, A, Thuresson, AC, Olsson, L, Terracio, T, Rubin, K. (1990) Beta 1 integrin-mediated collagen gel contraction is stimulated by PDGF Exp Cell Res ,186-264
  22. Klein, C, Dressel, D, Stainmayer, T, et al (1991) Integrin alpha 2 beta 1 is upregulated in fibroblasts and highly aggressive melanoma cels in three-dimensional collagen lattices and mediates the reorganization of collagen I fibrils J Cell Biol 115,1427-1436[Abstract/Free Full Text]
  23. Carver, W, Molano, I, Reaves, TA, Borg, TK, Terracio, L. (1995) Role of the alpha 1 beta 1 integrin complex in collagen gel contraction in vitro by fibroblasts J Cell Physiol 165,425-437[CrossRef][Medline][Order article via Infotrieve]
  24. Racine-Samson, L, Rockey, DC, Bissell, DM. (1997) The role of alpha1beta1 integrin in wound contraction: a quantitative analysis of liver myofibroblasts in vivo and in primary culture J Biol Chem 272,30911-30917[Abstract/Free Full Text]
  25. Kagami, S, Kondo, S, Loster, K, et al (1999) Alpha 1 beta 1 integrin-mediated collagen remodeling by rat mesangial cells is differentially regulated by transforming-growth factor-beta and platelet-derived growth factor-BB J Am Soc Nephrol 10,779-789[Abstract/Free Full Text]
  26. Niland, S, Cremer, A, Fluck, J, Eble, JA, Kreig, T, Sollberg, S. (2001) Contraction-dependent apoptosis of normal dermal fibroblasts J Invest Dermatol 116,686-692[CrossRef][Medline][Order article via Infotrieve]
  27. Ivaska, J, Reunanen, H, Westermarck, J, Koivisto, L, Kahari, VM, Heino, J. (1999) Integrin alpha2beta1 mediates isoform-specific activation of p38 and upregulation of collagen gene transcription by a mechanism involving the alpha2 cytoplasmic tail J Cell Biol 147,401-416[Abstract/Free Full Text]
  28. Nykvist, P, Tu, H, Ivaska, J, Kapyla, J, Pihlajaniemi, T, Heino, J. (2000) Distinct recognition of collagen subtypes by alpha(1)beta(1) and alpha(2)beta(1) integrins. Alpha(1)beta(1) mediates cell adhesion to type XIII collagen J Biol Chem 275,8255-8261[Abstract/Free Full Text]
  29. Klekotka, PA, Santoro, SA, Zutter, MM. (2001) alpha 2 integrin subunit cytoplasmic domain-dependent cellular migration requires p38 MAPK J Biol Chem 276,9503-9511[Abstract/Free Full Text]
  30. Miller, E, Rhodes, R. (1982) Preparation and characterization of the different types of collagen Methods Enzymol 82,33-64
  31. Guidry, C, Hohn, S, Hook, M. (1990) Endothelial cells secrete a factor that promotes fibroblast contraction of hydrated collagen gels J Cell Biol 110,519-528[Abstract/Free Full Text]
  32. Giegerich, R, Meyer, F, Schleiermacher, S. (1996) GeneFisher: software support for the detection of postulated genes Proceedings of the Fourth International Conference on Intelligent Systems for Molecular Biology ,68-77 AAAI Press Menlo Park, CA.
  33. Guidry, C, Grinnell, F. (1985) Studies on the mechanism of hydrated collagen gel reorganization by human skin fibroblasts J Cell Sci 79,67-81[Abstract]
  34. Hering, H, Koulen, P, Kroger, S. (2000) Distribution of the integrin beta 1 subunit on radial cells in the embryonic and adult avian retina J Comp Neurol 424,153-164[CrossRef][Medline][Order article via Infotrieve]
  35. Sherry, DM, Proske, PA. (2001) Localization of alpha integrin subunits in the neural retina of the tiger salamander Graefes Arch Clin Exp Ophthalmol 239,278-287[Medline][Order article via Infotrieve]
  36. Grisanti, S, Guidry, C. (1995) Transdifferentiation of retinal pigment epithelial cells from epithelial to mesenchymal phenotype Invest Ophthalmol Vis Sci 36,391-405[Abstract/Free Full Text]
  37. Mamballikalathil, I, Mann, C, Guidry, C. (2000) Tractional force generation by porcine Müller cells: paracrine stimulation by retinal pigment epithelium Invest Ophthalmol Vis Sci 41,529-536[Abstract/Free Full Text]
  38. Guidry, C, Hook, M. (1991) Endothelins produced by endothelial cells promote collagen gel contraction by fibroblasts J Cell Biol 115,873-880[Abstract/Free Full Text]
  39. Boulton, M, Gregor, Z, McLeod, D, et al (1997) Intravitreal growth factors in proliferative diabetic retinopathy: correlation with neovascular activity and glycaemic management Br J Ophthalmol 81,228-233[Abstract/Free Full Text]
  40. Robbins, SG, Brem, RB, Wilson, DJ, et al (1994) Immunolocalization of integrins in proliferative retinal membranes Invest Ophthalmol Vis Sci 35,3475-3485[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
IOVSHome page
C. Guidry, J. L. King, and J. O. Mason III
Fibrocontractive Muller Cell Phenotypes in Proliferative Diabetic Retinopathy
Invest. Ophthalmol. Vis. Sci., April 1, 2009; 50(4): 1929 - 1939.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S. Mukherjee and C. Guidry
The Insulin-Like Growth Factor System Modulates Retinal Pigment Epithelial Cell Tractional Force Generation
Invest. Ophthalmol. Vis. Sci., April 1, 2007; 48(4): 1892 - 1899.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
C. Fuchs, V. Forster, E. Balse, J.-A. Sahel, S. Picaud, and L.-H. Tessier
Retinal-Cell-Conditioned Medium Prevents TNF-{alpha}-Induced Apoptosis of Purified Ganglion Cells
Invest. Ophthalmol. Vis. Sci., August 1, 2005; 46(8): 2983 - 2991.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
J. L. King and C. Guidry
Muller Cell Production of Insulin-like Growth Factor-Binding Proteins In Vitro: Modulation with Phenotype and Growth Factor Stimulation
Invest. Ophthalmol. Vis. Sci., December 1, 2004; 45(12): 4535 - 4542.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
D. S. Wall, R. L. Gendron, W. V. Good, E. Miskiewicz, M. Woodland, K. Leblanc, and H. Paradis
Conditional Knockdown of Tubedown-1 in Endothelial Cells Leads to Neovascular Retinopathy
Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3704 - 3712.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. Guidry, R. Feist, R. Morris, and C. W. Hardwick
Changes in IGF Activities in Human Diabetic Vitreous
Diabetes, September 1, 2004; 53(9): 2428 - 2435.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
J. L. King and C. Guidry
Insulin-Like Growth Factor Binding Proteins Modulate Muller Cell Responses to Insulin-Like Growth Factors
Invest. Ophthalmol. Vis. Sci., August 1, 2004; 45(8): 2848 - 2855.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
R. J. Casson, G. Chidlow, J. P. M. Wood, M. Vidal-Sanz, and N. N. Osborne
The Effect of Retinal Ganglion Cell Injury on Light-Induced Photoreceptor Degeneration
Invest. Ophthalmol. Vis. Sci., February 1, 2004; 45(2): 685 - 693.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guidry, C.
Right arrow Articles by King, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guidry, C.
Right arrow Articles by King, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS