IOVS AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2003;44:1837-1842.)
© 2003 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.02-0853

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murthy, R. C.
Right arrow Articles by Stout, J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murthy, R. C.
Right arrow Articles by Stout, J. T.

Corneal Transduction to Inhibit Angiogenesis and Graft Failure

Raghu C. Murthy,1 Trevor J. McFarland,1 Jon Yoken,1 Sandy Chen,1 Chris Barone,1 Dorthea Burke,1 Yi Zhang,1 Binoy Appukuttan,1 and J. Timothy Stout1

1From the Clayton Gene Therapy Laboratory, Casey Eye Institute, Oregon Health Sciences University, Portland, Oregon.


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
PURPOSE. To test whether lentivirus-mediated expression of an endostatin::kringle-5 (E::K-5) fusion gene has an inhibitory effect on neovascularization and failure of corneal transplants.

METHODS. A lentiviral vector containing a fusion transgene comprising the human endostatin gene and the kringle-5 domain of the human plasminogen gene (E::K-5) was used for transduction of corneal buttons ex vivo. The corneal buttons were transplanted after overnight incubation in media containing either lentivirus or PBS. Sixteen rabbits underwent allogenic penetrating keratoplasty in one eye. The area of neovascularization from the limbus to within the graft was documented after surgery. RT-PCR was performed to demonstrate the presence of transgene mRNA within the graft. Histopathology was used to analyze neovascularization, inflammation, and rejection morphology.

RESULTS. Less neovascularization was observed in corneas treated with the lentivirus E::K-5 fusion vector. Early onset and profound neovascularization was observed in control eyes. E::K-5-treated animals did not have graft failure, whereas five of the six control animals had graft failure, as classified by opacification of the graft. All E::K-5 transduced corneas tested were positive by RT-PCR for the unique fusion gene sequence. Histopathology corroborated a significant increase of blood vessel presence and inflammatory reaction in control compared with treated eyes.

CONCLUSIONS. Corneas transduced with a lentivirus containing an endostatin::kringle-5 fusion gene demonstrated an inhibition of neovascularization and graft failure. E::K-5 gene transduction through a lentiviral vector system may be a useful adjunct to prevent graft neovascularization and corneal graft rejection in high-risk corneal transplants with antecedent rejection or neovascularization.


More than 30,000 corneal transplantations are performed each year in the United States—more than all heart, kidney, and liver transplantations.1 Corneal transplantation (or penetrating keratoplasty, PK) is one of the most successful of such operations in humans, with success exceeding 90%. Still, a significant number of corneal transplantations end in rejection and graft failure every year. The need for regrafting a failed transplant is one of the top two indications for corneal transplantation in many centers in the United States, competing with pseudophakic bullous keratopathy in frequency.2 The major risk factors for rejection are prior corneal transplantation, glaucoma, and preoperative corneal vascularization.3 Prevention of corneal neovascularization would be a pivotal step toward inhibiting graft failure and rejection.

Endothelial cell migration, proliferation, and modification of the extracellular matrix are all involved in angiogenesis. Molecules that stimulate or inhibit vessel growth modulate angiogenesis.4 A variety of pathologic states can result from a decreased production of inhibitors or an increased production of stimulators.4 For example, an elevated level of vascular endothelial growth factor (VEGF) is associated with the abnormal neovascularization in diabetic retinopathy.5 The development of a biological agent to combat proangiogenic stimulation would be a useful tool. Prior attempts to inhibit rejection have included ex vivo gene therapy in a sheep corneal transplantation model.6 Donor grafts were transduced with an adenovirus-mediated delivery system with a gene encoding IL-10, which downregulates some of the steps in the cascade of cell-mediated immunity. These animals showed prolonged corneal allograft survival.

Endostatin, a 20-kDa C-terminal fragment of collagen XVIII (Fig. 1) has been shown to be an endogenous inhibitor of angiogenesis and tumor growth in a hemangioendothelioma model in rats.7 Endostatin impedes proliferation and migration by downregulating the expression of genes involved in cell growth, antiapoptosis, and angiogenesis, specifically within endothelial cells.8 Endostatin has also been reported to inhibit cell matrix adhesion in endothelial cells and to promote a G1 arrest through inhibition of cyclin D1.9 10 Angiostatin, a protein derived from proteolytic cleavage of an internal fragment of plasminogen (Fig. 1) , containing up to four kringle domains, inhibits angiogenesis-dependent tumor growth.11 12 Kringle-5 of plasminogen shares 46% to 57% amino acid identity to each of the four kringle domains of angiostatin and is a more potent inhibitor of basic fibroblast growth factor (bFGF)-stimulated angiogenesis than is angiostatin alone.13 Kringle-5 acts specifically on endothelial cells by inhibiting cell migration, although the exact mechanism has not been fully elucidated.14 Reports have implied that interactions between angiostatin and integrin {alpha}vß3 (an integrin common to immature, newly synthesized vessels), and caveolin-1 may be essential components in this process.15 16 The angiostatic fusion protein consisting of mouse endostatin and mouse angiostatin has been shown to have a more potent biological effect than either gene product alone in an in vitro cancer model.17 In the current study, the biologically active domains of human endostatin 18 and human kringle-5 were linked to make the fusion protein E::K-5 for the purpose of producing a protein able to inhibit both endothelial cell proliferation and migration.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 1. Diagram of the proteins plasminogen and collagen XVIII. The fusion protein E::K-5 was derived from the kringle 5 domain of plasminogen and the cleaved product endostatin 18 of collagen XVIII.

 
Lentiviral vectors are efficient at transducing a number of target cells, have a large transgene-carrying capacity, and exhibit early-onset expression. As a result of proviral integration into the host genome, sustained long-term expression is achieved in many tissue types, including nondividing cells.18 19 In a previous study, we confirmed that a lentivirus containing a reporter gene transduces all cornea cell types efficiently, and expression is persistent in corneal cultures maintained up to 60 days.20 To study the neovascularization and rejection of corneal transplants, we used a rabbit model of allogenic corneal transplantation.

Prior studies have documented a high rate of transplant rejection in rabbits with retained graft-host sutures after PK.21 In this study we investigated the ability of a lentiviral vector to deliver a potentially antiangiogenic fusion gene to donor corneal buttons and to correlate successful transduction and grafting with postoperative neovascularization and graft failure.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Lentivirus Production
An endostatin-kringle-5 (E::Kr5) fusion cDNA was amplified by PCR from the E::Kr5 pBlast vector (InvivoGen, San Diego, CA) using the forward primer (5'CTGAGGGATCCGGCGAAGGAG3') containing a BamHI site and the reverse primer (5'CAATGTATCGGATCCTGTCGAGCTAGC3') containing a BamHI site. This fusion gene encodes 20 amino acids from the human IL-2 secretion signal, amino acids Ala1333 to Lys1516 from the human collagen XVIII gene (endostatin), an 8-amino-acid elastin linker motif VPGVGTAS, and amino acids Pro466 to Asp566 from the human plasminogen gene. The PCR fragment was digested with BamHI and ligated into the lentiviral vector pHR', under the transcriptional control of the cytomegalovirus (CMV) promoter (Fig. 2) . Construction of the E::Kr5 fusion gene was confirmed by direct sequencing of the transgene insert. Replication-deficient E::Kr5 lentivirus particles were prepared as previously described.19 Virus particles were resuspended in a minimal volume of PBS and stored at -80°C.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 2. Plasmid map of the lentiviral vector containing the cytomegalovirus (CMV) promoter, E::K-5 fusion cDNA, internal ribosomal entry site (ires), and the enhanced green fluorescent protein (eGFP) cDNA. Restriction enzymes used for cloning are highlighted (map created with Redasoft Visual Cloning 2000; Redasoft Corp. Toronto, Ontario, Canada).

 
Viral Assay
The presence of virus particles was confirmed with a quantitative HIV-1 p24 antigen ELISA kit (ZeptoMetrix, Buffalo, NY), according to the manufacturer’s instructions. To ensure the infectivity of the lentiviral reagent, 10, 50, and 100 µL of virus was placed into a six-well plate of human dermal microvascular endothelial cells (HDMECs) for 20 minutes at 37°C. Medium 131 (Cascade Biologicals, Portland, OR) was then added, and cells were incubated at 37°C 5% CO2 for 5 days, with medium changes every other day. On day 5, RNA was isolated with extraction reagent (TRIzol; Gibco-BRL, Grand Island, NY), and standard RT-PCR reactions and analyses were performed. The forward primer (5'TCTGAGGGTCCGCTGAAGCCCGGGG3') and reverse primer (5'CAAATGAAGGGGCCGCAC3') flanked the elastin linker region and thus amplified only the fusion transcript.

Corneal Transduction
All animal procedures were performed under Institutional Animal Care and Use Committee (IACUC)-approved protocols, which conform to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research standard for humane animal care. Sixteen 7-mm trephined donor corneas were obtained from eight New Zealand White rabbits. Each button was harvested in a sterile surgical fashion and placed in 2-mL of corneal storage medium containing chondroitin sulfate dextran medium supplemented with 100 µg/mL gentamicin and 200 µg/mL streptomycin sulfate (Optisol-GS; Chiron, Irvine, CA). The medium was spiked with 50 µL E::K-5 lentivirus, 50 µL enhanced green fluorescent protein (eGFP) lentivirus, or 50 µL PBS. These buttons were incubated for 18 hours at 37°C.

Corneal Transplantation in Rabbits
General anesthesia was induced by mask administration of isoflurane. Heparin and viscoelastic were instilled by paracentesis into the anterior chamber (AC). A 7-mm Hessburg-Barron trephine (Jedmed Instruments, St. Louis, MO) was used to remove the host corneal button. A 7-mm-trephined corneal button previously treated with EK-5, eGFP, or PBS was rinsed in balanced salt solution (BSS, Alcon Laboratories, Fort Worth, TX) and grafted with 16 interrupted 7-0 nylon sutures. Subconjunctival injections (0 0.1 mL) of enrofloxacin (23 mg/mL, Baytril; Bayer Animal Health, Shawnee Mission, KS) and 40 mg/mL triamcinolone (Kenalog; Westwood Squibb Pharmaceuticals, Buffalo, NY) were given. After surgery, all animals received a single dose of topical atropine (1%) and a single dose of carprofen (Rimadyl; Pfizer, New York, NY) at 2.5 mg/kg administered subcutaneously, as well as 1 drop tobramycin twice daily for 5 days and buprenorphine (Buprenex; Reckitt Benckiser Pharmacy, Hull, UK) at 0.1 mg/kg subcutaneously as necessary. No topical steroid drops were administered after surgery.

Measurement of Neovascularization and Evaluation of Graft Rejection
Neovascularization was followed by slit lamp examinations on postoperative days 5, 9, 12, 14, 16, 24, 28, and 36. Measurements of neovascularization were made with a portable slit lamp by a single masked observer, an ophthalmologist. Vessel growth onto the clear cornea was noted in millimeters and number of clock hours. Neovascularization was quantified by calculating the wedge-shaped area of vessel growth with the formula: A = (clock hours/12)[{pi}(R2 - R22], where R is the total radius and R2 is the radius from the center to the border of vessel growth. Graft rejection was evaluated by portable slit lamp. Graft failure was judged by the presence of persistent corneal graft edema with opacification of 100% of the graft. Serial photographs of the cornea were taken. Animals were killed on postoperative days 9, 21,30, and 40. Fresh corneal tissue was placed in either extraction reagent (TRIzol; Gibco-BRL) for RT-PCR or formalin for histopathologic study.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
A fusion cDNA coding for the 20 amino acids of human IL-2 secretion signal, human endostatin (derived from the 184 amino acids of the carboxyl terminus of collagen XVIII), an 8-amino-acid elastin linker sequence, and the 101 amino acids of human plasminogen (corresponding to the fifth kringle domain) was successfully cloned into the pHR' CMV-IRES-eGFP vector. Quantitative ELISA confirmed presence of virus particles and based on standard curve interpolation, 230 pg/mL of antigen was detected, correlating to approximately 108 virus particles/mL (Zeptometrix). Transcription of the fusion gene was verified by RT-PCR of transduced HDMECs (data not shown).

Postoperative corneal neovascularization was significantly lower in E::K-5 lentivirus-treated eyes than in either eGFP lentivirus- or PBS-treated control eyes on postoperative days 5, 12, 14, 16, 18, 24, 28, and 36 (Fig. 3) .



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 3. Quantitative analysis of the area of neovascularization (NV). (A) Average area (av) ± SD of NV in postoperative E::K-5- and control-treated corneas at each time point studied. The average total area of rabbit corneas was 143 mm2. Only one subject (treated with eGFP) had a surviving graft at day 36; therefore, there was no deviation. (B) Standard t-test using a one-tailed distribution comparing results obtained with E::K-5 with those obtained with eGFP or PBS. Differences in average area of NV are significant at all time points (P = 0.05 or less), with the exception of eGFP at day 9.

 
All PBS- and all eGFP lentivirus-treated corneas exhibited neovascular arborization into the graft bed (Fig. 4B 4C 4D 4G) . Vascularization in all control animals was relatively unchanged after postoperative day 9. None of the 10 E::K-5-treated corneas had new vessels extending into the graft (Fig. 4E 4F) . Three of 3 PBS-treated and 2 of 3 eGFP-treated corneas exhibited corneal opacification and graft failure (Figs. 4B 4D 4G) , whereas none of the 10 E::K-5-treated grafts completely opacified or failed by postoperative day 39 (Fig. 4F) . PBS-treated control corneas exhibited graft failure by postoperative days 14 and 18, and eGFP-treated corneas by day 24, with the exception of one eGFP-treated control, which remained stable for the duration of the experiment (day 36). All five grafts tested by RT-PCR for the presence of fusion gene transcripts were positive on postoperative days 30 and 40 (Fig. 5A 5B) . All control and nonsurgical eyes were negative, according to fusion gene RT-PCR.



View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 4. Representative photographs of neovascularization and graft failure from corneal buttons treated with either E::K-5 or control (eGFP or PBS). (A) Postoperative day (PD)0 graft treated with E::K-5. (B) PD14, eGFP-treated control showing infiltration of new vessels and corneal opacification and (C) dense neovascularization. (D) PD15, PBS-treated control showing opacified graft with vessel growth spanning the donor-host border. (E) PD18, E::K-5-treated graft showing absence of neovascularization extending across the graft border and clarity of the graft. (F) PD40, E::K-5-treated graft showing minimal if any neovascularization. (G) PD40, PBS-treated control showing opaque graft with new vessels extending into the graft.

 


View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 5. In vivo RT-PCR demonstrating transcription of E::K-5 in corneal buttons. Only the right eyes received corneal transplants; left eyes were not altered. (A, top and middle) Day 30: lanes 1, 3, 5, 7, and 9: E::K-5-positive right-eye grafts; lanes 2, 4, 6, 8, and 10: left-eye control; lane 11: RT-negative control; lane 12: PCR-negative control; lane 13: E::K-5 cDNA-positive control. (A, bottom) ß-Actin mRNA controls for lanes 18. (B) Day 40 harvest: lane 1: E::K-5 RT-PCR-positive button; lane 2: contralateral control; lanes 3 and 4: ß-actin control. (A, B) Lane M: molecular weight markers.

 
Analysis of serial sections revealed more neovascularization and basophilic inflammatory infiltrates in control eyes than in E::K-5-treated or nonsurgical eyes. Histopathologic study of a site of retained suture, often the location of an inflammatory infiltrate, was void of inflammatory cells in the examined E::K-5-treated cornea (Fig. 6C) .



View larger version (117K):
[in this window]
[in a new window]
 
FIGURE 6. Corneal histopathology at postoperative day (PD)40 after E::K-5 and control treatments. (A) Naive cornea (normal). (B, C, D) E::L-5-treated buttons showing tissue devoid of vessel proliferation with only a slightly elevated presence of immune infiltrates (basophils). (E, F, G) eGFP-treated control samples showing an increased presence of immune cells and many blood vessels. (H, I) PBS-treated control samples, with appearance similar to that of the eGFP sections, with increased immune cell presence and vessels apparent in the stroma.

 

    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
The success of corneal transplantation has expanded the indications for this surgery and has increased the number of keratoplasties performed annually. Despite advances in corneal transplantation, such as enhanced storage media and improved donor requirements, graft rejection remains a major problem.22 A major risk factor for graft rejection is neovascularization of the recipient corneal bed, the graft-host interface, or subsequently of the graft itself. The development of new blood vessels extending into the graft is associated with high levels of inflammatory cells, plasma proteins, and cytokines within the graft and is often a presage of rejection and failure. Believing that corneal neovascularization promotes rejection, investigators have long sought medical or surgical approaches to abort the process.

We describe a successful approach to inhibiting the development of post-PK neovascularization in a rabbit model. This approach is based on the ability of lentiviral vectors to transduce corneal tissues ex vivo, with genes known to be antiangiogenic in animal models of tumor angiogenesis. We tested a fusion gene that combines the human endostatin gene and the fifth kringle element of the human plasminogen gene as an inhibitor of new blood vessel growth. These moieties are preceded by the IL-2 secretory signal and are fused by an elastin linker motif. Once transduced, corneal tissues demonstrated a significantly decreased propensity for postoperative neovascularization.

Treatment of corneal buttons with E::K-5 by lentiviral vector prevented new vessel growth onto the donor graft in all treated corneas. Histologic study revealed a marked decrease in inflammation in E::K-5-treated corneas, including the areas around retained sutures, a commonly inflamed area. Furthermore, there was no evidence of graft failure, as measured by persistent corneal edema and corneal opacification in E::K-5-treated corneas, whereas five of six control corneas exhibited evidence of opacification and failure.

Corneas expressing E::K5 are less vascularized and less inflamed than control corneas, however, the mechanism of inhibition is not clear. Disruption of {alpha}vß3 integrin distribution, expression of caveolin-1, or levels of cyclin D1 or changes in the levels of tyrosine phosphorylation of focal adhesion kinase and paxillin may independently or in combination have a role in this result.9 10 15 16

The ability of the fusion protein E::K-5 to retard new blood vessel growth may be augmented by its potentially bifunctional structure. Endostatin has been shown to inhibit new vessel growth in solid tumors in a rat hemangioendothelioma model.7 Kringle-5 is a specific inhibitor of endothelial cell proliferation in bovine capillary cells and prevents migration of endothelial cells in a number of cell cultures stimulated by bFGF.14 Endostatin and angiostatin proteins given together have been shown to cause more regression of blood vessels and ovarian cancer cells in an experimental model, than when administered individually.23 24 Similarly, these two proteins, when given together in an Fc-angiostatin plus Fc-endostatin combination, resulted in a significant reduction of tumor size in Ripa1-Tag2 mice; given separately, they had a markedly reduced effect.25 We wanted to test a potentially bifunctional protein that combines the antiangiogenic domains of collagen XVIII and plasminogen, as an inhibitor of corneal angiogenesis.

Although the lentiviral vectors used are replication defective, questions about the safety of genetic transduction are important and appropriate. Transduction of corneal tissue ex vivo is an attractive alternative to somatic in vivo therapy. Inducible control of transgene expression may also be beneficial. Tetracycline-regulated promoters have been used in the past as a system for controlling gene expression by exogenous administration of tetracycline and should be evaluated.26 27 Our data suggest that ex vivo lentiviral transduction of donor corneal tissue with a fusion antiangiogenic gene, before PK, may increase the likelihood of long-term graft survival and be a useful surgical adjunct.


    Footnotes
 
2 Contributed equally to the work and therefore should be considered equivalent senior authors. Back

Supported by the Clayton Foundation for Research, Research to Prevent Blindness, and the Heed Ophthalmic Foundation.

Submitted for publication August 20, 2002; revised October 1, 2002; accepted November 7, 2002.

Disclosure: R.C. Murthy, None; T.J. McFarland, None; J. Yoken, None; S. Chen, None; C. Barone, None; D. Burke, None; Y. Zhang, None; B. Appukuttan, None; J.T.Stout, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: J. Timothy Stout, Casey Eye Institute, 3375 SW Terwilliger Boulevard, Portland, OR 97201; stoutt{at}ohsu.edu.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. . Council on Scientific Affair (1988) Report of the organ transplant panel: corneal transplantation JAMA 259,719-722[Abstract/Free Full Text]
  2. Flowers, CW, Chang, KY, McLeod, SD, et al (1995) Changing indications for penetrating keratoplasty, 1989–1993 Cornea 14,583-588[Medline][Order article via Infotrieve]
  3. Price, FW, Jr, Whitson, WE, Johns, S, Gonzales, JS. (1996) Risk factors for corneal graft failure J Refractive Surg 12,134-143[Medline][Order article via Infotrieve]
  4. Carmeliet, P, Jain, RK. (2000) Angiogenesis in cancer and other diseases (Review) Nature 407,249-257[CrossRef][Medline][Order article via Infotrieve]
  5. Adamis, AP, Miller, JW, Bernal, MT, et al (1994) Increased vascular endothelial growth factor (VEGF) levels in the vitreous of eyes with proliferative diabetic retinopathy Am J Ophthalmol 118,445-450[Medline][Order article via Infotrieve]
  6. Klebe, S, Sykes, PJ, Coster, DJ, et al (2001) Prolongation of sheep corneal allograft survival by ex vivo transfer of the gene encoding interleukin-10 Transplantation 71,1214-1220[CrossRef][Medline][Order article via Infotrieve]
  7. O’Reilly, MS, Boehm, T, Shing, Y, et al (1997) Endostatin: an endogenous inhibitor of angiogenesis and tumor growth Cell 88,277-285[CrossRef][Medline][Order article via Infotrieve]
  8. Shichiri, M, Hirata, Y. (2001) Antiangiogenesis signals by endostatin FASEB J 15,1044-1053[Abstract/Free Full Text]
  9. Dixelius, J, Cross, M, Matsumoto, T, Sasaki, T, Timpl, R, Claesson-Welsh, L. (2002) Endostatin regulates endothelial cell adhesion and cytoskeletal organization Cancer Res 62,1944-1947[Abstract/Free Full Text]
  10. Hanai, J, Dhanabal, M, Karumanchi, SA, et al (2002) Endostatin causes G1 arrest of endothelial cells through inhibition of cyclin D1 J Biol Chem 277,16464-16469[Abstract/Free Full Text]
  11. O’Reilly, MS, Holmgren, L, Shing, Y, et al (1994) Angiostatin: a novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma Cell 79,315-328[CrossRef][Medline][Order article via Infotrieve]
  12. O’Reilly, MS (1997) Angiostatin: an endogenous inhibitor of angiogenesis and of tumor growth EXS 79,273-294[Medline][Order article via Infotrieve]
  13. Cao, Y, Chen, A, An, SSA, et al (1997) Kringle-5 of plasminogen is a novel inhibitor of endothelial cell growth J Biol Chem 272,22924-22928[Abstract/Free Full Text]
  14. Ji, W-R, Barrientos, LG, Llinas, M, et al (1998) Selective inhibition by kringle-5 of human plasminogen on endothelial cell migration, an important process in angiogenesis Biochem Biophys Res Commun 247,414-419[CrossRef][Medline][Order article via Infotrieve]
  15. Tarui, T, Miles, LA, Takada, Y. (2001) Specific interaction of angiostatin with integrin {alpha}vß3 in endothelial cells J Biol Chem 276,39562-39568[Abstract/Free Full Text]
  16. Liu, J, Razani, B, Tang, S, Terman, BI, Ware, JA, Lisanti, MP. (1999) Angiogenesis activators and inhibitors differentially regulate caveolin-1 expression and caveolae formation in vascular endothelial cells: angiogenesis inhibitors block vascular endothelial growth factor-induced down-regulation of caveolin-1 J Biol Chem 274,15781-15785[Abstract/Free Full Text]
  17. Hampl, M, Tanaka, T, Albert, PS, Lee, J, Ferrari, N, Fine, HA. (2001) Therapeutic effects of viral vector-mediated antiangiogenic gene transfer in malignant ascites Hum Gene Ther 12,1713-1729[CrossRef][Medline][Order article via Infotrieve]
  18. Akkina, RK, Walton, RM, Chen, ML, Li, QX, Planelles, V, Chen, IS. (1996) High efficiency gene transfer into cd34 (+) cells with a human immunodeficiency virus type 1-based retroviral vector pseudotyped with vesicular stomatitis virus envelope glycoprotein G J Virol 70,2581-2585[Abstract]
  19. Naldini, L, Blomer, U, Gallay, P, et al (1996) In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector Science 272,263-267[Abstract]
  20. Wang, X, Appukuttan, B, Ott, S, et al (2000) Efficient and sustained transgene expression in human corneal cells mediated by a lentiviral vector Gene Ther 7,196-200[CrossRef][Medline][Order article via Infotrieve]
  21. Khodadoust, A. (1968) Penetrating keratoplasty in the rabbit Am J Ophthalmol 66,899-905[Medline][Order article via Infotrieve]
  22. Wilson, SE, Kaufmann, HE. (1990) Graft failure after penetrating keratoplasty Surv Ophthalmol 34,325-356[CrossRef][Medline][Order article via Infotrieve]
  23. Yokoyama, Y, Dhanabal, M, Griffioen, AW, Sukhatme, VP, Ramakrishnan, S. (2000) Synergy between angiostatin and endostatin: inhibition of ovarian cancer growth Cancer Res 60,2190-2196[Abstract/Free Full Text]
  24. Scappaticci, FA, Smith, R, Pathak, A, et al (2000) Combination angiostatin and endostatin gene transfer induces synergistic antiangiogenic activity in vitro and antitumor efficacy in leukemia and solid tumors in mice Mol Ther 3,186-196
  25. Bergers, G, Javaherian, K, Lo, KM, Folkman, J, Hanahan, D. (1999) Effects of angiogenesis inhibitors on multistage carcinogenesis in mice Science 284,808-812[Abstract/Free Full Text]
  26. Kafri, T, Praag, HV, Gage, FH, Verma, M. (2000) Lentiviral vectors: regulated gene expression Mol Ther 1,516-521[CrossRef][Medline][Order article via Infotrieve]
  27. Apparailly, F, Millet, V, Noel, D, Jacquet, C, Sany, J, Jorgensen, C. (2002) Tetracycline-inducible interleukin-10 gene transfer mediated by an adeno-associated virus: application to experimental arthritis Hum Gene Ther 13,1179-1188[CrossRef][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
IOVSHome page
E. Sekiyama, T. Nakamura, L. J. Cooper, S. Kawasaki, J. Hamuro, N. J. Fullwood, and S. Kinoshita
Unique distribution of thrombospondin-1 in human ocular surface epithelium.
Invest. Ophthalmol. Vis. Sci., April 1, 2006; 47(4): 1352 - 1358.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Z. Zhang, J.-x. Ma, G. Gao, C. Li, L. Luo, M. Zhang, W. Yang, A. Jiang, W. Kuang, L. Xu, et al.
Plasminogen Kringle 5 Inhibits Alkali-Burn-Induced Corneal Neovascularization
Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4062 - 4071.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Klebe, D. J. Coster, P. J. Sykes, S. Swinburne, P. Hallsworth, J.-P. Y. Scheerlinck, R. Krishnan, and K. A. Williams
Prolongation of Sheep Corneal Allograft Survival by Transfer of the Gene Encoding Ovine IL-12-p40 but Not IL-4 to Donor Corneal Endothelium
J. Immunol., August 15, 2005; 175(4): 2219 - 2226.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murthy, R. C.
Right arrow Articles by Stout, J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murthy, R. C.
Right arrow Articles by Stout, J. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS