IOVS Journal of Experimental Medicine
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2003;44:1879-1887.)
© 2003 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.02-0860

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blalock, T. D.
Right arrow Articles by Schultz, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blalock, T. D.
Right arrow Articles by Schultz, G. S.

Connective Tissue Growth Factor Expression and Action in Human Corneal Fibroblast Cultures and Rat Corneas after Photorefractive Keratectomy

Timothy D. Blalock,1 Matthew R. Duncan,2 Juan C. Varela,1 Michael H. Goldstein,3 Sonal S. Tuli,3 Gary R. Grotendorst,2 and Gregory S. Schultz1

1From the Institute for Wound Research and the 3Department of Ophthalmology, University of Florida, Gainesville, Florida; and the 2Department of Cell Biology and Anatomy, University of Miami, Miami, Florida.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Connective tissue growth factor (CTGF) has been linked to fibrosis in several tissues. In this study, the interactions between CTGF and transforming growth factor (TGF)-ß were assessed in human corneal fibroblasts, and the levels and location of CTGF protein and mRNA were measured during healing of excimer laser ablation wounds in rat corneas.

METHODS. Human corneal fibroblasts were incubated with TGF-ß1, -ß2, and -ß3 isoforms, and CTGF mRNA and protein were measured. CTGF was immunolocalized in the cultured fibroblasts by using a specific antibody. Regulation of collagen synthesis by TGF-ß and CTGF was assessed in human corneal fibroblasts with a neutralizing antibody and an antisense oligonucleotide to CTGF. CTGF mRNA and protein were measured in rat corneas up to day 21 after excimer ablation of the cornea. CTGF protein was immunolocalized in rat corneas after photorefractive keratectomy (PRK), and the presence of CTGF mRNA and protein in ex vivo rat corneal scrapings was established.

RESULTS. All three TGF-ß isoforms stimulated expression of CTGF in human corneal fibroblasts, and CTGF was immunolocalized in the cells. Both TGF-ß and CTGF increased collagen synthesis in corneal fibroblasts. Furthermore, CTGF antibody or antisense oligonucleotide blocked TGF-ß–stimulated collagen synthesis. CTGF protein and mRNA increased in rat corneas through day 21 after PRK. CTGF expression was also detected in ex vivo scrapings of rat corneas.

CONCLUSIONS. These data demonstrate that CTGF is expressed by corneal cells after stimulation by TGF-ß, that CTGF expression increases significantly during corneal wound healing, and that CTGF mediates the effects of TGF-ß induction of collagen synthesis by corneal fibroblasts. These data support the hypothesis that CTGF promotes corneal scar formation and imply that regulating CTGF synthesis and action may be an important goal for reducing corneal scarring.


Connective tissue growth factor (CTGF) is a secreted, cysteine-rich monomer of approximately 38 kDa that was originally identified as a mitogen for fibroblast in conditioned media cultures from human umbilical vein endothelial cells.1 2 3 CTGF belongs to the CCN (CTGF, Cyr61/Cef10, neuroblastoma overexpressed gene [Nov]) family of secreted cysteine-rich proteins, which possess important growth regulatory functions and are involved in cell differentiation.4 5 6 However, the most important biological action of CTGF may be in stimulating synthesis of extracellular matrix components. When added to cultured human skin fibroblasts, CTGF dramatically increases synthesis of collagen, integrin, and fibronectin,3 and subcutaneous injections of CTGF into mice produce granulation tissue and fibrosis in the skin.7 These findings led to investigation of the possible role of CTGF in fibrotic diseases. CTGF mRNA was significantly elevated in the left ventricles of rat hearts after myocardial infarction, which correlated well with concomitant increases in fibronectin and type I and type III collagen mRNA levels and development of cardiac fibrosis in the animal hearts.8 Significant upregulation of CTGF was detected in human heart samples derived from patients with cardiac ischemia. Elevated CTGF protein and mRNA levels were found in sclerotic skin fibroblasts,9 specimens of inflammatory bowel disease,10 and retrocorneal membranes,11 and overexpression of CTGF was linked to human renal fibrosis.12

The transforming growth factor (TGF)-ß system13 14 has also been implicated in promoting scarring and fibrosis in numerous tissues, including lung,15 kidney,16 liver,17 and pancreas.18 Furthermore, agents that reduce the activity of the TGF-ß system by selectively targeting TGF-ß or its receptors reduce scarring in several animal models of tissue fibrosis.17 19 20 Recently, two important links between CTGF and the TGF-ß system have been reported that add weight to the concept that CTGF plays important roles in scarring. First, TGF-ß1 induces synthesis of CTGF in cultured normal rat kidney fibroblasts,7 and second, neutralizing antibodies to CTGF block collagen synthesis induced by TGF-ß in rat and human fibroblasts.21 These results indicate that CTGF could be a downstream mediator of some of the scarring effects of TGF-ß.

The CTGF system has not been investigated in corneal wound healing. To help assess our hypothesis that CTGF regulates corneal scarring, we investigated the influence of TGF-ß isoforms on expression of CTGF in human corneal fibroblasts and the role of CTGF in mediating the effects of TGF-ß on CTGF levels and collagen synthesis by cultured human corneal fibroblasts. We measured the levels of CTGF protein and mRNA in rat corneas after PRK and localized CTGF in healing rat corneas.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture
Cultures of human corneal fibroblasts were established by outgrowth from corneal explants, as described previously.22 Briefly, epithelial and endothelial cells were removed from corneas that were unsuitable for corneal transplantation, the stroma was cut into cubes of approximately 1 mm3, placed in culture medium consisting of equal parts Dulbecco’s modified Eagle’s medium (DMEM), medium 199 (Gibco BRL, Grand Island, NY), and Ham’s F12 nutrient mixture (Gibco BRL) containing 1 mM NaHCO3 and buffered with 25 mM HEPES at pH 7.4. The medium was supplemented with 10% heat-inactivated normal calf serum and 1x antibiotic-antimycotic (Gibco BRL). Cell from cultures between passages 2 and 5 were used for all experiments.

Induction of CTGF by TGF-ß Isoforms in Human Corneal Fibroblast Cultures
Cultures of corneal fibroblasts were washed and placed in serum-free medium for 24 hours, and then the medium was replaced by three different concentrations of TGF-ß1, -ß2, and -ß3 isoforms (0.1, 1.0, and 10 ng/mL; R&D Systems, Minneapolis, MN). After 48 hours of incubation, the conditioned media were removed and centrifuged and the supernatant solution frozen at -80°C until the samples were assayed for CTGF by ELISA, as described later. The cells in each well were also collected by scraping and frozen at -80°C and total RNA was isolated as described later for measurement of mRNA levels by quantitative RT-PCR (TaqMan; Applied Biosystems, Inc., Foster City, CA), as will be described. Each level of TGF-ß was assayed in three replicate wells, and results were analyzed with ANOVA, multivariate (M)ANOVA, and the Tukey honest significant difference (HSD) post hoc test.

CTGF Immunocytochemistry in Human Fibroblast Cultures
Human corneal fibroblasts were seeded into 48-well plates and grown to confluence in serum-supplemented medium. After incubation in serum-free medium containing insulin, transferrin, and selenious acid for 72 hours, fibroblasts were then cultured for an additional 48 hours with or without 5 ng/mL TGF-ß. Cells expressing CTGF were then detected immunohistologically using a standard avidin-biotin amplification method. Briefly, cells were fixed in cold 4% paraformaldehyde, permeabilized with Triton-X-100, and blocked with 2% milk and 10% horse serum. Fibroblasts were then sequentially incubated with goat anti-human CTGF for 1 hour at room temperature, washed three times with Tris-buffered saline (TBS), incubated with biotinylated horse anti-goat IgG secondary antibody (Vector Laboratories, Burlingame, CA), washed, incubated with alkaline phosphatase–conjugated streptavidin (Dako, Carpinteria, CA), washed, and incubated with alkaline phosphatase visualization substrate (Vector Red; Vector Laboratories). The goat anti-human CTGF antibody was raised against recombinant human CTGF protein and purified with a CTGF-affinity column as described previously.7 The antibody predominately recognizes antigenic determinants on the N-terminal sequence of CTGF.

Photorefractive Keratectomy
Animal procedures were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and was approved by the University of Florida Animal Care and Use Committee. Twenty adult Sprague–Dawley male rats (250 g) with normal eyes were anesthetized with an intraperitoneal injection of pentobarbital sodium (30 mg/kg). Eyelashes and whiskers surrounding the eye were removed from the visual field. A drop of proparacaine HCl (0.05%) was applied to the eye, and the cornea was centered under the laser microscope. Bilateral excimer laser photorefractive keratectomy was performed.23 Briefly, corneas were ablated in a 4.4-mm treatment zone with an excimer laser (SVS Apex; Summit Technology, Waltham, MA) in the phototherapeutic keratectomy mode. The corneal epithelium was ablated to a depth of 40 µm, followed by ablation of the stroma to a depth of 20 µm for a total ablation depth of 60 µm. After excimer laser treatment, tobramycin (0.3%) ointment was applied to the corneal surface to prevent infection. No postoperative topical steroid was administered. At 1, 3, 7, 11, 14, and 21 days after excimer laser ablation, rats were killed by peritoneal injection of pentobarbital. The corneas were excised under an operating microscope and snap frozen in liquid nitrogen, followed by storage at -80°C until analysis. Four rats were killed at each time point. Three rats from each time point were used for protein and RNA analyses. Corneas from the left eyes were used for protein analysis, and corneas from the right eyes were pooled and used to measure CTGF mRNA. One rat from each time point was used for immunohistochemistry. Eight corneas from four rats that did not undergo excimer ablation were used as the normal control (day 0).

Protein and RNA Extraction
Whole corneas or epithelial scrapings were homogenized in 200 µL PBS and 0.1% Triton-X-100 using a frosted glass-on-glass tissue grinder (Duall 22; Konte Scientific Glassware, Vineland, NJ). Tissue extracts were centrifuged at 4°C at 15,000g for 15 minutes to remove cellular debris and membranes. The supernatants were measured for CTGF protein levels by enzyme-linked immunosorbent assay (ELISA). Total RNA was extracted from pooled corneas by homogenization in extraction reagent (TRIzol; Invitrogen Life Technologies, Carlsbad, CA) using a frosted glass-on-glass tissue grinder. Total RNA was extracted from each sample by using chloroform, precipitated with isopropanol and washed with ethanol. RNA pellets were dissolved in diethylpyrocarbonate (DEPC)-treated water and stored at -80°C. RNA concentrations isolated from each group were measured by spectrophotometer (GeneQuant; Amersham/Pharmacia Biotech, Piscataway, NJ).

CTGF Sandwich ELISA
CTGF was measured in the conditioned medium of cultured cells and in tissue extracts by capture sandwich ELISA with biotinylated and nonbiotinylated affinity-purified goat polyclonal antibodies to human CTGF, which was produced with a baculovirus expression system, as described previously.21 Briefly, a flat-bottom ELISA plate (96-well; Corning Costar, Cambridge, MA) was coated with 50 µL of goat anti-human CTGF antibody, which recognizes predominately epitopes in the N-terminal half of the CTGF molecule at a concentration of 10 µg/mL in PBS and 0.02% sodium azide for 1 hour at 37°C. Wells were washed four times and incubated with 300 µL of blocking buffer (PBS, 0.02% sodium azide and 1% bovine serum albumin) for 1 hour at room temperature. This polyclonal antibody is appropriate for detection of rat CTGF, because there is a 92% amino acid identity between the sequences of rat and human CTGF in the N-terminal half of the peptide.24 The wells were washed four times, and 50 µL of recombinant human CTGF protein (from 0.1 ng/mL to 100 ng/mL) or sample was added and incubated at room temperature for 1 hour. After washing, 50 µL of biotinylated goat anti-human CTGF (2 µg/mL) was added and incubated at room temperature in the dark for 1 hour, then washed, and 50 µL of alkaline phosphatase-conjugated streptavidin (1.5 µg/mL; Zymed, South San Francisco, CA) was added and incubated at room temperature for 1 hour. The wells were washed again and incubated with 100 µL of alkaline phosphatase substrate solution (1 mg/mL p-nitrophenyl phosphate, Sigma Chemical Co., St. Louis, MO) in sodium carbonate, bicarbonate buffer and 0.02% sodium azide (pH 9.6). Absorbance at 405 nm was measured with a microplate reader (Molecular Devices, Sunnyvale, CA). CTGF levels were normalized for total protein content of samples by using bicinchoninic acid (BCA) protein assay reagent (Pierce Chemical Co., Rockford, IL) and were expressed as nanograms per milligram protein in three replicate samples for each condition. Sensitivity of the ELISA was 0.1 ng/mL with an intra-assay variability of 3%, which is similar to a previously published ELISA for CTGF.25

CTGF Real-Time Quantitative RT-PCR Procedure
CTGF mRNA transcripts were detected by a real-time quantitative RT-PCR procedure.26 This technique for measuring mRNA levels is based on the 5' exonuclease activity of Taq polymerase on DNA–DNA oligonucleotide complexes.27 In addition to gene-specific PCR primers, the kit (TaqMan; Applied Biosystems, Inc.) includes a reporter probe that is coupled to two fluorescent dye molecules at the 5' and 3' ends of the probe.28 A standard curve was generated with CTGF mRNA transcripts that were transcribed in vitro from a plasmid containing CTGF cDNA. Briefly, electrocompetent Escherichia coli cells (Stratagene, La Jolla, CA) were transformed with a plasmid (pRc/CMV; Invitrogen, Carlsbad, CA) containing the full-length cDNA for human CTGF, colonies were selected with ampicillin, and 1 µg of isolated plasmid was transcribed with an in vitro transcription kit (Ambion, Austin, TX). CTGF mRNA was precipitated with ethanol and dissolved in DEPC-treated water. Reactions were assembled in a 96-well optical reaction plate. Each reaction contained 1x master mix from the kit (TaqMan One-Step RT-PCR Master Mix; Applied Biosystems, Inc.), 900 nM forward primer (5'-AGCCGCCTCTGCATGGT-3'), 900 nM reverse primer (5'-CACTTCTTGCCCTTCTTAATGGTTCT-3'), 2 µM fluorescent probe (5'-6FAM-TTCCAGGTCAGCTTCGCAAGGCCT-TAMRA-3'), and RNA sample (CTGF mRNA standard or 500 ng of sample RNA) to a final volume of 25 µL per reaction. The plate was analyzed on a sequence-detection system (ABI Prism 5700 Sequence Detection System; Applied Biosystems, Inc.), which simultaneously performs RT-PCR and detects fluorescence signal. A standard curve was generated with the transcribed CTGF mRNA samples (2.3 x 10-2 to 2.3 x 10-6 pmol). The level of glyceraldehyde phosphate dehydrogenase (GAPDH) mRNA was also measured in each sample, with a kit (GAPDH Control Kit; Applied Biosystems, Foster City, CA), and the number of CTGF mRNA molecules in samples was expressed as picomoles of CTGF mRNA per nanomole of GAPDH mRNA. Levels of mRNA were expressed as mean ± SE of three replicate samples for each condition, and ANOVA and the Tukey HSD post hoc test were used to assess statistical significance between times and groups.

Collagen Synthesis Assay
Collagen synthesis by human corneal fibroblasts was measured by 3H-proline incorporation, as described previously.21 29 Briefly, cultures of human corneal fibroblasts were grown to confluence in serum-supplemented medium, incubated in serum-free medium for 24 hours, and incubated 24 hours with eight different supplements: (1) serum-free medium; (2) 10% serum; (3) serum-free medium with 5 ng/mL TGF-ß1; (4) 25 ng/mL CTGF; (5) 5 ng/mL TGF-ß1 with 50 µg/mL goat anti-CTGF; (6) 5 ng/mL TGF-ß1 and 50 µg/mL nonimmune goat IgG; (7) 5 ng/mL TGF-ß1 and 10 µM CTGF antisense oligonucleotide; and (8) 5 ng/mL TGF-ß1 and 10 µM control scrambled oligonucleotide.30 All treatments contained 50 µg/mL ascorbic acid and 1x insulin, transferrin, and selenious acid (ITS; Invitrogen Life Technologies) and 1-µCi tritiated proline (Amersham Biosciences, Arlington Heights, IL). The CTGF antisense oligonucleotide was a 20-mer with the sequence GCCAGAAAGCTCAAACTTGA that contained phosphorothioate ester backbone modifications with 2-O-methoxyethylribose groups coupled at base positions 1 to 6 and 16 to 20, and 5-methylcytosine substituted for all cytosines.30 The CTGF antisense oligonucleotide was identified by screening 81 separate 20-mer nucleotide sequences that span the mRNA sequence for reduction of CTGF mRNA in cultured mouse cells, with an RNase protection assay (data not shown). The scrambled 20-mer oligonucleotide control was a random mixture of AGCT bases. Addition of oligonucleotides to the culture medium penetrated membranes, accesses cellular mRNA, and reduces levels of target gene mRNA.31 Wells were incubated overnight with pepsin in 0.5 M acetic acid, carrier collagen was added, and the solution was centrifuged. The collagen was precipitated and washed with 0.1 M sodium chloride in 0.1 M acetic acid, and the radioactivity was measured with a beta scintillation counter. Results were expressed as counts per minute per well ± SE in six replicate wells.

Reverse Transcription–Polymerase Chain Reaction
Total RNA was extracted from epithelial cells obtained from ex vivo scrapings from six rat corneas, by extraction reagent (TRIzol), as described earlier, and RT-PCR was performed with a one-step RT-PCR kit (Invitrogen Life Technologies) to detect CTGF mRNA expression. Briefly, 10 µM of CTGF-specific forward primer (5'-AGTGTGCACTGCCAAAGATG-3') and reverse primer (5'-TTAGGTGTCCGGATGCACT-3') were added to 1 µg of total RNA isolated from the pooled rat epithelial cells along with reverse transcriptase, nucleotides, and buffer, and 35 cycles of amplification were completed using an annealing temperature of 58°C, an extension temperature of 72°C, and a dissociation temperature of 94°C. Control experiments included omitting the sample RNA, reverse transcriptase, or both reverse transcriptase and Taq polymerase. PCR products were visualized on a 1.5% agarose gel with ethidium bromide and isolated with a PCR purification kit (Qiagen, Valencia, CA). A unique restriction site (PstI) was used to cleave the predicted 503-bp product into 405- and 98-bp fragments before visualization.

CTGF Immunohistochemistry in Corneal Sections
Excised corneas from each time point were incubated in 4% para-formaldehyde and PBS overnight at 4°C and transferred to 70% ethanol. Paraffin-embedded sections were prepared and 5-µm-thick sections were mounted on microscopic slides (Superfrost/Plus; Fisher Scientific, Pittsburgh, PA). Slides were deparaffinized and rehydrated with xylene and a graded series of ethanol. Slides were blocked for 30 minutes at room temperature in TBS and 10% rabbit serum, incubated with affinity-purified goat anti-human CTGF (14 µg/mL) in TBS and 10% rabbit serum overnight at 4°C, washed, incubated with biotinylated rabbit anti-goat IgG in TBS and 10% rabbit serum, washed, and then incubated with alkaline phosphatase–conjugated streptavidin followed by alkaline phosphatase visualization substrate (Vector Red; Vector Laboratories). Sections were photographed with bright-field illumination, fluorescence microscopy with excitation and emission wavelengths for Texas red staining, and Nomarski phase-contrast microscopy at 200x magnification. Micrographs were taken at a constant exposure (430 ms) using a Peltier-cooled digital camera (Olympus, Lake Success, NY).


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Effect of TGF-ß Isoforms on Synthesis of CTGF mRNA and Protein in Human Corneal Fibroblast Cultures
All three TGF-ß isoforms induced significantly higher levels of CTGF protein in conditioned medium and mRNA in cultures of human corneal fibroblasts (Fig. 1) . Furthermore, the levels of induction of CTGF mRNA and protein were dependent on the dose of the TGF-ß isoforms. For example, the highest dose (10 ng/mL) of TGF-ß1, -ß2, and -ß3 increased CTGF protein production 70-, 200-, and 160-fold, respectively, compared with levels in cells cultured in serum-free medium (P < 0.001). Also, increasing concentrations of each isoform significantly increased levels of CTGF (P < 0.05). The largest increase in CTGF protein was produced by TGF-ß2, which produced an increase significantly higher than that produced by TGF-ß1 (P < 0.05).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of CTGF by human corneal fibroblasts was detected by ELISA, and mRNA was detected by quantitative RT-PCR assay. Cells were cultured in a 96-well plate with each group assayed in triplicate. The cells were grown to confluence and starved of serum for 24 hours, followed by 48-hour treatments as shown on the graph. Results are shown as nanograms CTGF per total milligrams of protein in conditioned medium for normalization or in picomoles of CTGF mRNA per nanomole GAPDH mRNA. Results are expressed as the mean ± SE.

 
All three TGF-ß isoforms also significantly increased levels of CTGF mRNA when compared with control cells incubated with serum-free medium. CTGF mRNA transcripts were detected at 10- to 45-fold increased levels on stimulation by TGF-ß isoforms (P < 0.001). The results of these experiments suggest that TGF-ß isoforms regulate CTGF expression at both the levels of transcription and translation. No significant difference between CTGF mRNA induced by the highest concentration of the three isoforms is noted. These data suggest that CTGF is regulated by TGF-ß isoforms at both the transcriptional and translational levels.

Role of CTGF in TGF-ß–Induced Collagen Synthesis in Human Corneal Fibroblast Cultures
The addition of 5 ng/mL of either TGF-ß1 or CTGF increased collagen synthesis approximately fourfold (Fig. 2) . However, the increase in collagen synthesis produced by TGF-ß1 was blocked 80% by a neutralizing goat anti-CTGF antibody and was blocked 92% by an antisense oligonucleotide directed to human CTGF (P < 0.001). The antibody was shown to be neutralizing by using the appropriate control, as shown previously.21 Blockage of collagen synthesis did not occur with addition of an irrelevant goat IgG or by scrambled oligonucleotides (P < 0.001). These experiments demonstrate that CTGF induced by TGF-ß mediates the increase in collagen synthesis when TGF-ß is added to cultures of human corneal fibroblasts. Because the antisense oligonucleotide and neutralizing antibody to CTGF did not reduce collagen synthesis to levels below that with serum-free cultures, CTGF does not appear to mediate the basal level of collagen synthesis of corneal fibroblasts grown on plastic. Furthermore, the effects of the neutralizing antibody and the antisense oligonucleotide are not due to nonspecific toxicity of the reagents.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 2. Collagen synthesis stimulation in human corneal fibroblasts by CTGF and TGF-beta. Collagen synthesis was examined by measuring 3H-proline incorporation. Cells were cultured in a 48-well plate with each group assayed six times. The cells were grown to confluence for 5 to 7 days and starved of serum for 24 hours followed by 24-hour treatments as shown on the graph. Amount of 3H-collagen is expressed as counts per minute per well. Results are expressed as the mean ± SE.

 
Effect of TGF-ß1 on Localization of CTGF Protein in Human Corneal Fibroblast Cultures
Intensity of immunostaining for CTGF was markedly increased in human corneal fibroblasts cultured for 48 hours with 5 ng/mL TGF-ß1, especially in the perinuclear region when compared with nonstimulated cells (Fig. 3) . This localization is most likely due to increased levels of newly synthesized CTGF protein in the Golgi and secretory pathway. Furthermore, CTGF immunostaining was detected in essentially all the fibroblasts, indicating that TGF-ß–induced CTGF synthesis is not restricted to a subpopulation of corneal fibroblasts.



View larger version (125K):
[in this window]
[in a new window]
 
FIGURE 3. Immunolocalization of CTGF in human corneal fibroblasts. Human corneal fibroblasts were grown to confluence and then rested in serum-free medium for 72 hours before stimulation with 5 ng/mL TGF-ß1 for 48 hours. The cells were fixed, followed by localization of CTGF using immunocytochemistry. Magnification: x100; insets: x400.

 
Effect of PRK on CTGF mRNA and Protein Levels in Rat Corneas
The experimental in vitro data described earlier established that TGF-ß induced CTGF synthesis and that CTGF mediated the effects of TGF-ß on collagen synthesis in cultures of human corneal fibroblasts. However, it is important to assess changes in levels of CTGF mRNA and protein change during healing of corneal wounds. As shown in Figure 4 , levels of CTGF mRNA and protein significantly increased in rat corneas at several time points after PRK. Specifically, levels of CTGF mRNA increased in the corneas beginning at day 3 after PRK, when compared with nonsurgical control corneas. Furthermore, the mRNA levels progressively increased and remained statistically higher than normal corneas through day 21, reaching approximately 1000-fold higher levels than in noninjured corneas.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 4. Expression of CTGF protein in rat corneas after PRK. Expression of CTGF protein was detected by ELISA, and mRNA was detected using a quantitative RT-PCR assay. Three corneas were analyzed for both protein and RNA at days 0, 1, 3, 7, 11, 14, and 21 after PRK. Results are shown as nanograms CTGF per total milligrams protein in the sample for normalization or as picomoles CTGF mRNA per nanomoles GAPDH mRNA. Results are expressed as the mean ± SE.

 
Levels of CTGF protein tended to decrease during the first 3 days after PRK, perhaps reflecting fewer epithelial cells in the healing corneas. Beginning at day 7 after surgery, levels of CTGF protein increased dramatically, slightly after mRNA levels began to increase in the corneas, and continued to increase through day 21 after surgery, reaching approximately 10-fold higher levels than in noninjured corneas. By day 21, all corneas showed significant corneal haze, corresponding with elevated levels of CTGF. These data suggest that CTGF expression in rat corneas increases after PRK in a fashion similar to that in TGF-ß–stimulated corneal fibroblasts.

Effect of PRK on CTGF in Rat Cornea after PRK
CTGF was also immunolocalized in paraffin-embedded sections of rat corneas harvested at the same time points after surgery at which protein and RNA were measured. As shown in Figure 5 , CTGF was detected in epithelial cells and stromal fibroblasts, with light staining in the stromal matrix of normal corneas before PRK ablation (day 0). The fluorescence images (Fig. 5 , insets) emphasize the intense staining of the epithelium. At day 3 after injury, there was generally less intense staining in the epithelium and stroma. On day 7, numerous fibroblast-like cells and inflammatory cells were present that stained strongly for CTGF. On days 11, 14, and 21, the epithelium continued to immunostain strongly for CTGF, which corresponds to the increase in CTGF protein measured in corneal homogenates (Fig. 4) . On day 21, intense immunostaining was present on the endothelium and Descemet’s membrane. Negative control experiments in which we omitted the primary anti-CTGF antibody showed faint immunostaining for CTGF when viewed by Nomarski phase-contrast, bright-field, and fluorescence microscopy.



View larger version (79K):
[in this window]
[in a new window]
 
FIGURE 5. Immunolocalization of CTGF in rat corneas after PRK. Rat corneas were excised at days 0, 3, 7, 11, 14, and 21 after PRK. The corneas were fixed, paraffin-embedded sections prepared, and CTGF localized by immunohistochemistry. CTGF was localized with an alkaline phosphatase visualization substrate. Sections were obtained with bright-field microscopy. Insets: images of the same field obtained by fluorescence microscopy. Control images shown in Nomarski, bright-field, and fluorescence microscopy were processed without the primary antibody. Magnification, x200.

 
CTGF Produced by Rat Corneal Epithelium
The immunostained corneas showed high levels of CTGF protein in corneal epithelial cells and fibroblasts. To assess whether corneal epithelial cells synthesize CTGF mRNA and protein, CTGF ELISA and RT-PCR were performed on ex vivo corneal epithelium scrapings from normal rat eyes. CTGF ELISA detected substantial levels (1.5 ng/mg of total detergent-extracted protein) of CTGF protein in the corneal scrapings. In addition, RT-PCR generated an intense amplicon band of the predicted size (503 bp) by using primers specific for rat CTGF cDNA. Furthermore, endonuclease restriction digestion using PstI generated two fragments with the predicted sizes (405 and 98 bp), indicating that the amplicon contained the correct cDNA nucleotide sequence corresponding to rat CTGF mRNA (Fig. 6) .



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 6. Detection of CTGF mRNA in rat corneal epithelium by RT-PCR. Corneal epithelium scrapings were isolated from rats, and total RNA was isolated. RT-PCR was performed with primers that amplify a 503-bp region of rat CTGF. The PCR product was cleaved with a unique restriction site (PstI) into 405- and 98-bp fragments and visualized on a 1.5% agarose gel with ethidium bromide. Lane 1: 100 bp ladder; lane 2: 503-bp PCR product; lane 3: PstI digestion of PCR product.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Multiple growth factors have been detected in the cornea, including epidermal growth factor (EGF), transforming growth factor (TGF)-{alpha}, basic fibroblast growth factor (bFGF), interleukin (IL)-1{alpha}, platelet derived growth factor (PDGF), and TGF-ß, where they appear to play different and important roles in corneal wound healing.32 33 34 35 For example, Chen et al.23 reported that levels of mRNAs for TGF-ß isoforms rapidly increased and remained elevated for 90 days in rat corneas after PRK, which correlated with increases in mRNAs for type I and type III collagen and fibronectin and the development of corneal haze after PRK in rats. They also reported the clinical status of the rat corneas. Epithelial healing was complete by day 7, and corneal edema increased on day 1.5 but returned to normal by day 7. Corneal haze progressively increased from days 7 through 91 after PRK, with all corneas showing significant corneal haze on day 21 (average clinical grade 0.83 on a 0 to 4 scale). The clinical evaluations reported previously by Chen et al.23 correlated well with the progressive increases in levels of CTGF mRNA and protein measured in the corneas. Inhibition of TGF-ß by repeated topical applications of neutralizing antibody reduced corneal haze in rabbits after lamellar keratectomy.20

TGF-ß also is a key regulator of conjunctival scarring. For example, subconjunctival injections of TGF-ß caused a rapid-onset and exaggerated scarring response in a mouse model of conjunctival scarring.36 Reducing TGF-ß activity by repeated subconjunctival injections of a recombinant humanized mouse monoclonal antibody to TGF-ß2 significantly reduced conjunctival scarring and improved the outcome of glaucoma filtration surgery in a rabbit model of aggressive filtration surgery scarring.37 These data led to a prospective, randomized, placebo-controlled, phase I/IIa clinical trial evaluating four subconjunctival injections of a neutralizing, humanized, mouse monoclonal antibody to TGF-ß2 into the filtering bleb of patients undergoing trabeculectomy.38 Analysis of outcomes indicated the anti-TGF-ß2 antibody produced greater declines in intraocular pressures at 3 and 6 months and fewer interventions than control injections, without causing serious adverse events or complications.38

One important finding demonstrates the upregulation of CTGF by TGF-ß in cultured rabbit corneal fibroblasts.39 However, the interactions between the TGF-ß and CTGF systems in human corneal fibroblasts, and the alterations of CTGF expression during corneal wound healing have not been investigated previously. As shown in Figure 1 , all three isoforms of TGF-ß significantly increased CTGF mRNA and protein levels compared with fibroblasts in serum-free medium. Although there was no significant difference in the levels of CTGF mRNA induced by the highest concentration of the TGF-ß isoforms, the highest concentrations TGF-ß2 and -ß3 (10 ng/mL) induced significantly higher levels of CTGF protein than TGF-ß1. This suggests that all three TGF-ß isoforms regulate CTGF synthesis by transcription of mRNA, but regulation of CTGF synthesis by TGF-ß1 may also involve some posttranscriptional regulation. Thus, during healing of wounds, corneal fibroblasts should respond to both TGF-ß1 and -ß2 isoforms by increasing CTGF synthesis, even though the TGF-ß1 isoform predominates in human tears40 and the TGF-ß2 isoform predominates in aqueous humor.41 An interesting finding was that corneal fibroblasts also increased CTGF synthesis in response to TGF-ß3 isoform, which was reported to oppose the scarring effects of TGF-ß1 and -ß2 isoforms in a rat skin incision model.42

Another important interaction between the TGF-ß and CTGF systems is shown in Figure 2 . Specifically, addition of CTGF antisense oligonucleotide or CTGF-neutralizing antibody blocked more than 85% of the increased collagen synthesis induced by TGF-ß1. This demonstrates that synthesis of CTGF is necessary for TGF-ß to increase collagen synthesis. However, neither antisense oligonucleotide nor neutralizing antibody totally suppressed the effect of TGF-ß, nor was the synthesis of collagen reduced below basal levels in fibroblasts cultured in serum-free medium. This may be due to suboptimal levels of the antisense oligonucleotide and antibody, to the presence of other autocrine factors that stimulate collagen synthesis, such as platelet-derived growth factor (PDGF), or to a low constitutive level of collagen synthesis by fibroblasts grown on plastic, perhaps through activation of integrin receptors. Nevertheless, antisense oligos or ribozymes targeting CTGF may be effective therapies for selectively reducing corneal scarring.

The in vitro experiments shown in Figures 1 and 2 strongly indicate that TGF-ß and CTGF systems are linked and that CTGF is an important inducer of collagen synthesis. If our hypothesis that CTGF is a major promoter of corneal scarring in vivo is correct, levels of CTGF mRNA and protein should increase in corneas during wound healing and scar formation. As shown in Figure 4 , analysis of rat corneas showed little change in CTGF levels at 1 day after PRK, followed by a sharp increase in mRNA at day 3, with a continual and almost exponential increase in mRNA levels, reaching a 1000-fold increase on day 21. Protein levels slightly lagged mRNA levels, with a slight decrease on day 3 followed by a nearly 10-fold linear increase to day 21. Because CTGF is a secreted protein, we would expect the levels of CTGF measured in the detergent extracts of the corneal homogenates to represent only a small portion of the total CTGF protein that was synthesized by corneal cells.

Immunostaining indicated that the sources of CTGF protein were the fibroblasts, inflammatory cells, and epithelial cells, which stained intensely. Previous reports have suggested that synthesis of CTGF is limited to cells of mesenchymal origin.43 However, corneal epithelial cells are derived from surface ectoderm.44 CTGF immunostaining in the epithelial cells could be due to synthesis of CTGF or to other sources of CTGF, such as the tears. Unpublished findings (van Setten GB, Blalock TD, Schultz GS, unpublished data, 2002) showed that CTGF was detected in human tears at an average level of 6.2 ng/mL. RT-PCR analysis performed on samples of total RNA isolated from corneal epithelial cells scraped from rat corneas generated a single amplicon with the predicted size, which was cleaved into the unique fragments predicted, by endonuclease digestion, which strongly supports the concept that corneal epithelial cells synthesize CTGF (Fig. 6) . The intensity of CTGF immunostaining roughly followed the levels of CTGF protein measured by ELISA in rat corneas, with intense staining observed in the epithelium at day 21 and strong staining in fibroblasts and endothelial cells and Descemet’s membrane. We recently reported that CTGF protein is present in aqueous humor at an average concentration of 1.24 ng/mL.45 CTGF may be bound to extracellular matrix proteins and glycosaminoglycans in basement membrane, in that CTGF possesses a heparin-binding domain.43

In summary, we investigated the interaction between TGF-ß and CTGF systems in corneal fibroblast cultures, their regulation of collagen synthesis, and the expression and localization of CTGF in the cornea during wound healing after PRK. Collectively, the data strongly support our hypothesis that CTGF is induced by TGF-ß, mediates the effects of TGF-ß on collagen synthesis, increases dramatically during corneal wound healing, and is likely to be a key regulator of corneal wound healing. These results suggest that CTGF may be a key target for therapies that reduce scarring by selectively reducing expression of CTGF.


    Footnotes
 
Supported in part by NIH Grant EY05587 and Research to Prevent Blindness.

Submitted for publication August 22, 2002; revised October 22, 2002; accepted November 14, 2002.

Disclosure: T.D. Blalock, None; M.R. Duncan, None; J.C. Varela, None; M.H. Goldstein, None; S.S. Tuli, None; G.R. Grotendorst, None; G.S. Schultz, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Gregory S. Schultz, University of Florida College of Medicine, Institute for Wound Research, Department of Ob/Gyn, 1600 SW Archer Road, University of Florida, Gainesville, FL 32610-0294; schultzg{at}obgyn.ufl.edu.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bradham, DM, Igarashi, A, Potter, RL, Grotendorst, GR. (1991) Connective tissue growth factor: a cysteine-rich mitogen secreted by human vascular endothelial cells is related to the SRC-induced immediate early gene product CEF-10 J Cell Biol 114,1285-1294[Abstract/Free Full Text]
  2. Ryseck, RP, Macdonald-Bravo, H, Mattei, MG, Bravo, R. (1991) Structure, mapping, and expression of fisp-12, a growth factor-inducible gene encoding a secreted cysteine-rich protein Cell Growth Diff 2,225-233[Abstract]
  3. Frazier, K, Williams, S, Kothapalli, D, Klapper, H, Grotendorst, GR. (1996) Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor J Invest Dermatol 107,404-411[CrossRef][Medline][Order article via Infotrieve]
  4. Hashimoto, K, Shindo-Okada, N, Tani, M, et al (1998) Expression of the Elm1 gene, a novel gene of the CCN (connective tissue growth factor, Cyr61/Cef10, and neuroblastoma overexpressed gene) family, suppresses In vivo tumor growth and metastasis of K-1735 murine melanoma cells J Exp Med 187,289-296[Abstract/Free Full Text]
  5. Hurvitz, JR, Suwairi, WM, VanHul, W, et al (1999) Mutations in the CCN gene family member WISP3 cause progressive pseudorheumatoid dysplasia Nat Genet 23,94-98[CrossRef][Medline][Order article via Infotrieve]
  6. Albrecht, C, von Der Kammer, H, Mayhaus, M, Klaudiny, J, Schweizer, M, Nitsch, RM. (2000) Muscarinic acetylcholine receptors induce the expression of the immediate early growth regulatory gene CYR61 J Biol Chem 275,28929-28936[Abstract/Free Full Text]
  7. Frazier, K, Williams, S, Kothapalli, D, Klapper, H, Grotendorst, GR. (1996) Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor J Invest Dermatol 107,404-411
  8. Chen, MM, Lam, A, Abraham, JA, Schreiner, GF, Joly, AH. (2000) CTGF expression is induced by TGF-beta in cardiac fibroblasts and cardiac myocytes: a potential role in heart fibrosis J Mol Cell Cardiol 32,1805-1819[CrossRef][Medline][Order article via Infotrieve]
  9. Igarashi, A, Nashiro, K, Kikuchi, K, et al (1995) Significant correlation between connective tissue growth factor gene expression and skin sclerosis in tissue sections from patients with systemic sclerosis J Invest Dermatol 105,280-284[CrossRef][Medline][Order article via Infotrieve]
  10. Dammeier, J, Brauchle, M, Falk, W, Grotendorst, GR, Werner, S. (1998) Connective tissue growth factor: a novel regulator of mucosal repair and fibrosis in inflammatory bowel disease? Int J Biochem Cell Biol 30,909-922[CrossRef][Medline][Order article via Infotrieve]
  11. Wunderlich, K, Senn, BC, Reiser, P, Pech, M, Flammer, J, Meyer, P. (2000) Connective tissue growth factor in retrocorneal membranes and corneal scars Ophthalmologica 214,341-346[CrossRef][Medline][Order article via Infotrieve]
  12. Ito, Y, Aten, J, Bende, RJ, et al (1998) Expression of connective tissue growth factor in human renal fibrosis Kidney Int 53,853-861[CrossRef][Medline][Order article via Infotrieve]
  13. Border, WA, Noble, NA. (1994) Transforming growth factor B in tissue fibrosis N Engl J Med 331,1286-1292[Free Full Text]
  14. Perkett, EA. (1995) Role of growth factors in lung repair and diseases Curr Opin Pediatr 7,242-249[Medline][Order article via Infotrieve]
  15. Westergren-Thorsson, G, Hernnas, J, Sarnstrand, B, Oldberg, A, Heinegard, D, Malmstrom, A. (1993) Altered expression of small proteoglycans, collagen, and transforming growth factor-beta 1 in developing bleomycin-induced pulmonary fibrosis in rats J Clin Invest 92,632-637
  16. Border, WA, Noble, NA, Yamamoto, T, et al (1992) Natural inhibitor of transforming growth factor-beta protects against scarring in experimental kidney disease Nature 360,361-364[CrossRef][Medline][Order article via Infotrieve]
  17. Castilla, A, Prieto, J, Fausto, N. (1991) Transforming growth factors beta 1 and alpha in chronic liver disease: effects of interferon alpha therapy N Engl J Med 324,933-940[Abstract]
  18. Vogelmann, R, Ruf, D, Wagner, M, Adler, G, Menke, A. (2001) Effects of fibrogenic mediators on the development of pancreatic fibrosis in a TGF-beta1 transgenic mouse model Am J Physiol 280,G164-G172
  19. Border, WA, Okuda, S, Languino, LR, Sporn, MB, Ruoslahti, E. (1990) Suppression of experimental glomerulonephritis by antiserum against transforming growth factor beta 1 Nature 346,371-374[CrossRef][Medline][Order article via Infotrieve]
  20. Jester, JV, Barry-Lane, PA, Petroll, WM, Olsen, DR, Cavanagh, HD. (1997) Inhibition of corneal fibrosis by topical application of blocking antibodies to TGF beta in the rabbit Cornea 16,177-187[Medline][Order article via Infotrieve]
  21. Duncan, MR, Frazier, KS, Abramson, S, et al (1999) Connective tissue growth factor mediates transforming growth factor beta-induced collagen synthesis: down-regulation by cAMP FASEB J 13,1774-1786[Abstract/Free Full Text]
  22. Woost, PG, Jumblatt, MM, Eiferman, RA, Schultz, GS. (1992) Growth factors and corneal endothelial cells: I. Stimulation of bovine corneal endothelial cell DNA synthesis by defined growth factors Cornea 11,1-10[CrossRef][Medline][Order article via Infotrieve]
  23. Chen, C, Michelini-Norris, B, Stevens, S, et al (2000) Measurement of mRNAs for TGFßs and extracellular matrix proteins in corneas of rats after PRK Invest Ophthalmol Vis Sci 41,4108-4116[Abstract/Free Full Text]
  24. Moussad, EE, Brigstock, DR. (2000) Connective tissue growth factor: What’s in a name? Mol Genet Metab 71,276-292[CrossRef][Medline][Order article via Infotrieve]
  25. Tamatani, T, Kobayashi, H, Tezuka, K, et al (1998) Establishment of the enzyme-linked immunosorbent assay for connective tissue growth factor (CTGF) and its detection in the sera of biliary atresia Biochem Biophys Res Commun 251,748-752[CrossRef][Medline][Order article via Infotrieve]
  26. Heid, CA, Stevens, J, Livak, KJ, Williams, DM. (1996) Real time quantitative PCR Genome Res 10,986-984
  27. Holland, PM, Abramson, RD, Watson, R, Gelfand, DH. (1991) Detection of specific polymerase chain reaction product by utilizing the 5'–3' exonuclease activity of Thermus aquaticus DNA polymerase Proc Natl Acad Sci USA 88,7276-7280[Abstract/Free Full Text]
  28. Livak, KJ, Flood, SAJ, Marmaro, J, Giusti, W, Deetz, K. (1995) Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization PCR Meth Appl 4,357-362[Medline][Order article via Infotrieve]
  29. Webster, DF, Harvey, W. (1979) A quantitative assay for collagen synthesis in microwell fibroblast cultures Anal Biochem 96,220-224[CrossRef][Medline][Order article via Infotrieve]
  30. Dean, NM, Griffey, RH. (1997) Identification and characterization of second-generation antisense oligonucleotides Antisense Nucleic Acid Drug Dev 7,229-233[Medline][Order article via Infotrieve]
  31. Dou, Q, Williams, RS, Chegini, N. (1997) Inhibition of transforming growth factor-beta 1 alters the growth, anchor-dependent cell aggregation and integrin mRNA expression in human promonocytes: implications for endometriosis and peritoneal adhesion formation Mol Hum Reprod 3,383-391[Abstract/Free Full Text]
  32. Wilson, SE, Schultz, GS, Chegini, N, Weng, J, He, YG. (1994) Epidermal growth factor, transforming growth factor alpha, transforming growth factor beta, acidic fibroblast growth factor, basic fibroblast growth factor, and interleukin-1 proteins in the cornea Exp Eye Res 59,63-71[CrossRef][Medline][Order article via Infotrieve]
  33. Hoppenreijs, VPT, Pels, E, Vrensen, GFJM, Felten, PC, Treffers, WF. (1993) Platelet-derived growth factor: receptor expression in corneas and effects on corneal cells Invest Ophthalmol Vis Sci 34,637-649[Abstract/Free Full Text]
  34. Hoppenreijs, VPT, Pels, E, Vrensen, GFJM, Oosting, J, Treffers, FW. (1992) Effects of human epidermal growth factor on endothelial wound healing of human corneas Invest Ophthalmol Vis Sci 33,1946-1957[Abstract/Free Full Text]
  35. Hoppenreijs, VPT, Pels, E, Vrensen, GFJM, Treffers, FW. (1994) Basic fibroblast growth factor stimulates corneal endothelial cell growth and endothelial wound healing of human corneas Invest Ophthalmol Vis Sci 35,931-944[Abstract/Free Full Text]
  36. Cordeiro, MF, Reichel, MB, Gay, JA, D’Esposita, F, Alexander, RA, Khaw, PT. (1999) Transforming growth factor-beta1, -beta2, and -beta3 in vivo: effects on normal and mitomycin C-modulated conjunctival scarring Invest Ophthalmol Vis Sci 40,1975-1982[Abstract/Free Full Text]
  37. Cordeiro, MF, Gay, JA, Khaw, PT. (1999) Human anti-transforming growth factor-beta2 antibody: a new glaucoma anti-scarring agent Invest Ophthalmol Vis Sci 40,2225-2234[Abstract/Free Full Text]
  38. Siriwardena, D, Khaw, PT, King, AJ, Donaldson, ML, Overton, BM, Migdal, C, et al (2002) Human antitransforming growth factor beta monoclonal antibody: a new modulator of wound healing in trabeculectomy: a randomized placebo controlled clinical study Ophthalmology 109,427-431[CrossRef][Medline][Order article via Infotrieve]
  39. Folger, PA, Zekaria, D, Grotendorst, G, Masur, SK. (2001) Transforming growth factor-beta-stimulated connective tissue growth factor expression during corneal myofibroblast differentiation Invest Ophthalmol Vis. Sci 42,2534-2541[Abstract/Free Full Text]
  40. Gupta, A, Monroy, D, Ji, Z, Yoshino, K, Huang, A, Pflugfelder, SC. (1996) Transforming growth factor beta-1 and beta-2 in human tear fluid Curr Eye Res 15,605-614[Medline][Order article via Infotrieve]
  41. Jampel, HD, Roche, N, Stark, WJ, Roberts, AB. (1990) Transforming growth factor-beta in human aqueous humor Curr Eye Res 9,963-969[Medline][Order article via Infotrieve]
  42. Shah, M, Foreman, DM, Ferguson, MW. (1995) Neutralisation of TGF-beta 1 and TGF-beta 2 or exogenous addition of TGF-beta 3 to cutaneous rat wounds reduces scarring J Cell Sci 108,985-1002[Abstract]
  43. Grotendorst, GR. (1997) Connective tissue growth factor: a mediator of TGF-beta action on fibroblasts Cytokine Growth Factor Rev 8,171-179[CrossRef][Medline][Order article via Infotrieve]
  44. Barishak, YR. (1992) Embryology of the eye and its adnexae Dev Ophthalmol 24,1-142[Medline][Order article via Infotrieve]
  45. van Setten, G, Blalock, TD, Grotendorst, G, Schultz, GS. (2002) Detection of connective tissue growth factor in human aqueous humor Ophthalmic Res 34,306-308[CrossRef][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
J. Physiol.Home page
K. M. Heinemeier, J. L. Olesen, F. Haddad, H. Langberg, M. Kjaer, K. M. Baldwin, and P. Schjerling
Expression of collagen and related growth factors in rat tendon and skeletal muscle in response to specific contraction types
J. Physiol., August 1, 2007; 582(3): 1303 - 1316.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
K. L. Watts, E. M. Sampson, G. S. Schultz, and M. A. Spiteri
Simvastatin Inhibits Growth Factor Expression and Modulates Profibrogenic Markers in Lung Fibroblasts
Am. J. Respir. Cell Mol. Biol., April 1, 2005; 32(4): 290 - 300.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Ophthalmol.Home page
S L Ho, G F Dogar, J Wang, J Crean, Q D Wu, N Oliver, S Weitz, A Murray, P E Cleary, and C O'Brien
Elevated aqueous humour tissue inhibitor of matrix metalloproteinase-1 and connective tissue growth factor in pseudoexfoliation syndrome
Br. J. Ophthalmol., February 1, 2005; 89(2): 169 - 173.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Q. Garrett, P. T. Khaw, T. D. Blalock, G. S. Schultz, G. R. Grotendorst, and J. T. Daniels
Involvement of CTGF in TGF-{beta}1-Stimulation of Myofibroblast Differentiation and Collagen Matrix Contraction in the Presence of Mechanical Stress
Invest. Ophthalmol. Vis. Sci., April 1, 2004; 45(4): 1109 - 1116.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blalock, T. D.
Right arrow Articles by Schultz, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blalock, T. D.
Right arrow Articles by Schultz, G. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS