IOVS Is this journal stale?
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2003;44:2496-2506.)
© 2003 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.02-0851

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gipson, I. K.
Right arrow Articles by Russo, C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gipson, I. K.
Right arrow Articles by Russo, C. L.

Mucin Gene Expression in Immortalized Human Corneal–Limbal and Conjunctival Epithelial Cell Lines

Ilene K. Gipson, Sandra Spurr-Michaud, Pablo Argüeso, Ann Tisdale, Tat Fong Ng, and Cindy Leigh Russo

From the Schepens Eye Research Institute and Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. The corneal and conjunctival epithelia, which cover the ocular surface, play an important role in preventing pathogen penetrance into the eye and maintaining a wet-surface phenotype by producing highly hydrophilic mucin molecules for their apical surfaces. Ocular surface infections, wounding, and pathologies resulting in dry eye threaten sight and can cause blindness. Understanding the ocular surface defense mechanisms that mucins provide has been hampered by the lack of immortalized human corneal and conjunctival epithelial cell lines that retain mucin gene expression patterns of the native tissue. The purpose of this work was to characterize newly developed immortalized corneal and conjunctival cell lines using mucin gene expression as markers of differentiation.

METHODS. The cell lines were derived as described by a previously published process. Primary cultures of corneal–limbal and conjunctival epithelia were sequentially transduced to express a dominant negative p53 protein and a p16INK4A/Rb-resistant, mutant cdk4 protein, which enabled the cells to bypass a senescence mechanism recently identified for primary cultures of keratinocytes. These cells were then transduced to express the catalytic subunit of telomerase to permit them to retain their telomeres and divide indefinitely. Cellular morphology and expression of mucin genes in the two cell lines, designated HCLE for the human corneal–limbal line and HCjE for the human conjunctival cell line, were determined after culture on plastic, type I collagen, or Matrigel, in coculture with fibroblasts, and in severe combined immunodeficient (SCID) mice. Expression of the epithelial cell mucins was assayed by reverse transcription, real-time polymerase chain reaction, immunoblot analysis, or immunohistochemistry and compared with expression in native cornea and conjunctiva.

RESULTS. When grown in high-calcium medium on plastic and type I collagen, cells of both lines stratified, exhibiting multiple cell layers. In Matrigel, both cell lines formed cell aggregates that contained lumens. In the SCID mice, the conjunctival cell line formed stratified layers under the kidney capsule. The corneal cell line expressed keratins K3 and K12, the keratins that are corneal-epithelial–specific, and both cell lines expressed K19. As in native tissue, the HCLE and HCjE cell lines expressed the membrane-associated mucins, MUC1, -4, and -16, although their levels were generally lower. Levels of MUC4 and -16 mRNA were the most comparable to native tissue, particularly when cultured on plastic. Apical cells of the stratified cultures were the cells that expressed the membrane-associated mucins MUC1 and -16. Goblet-cell–specific MUC5AC mRNA and protein was detected in a small population of HCjE cells only when using type I collagen as a substrate or when cells were cocultured with fibroblasts. Both cell lines produced glycosylated mucins as indicated by binding of H185 antibody, an antibody that recognizes a carbohydrate epitope on mucins.

CONCLUSIONS. The immortalized corneal (HCLE) and conjunctival (HCjE) cell lines exhibit the mucin gene expression repertoire of their native epithelia. These cell lines will be useful in determining regulation of ocular surface mucin gene expression and, potentially, goblet cell differentiation.


The corneal and conjunctival epithelia of the ocular surface protect the eye from pathogen invasion, desiccation, and injury. The corneal epithelium additionally provides an extraordinarily smooth, wet apical surface, which is the major refractive surface of the visual system.1 2 Apical cells of both corneal and conjunctival epithelia express membrane-associated mucins for their tear film surface that, along with the secreted mucin of the conjunctival goblet cells, protects and maintains hydration of the ocular surface.3 4

Despite the well-developed defense mechanisms of the ocular surface epithelia, infections and diseases resulting in drying and keratinization of the epithelium often occur. Study of synthesis and production of defense and protective molecules by the ocular surface epithelia and their regulation would be facilitated by development of immortalized corneal and conjunctival epithelial cell lines that exhibit characteristics of their native epithelia.

Several methods for primary culture of corneal and conjunctival epithelia have been developed (for examples see Kahn et al.5 and Risse Marsh et al.6 ). Primary cultures have been useful in determining aspects of stem cell location within the corneal and conjunctival epithelia of humans,7 expression of corneal and conjunctival epithelial proteins,8 9 goblet cell development,10 cytotoxicity studies with the objective of replacing the Draize test,11 12 and restoration of damaged ocular surface epithelium.13 14 They have also been useful in constructing experimental corneal equivalents.15 16 Although these studies have provided valuable information, immortalized epithelial cell lines that retain differentiation characteristics would facilitate studies of gene regulation specific to these epithelia. This is especially true in the case of conjunctival epithelial study, because there is not the tissue source that discarded donor corneal–limbal rims provide.

Several immortalized ocular surface epithelial cell lines have been reported. These include three corneal epithelial cell lines that were immortalized with a recombinant SV40 adenovirus vector.5 17 18 The cell lines stratify and make the proteins that differentiated corneal epithelia make,5 17 18 and they have been valuable resources for many studies.19 20 21 22 In our hands, however, these cell lines did not synthesize the glycosylated mucin that we were trying to characterize. To our knowledge, immortalized epithelial cell lines from human conjunctiva have not been published, although several abstracts reporting experiments using a human conjunctival epithelial cell line, HCO597, have appeared (Hallberg CK, Hallberg SL, Trocme MC, Ward SD, Trocme SD, ARVO Abstract 3612, 1999; Trocme MC, Hallberg CK, Ward SL, Trocme SD, ARVO Abstract 3613, 1999; Ward SL, Walker TL, ARVO Abstract 4151, 1999). In addition, the so-called Chang conjunctival cell line American Type Culture Collection 20.2 (ATCC, Manassas, VA) is listed as conjunctival in origin; however, it is commonly acknowledged that it has a fibroblastic phenotype and an HeLa cell contaminant.

The development of techniques to immortalize epithelial cells by preventing telomere shortening by transduction with hTERT, the catalytic subunit of the telomerase holoenzyme, was originally purported to confer replicative immortality without loss of differentiation potential.23 24 By comparison, immortalization with viral oncogenes, such as the SV40 large T-antigen, perturbs cell differentiation programs.25 The goal of this study was therefore to develop and characterize hTERT-immortalized human ocular surface epithelial cell lines. During the course of the development of the cell lines, it became apparent that hTERT transduction was not sufficient to immortalize all cell types, including primary cultures of keratinocytes (Weinberg25 ). A two- or three-step process, including abrogation of either the p16INK4A/Rb pathway26 or the p16NK4A/Rb and p53 pathways in the cell cycle, is required.27 However, for those trying to obtain immortalized epithelial cells for study of their differentiation phenotypes (i.e., mucin expression), the inactivation of the cell cycle pathways may affect differentiation progress. We report here the differentiation characteristics and mucin gene expression profiles of corneal and conjunctival cell lines immortalized by stable transduction to express both a p16INK4A/Rb-resistant mutant cdk4 protein and a dominant-negative p53 protein, followed by transduction with hTERT.27 We report that the cells expressed the same mucin gene and keratin repertoire that their native epithelia produce, but they did not achieve normal morphologic differentiation seen in vivo.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Tissue Acquisition
All tissue was obtained in accordance with good clinical practice, Institutional Review Board and informed consent regulations of the Schepens Eye Research Institute and Massachusetts Eye and Ear Infirmary, and the tenets of the Declaration of Helsinki. Human corneoscleral donor rims were provided by Roger Steinert and Ann Bajart of Ophthalmic Consultants of Boston, and conjunctival biopsy specimens from individuals with normal ocular surfaces were provided by C. Steven Foster of the Massachusetts Eye and Ear Infirmary. Corneoscleral donor rims consisted of peripheral and limbal corneas that were left after removal of central corneal buttons for transplantation. A small piece of bulbar conjunctiva was removed from the superior temporal region of patients undergoing routine cataract surgery.

Cell Culture
Primary cultures of human corneal–limbal and conjunctival epithelial cells derived from corneal donor rims and conjunctival biopsy specimens were immortalized by abrogation of p16 control and p53 function before immortalization by expression of hTERT, by the laboratory of James Rheinwald under contractual agreement on projects entitled, "Development of Human Conjunctival, Endocervical, and Tracheal Epithelial Cell Lines Expressing Mucins MUC4, 5AC, and 5B for Testing Agents that Affect Mucin Secretion" (funded by Inspire Pharmaceuticals, Inc., Durham, NC), and "Molecular Characterization of H185, a Membrane-Associated Mucin of the Corneal Epithelial Surface" (funded by Ciba Vision Corp., Duluth, GA).27 Full details of the derivation of the two cell lines have been reported,27 but their differentiation characteristics have not. Briefly, primary cultures of human corneal limbal epithelium were sequentially transduced with pBABE (cdk4R)hygro, which expresses a p16INK4A-resistant point mutant (R24C) of cdk4,28 29 and pL(p53DD)SN, which expresses a dominant-negative fragment of p53.30 31 Primary cultures of human conjunctival epithelium were sequentially transduced with pL(p53DD)SN followed by pBABE (cdk4R)hygro. Both cell lines were finally transduced with pBABE(hTERT)puro, which expresses the catalytic subunit of human telomerase.32 33

The immortalized corneal and conjunctival epithelial cells, designated HuCl-22/cdk4R/p53DD/TERT (shortened here to HCLE) and ConjEp-1/p53DD/cdk4R/TERT (shortened here to HCjE), respectively, were plated at 2 x 104/cm2 in a medium nutritionally optimized for growth of keratinocytes—keratinocyte serum-free medium (K-sfm)34 (Gibco-Invitrogen Corp., Rockville, MD), supplemented with 25 µg/mL bovine pituitary extract (BPE), 0.2 ng/mL epidermal growth factor (EGF), and 0.4 mM CaCl2,35 and grown at 37°C in a 5% carbon dioxide atmosphere, as previously described.27 To enhance nutrient composition, the cultures were switched at approximately half-confluence to a 1:1 mixture of Gibco K-sfm:low-calcium DMEM/F12 (Gibco) to achieve confluence (approximately 24 hours). After reaching confluence, cells were switched to DMEM/F12 medium with high calcium (1 mM CaCl2) supplemented with 10% calf serum and 10 ng/mL EGF (stratification medium) for 3 to 7 days to promote stratification.

For all studies of the expression of mucins, cells were cultured in medium, as just described, on plastic, on inserts coated with type I collagen or Matrigel (Biocoat Cell Culture Inserts; BD Labware, Bedford, MA), or on inserts with corneal or conjunctival fibroblasts grown to confluence in the lower chamber. The corneal and conjunctival fibroblasts, obtained from James Zieske of the Schepens Eye Research Institute, were grown in DMEM/Ham F-12 plus antibiotic/antimycotic, 200 mM L-glutamine, and 10% fetal bovine serum (Sigma, St. Louis, MO).

To determine the effect of steroids on mucin gene expression, HCjE cells were grown to confluence, as described above, switched to serum-containing medium for 48 hours to achieve stratification, serum starved for 24 hours, and then cultured in DMEM/F12 plus 10-6 M dexamethasone for 24 hours.

To determine whether the immortalized conjunctival cells would differentiate into goblet cells, cells were grown to near confluence on clear cell-culture inserts (Transwell; Corning CoStar, Corning, NY), which were cut into 1 x 1-mm pieces and implanted, as previously described, into the renal subcapsular space of C.B-17-scid severe combined immunodeficient (SCID) mice homozygous for the Prkdcscid mutation and lacking both T and B cells (Taconic, Germantown, NY).36 37 Implanted HCjE cells were harvested for morphologic studies after 3, 5, or 21 days of growth in the SCID mice. The use of animals was approved by the Schepens Eye Research Institute Animal Care and Use Committee and conformed to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

Microscopy
Cell cultures were visualized and photographed during growth by phase-contrast microscopy. Cell cultures grown on type I collagen or Matrigel-coated inserts, and tissue excised from C.B-17-scid mice were fixed in 4% paraformaldehyde in phosphate buffer and processed for embedding in hydroxyethylmethacrylate embedding resin (Technovit 7100; Energy Beam Sciences, Agawam, MA). Cross sections were stained with hematoxylin and eosin.

Immunofluorescence Microscopy
Cultures grown on type I collagen inserts for 7 days in stratification medium were fixed in 4% paraformaldehyde for en face immunofluorescence detection of keratins and mucin proteins. Briefly, cultures were rinsed in phosphate-buffered saline (PBS), permeabilized with PBS plus 5% Triton X-100, and blocked with PBS with 1% bovine serum albumin (BSA). Cultures were then incubated for 1 hour at room temperature with primary antibody followed by fluorescein-conjugated secondary antibody and coverslipped with antifade mounting medium plus propidium iodide (Vectashield; Vector Laboratories; Burlingame, CA) as previously described.38 The primary antibodies used were AE5, which recognizes keratin K3 (ICN Biomedical, Costa Mesa, CA); pAb55, which recognizes K1239 ; RCK 108, which recognizes K19 (ICN Biomedical); HMFG-2 (Biodesign, Saco, ME), which recognizes a peptide in MUC1; H185, which recognizes a carbohydrate epitope on MUC168 40 ; Clone OC125, which recognizes a peptidic epitope on MUC16 (CA125; Dako Corp.; Carpinteria, CA); and 791, an antibody which recognizes a peptide in MUC5AC.38

Fluorescence In Situ Hybridization
Cultures grown on type I collagen inserts for 7 days in stratification medium were fixed in RNase-free 4% paraformaldehyde for en face fluorescence in situ hybridization (FISH) of mucin mRNA, essentially as previously described.41 Briefly, FISH was performed using digoxigenin-labeled antisense and sense riboprobes (DIG RNA Labeling Kit; Roche Applied Sciences; Indianapolis, IN) generated from a previously described MUC5AC cDNA.42 Probe labeling, prehybridization treatments (rinses, permeabilization, proteinase K treatment, and acetylation), hybridization with DIG-labeled riboprobes, and posthybridization washes were performed according to recommendations of the manufacturer. Hybridized riboprobes were detected with 20 µg/mL fluorescein-conjugated anti-digoxigenin antibody (Roche Applied Sciences).

RNA Isolation and Reverse Transcription
Total RNA was isolated from the cell cultures, human donor corneas, and human conjunctival biopsy specimens using TRIzol reagent (Invitrogen), according to the manufacturer’s recommended protocol. Residual genomic DNA in the RNA samples was eliminated by digestion with DNase I (Amplification Grade; Gibco-Invitrogen). Digested total RNA was reverse transcribed with random hexamer primers and Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s protocol, as previously described.38

Conventional Reverse Transcription–Polymerase Chain Reaction (RT-PCR)
Conventional RT-PCR was performed on RNA from cell cultures grown on plastic to look for expression of MUC1, -2, -4, -5AC, -5B, -6, and -11, as previously described.43 44 45 46 In addition, PCR primers were designed for the recently cloned membrane-associated mucins, MUC13,47 -16,48 and -17,49 using Primer Express software (Applied Biosystems, Foster City, CA). The specificity of newly designed primers (MUC13, -16, and -17) and probe (MUC16) was confirmed by BLASTN (www.ncbi.nlm.nih.gov/blast/; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD) searches against nucleotide databases. Furthermore, the identity of the amplified PCR products was verified by the DNA Sequencing Core of Massachusetts General Hospital (Boston, MA). The primer sets for MUCs 13, 16, and 17 are as follows: MUC13 Forward: TGCTTCTATCCCTCCAATGGA; MUC13 Reverse: TGGGTGAGGCTAGGTTGCA; MUC16 Forward: GCCTCTACCTTAACGGTTACAATGAA; MUC16 Reverse: GGTACCCCATGGCTGTTGTG; MUC16 TaqMan Probe: AGATGAGCCTCCTACAACTCCCAAGCCAG; MUC17 Forward: GGGCCAGCATAGCTTCGA; MUC17 Reverse: GCTACAGGAATTGTGGGAGTTGA.

Real-Time PCR
Real-time PCR amplification and relative quantitation of the mucin genes found to be expressed by the cell cultures was performed with double-labeled fluorogenic probes and primers (TaqMan; Applied Biosystems), as previously described.38 PCR primers and probes for MUC16 are those listed herein, and those for MUC1, -4, -5AC and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) have been reported.38 To validate the use of these primers and probes for relative quantitation of mRNA, real-time PCR assays were performed to confirm that the efficiency of the target gene amplification was equivalent to that of the endogenous control used for this study (GAPDH).

The important parameter for quantitation in real-time PCR is the CT value, which is the fractional cycle number at which the amount of amplified target reaches a fixed threshold of detectable fluorescence. The threshold is set in the midlinear phase of the amplification plot. To standardize the amount of sample cDNA added to each reaction, the amount of target gene in each sample was normalized to the endogenous control by subtracting the CT of the endogenous control, GAPDH, from that of the target gene ({Delta}CT). For quantitation, the amount of mRNA for each target gene was expressed relative to the amount present in a calibrator sample using the {Delta}CT method (Applied Biosystems). For this study, mucin expression in native corneal or conjunctival tissue (for HCLE or HCjE, respectively) were used as the calibrators. The level of mRNA for the calibrator sample was set at 1, and all other conditions were expressed relative to it. No template controls were included in all real-time PCR experiments to confirm the absence of DNA contamination in the reagents used for the amplification. Statistical comparisons of results from real-time PCR were done with the Fisher Protected Least-Significant Difference (Fisher’s PLSD) test using StatView, version 5.0 (SAS Institute, Cary, NC).

Immunoblot
Protein was extracted from cell cultures by methods previously described,8 except that a complete protease inhibitor cocktail was added (Roche Molecular Biochemicals, Indianapolis, IN). Proteins were separated by SDS-polyacrylamide gel electrophoresis (PAGE), blotted onto nitrocellulose membrane and probed with antibodies recognizing MUC1 (HMFG-1; Biodesign), MUC16 (clone OC125), or the carbohydrate epitope on MUC16 (H185),8 as previously described.38


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The purpose of the work reported herein was to develop immortalized corneal and conjunctival cell lines that would differentiate and express the mucins that are produced by native epithelia, to enable the study of regulation of expression of these differentiation products. The assays chosen to determine differentiation and mucin gene expression include (1) light microscopy of the epithelial architecture of the two cell lines after culture in high-calcium–containing medium on plastic and on culture inserts coated with type I collagen or Matrigel and after implant under the kidney capsule of C.B-17-scid mice; (2) immunolocalization of keratins specific to corneal and conjunctival epithelia; (3) real-time PCR to compare mucin gene mRNA expression from the same cultures listed above and from cocultures of the corneal and conjunctival epithelia with corneal or conjunctival fibroblasts, in situ hybridization for MUC5AC; and (4) mucin protein expression and mucin glycosylation assayed by immunohistochemistry or immunoblot analysis where possible.

Epithelial Architecture of Cultures of HCLE and HCjE Cells Grown on Various Substrates and in SCID Mice
Cells from both cell lines stratified when cultured with the serum-containing medium on plastic or culture inserts coated with type I collagen (Figs. 1 2) . The cells of all layers were elongated, with no apparent basal cell polarity. In Matrigel, both cell types formed cell aggregates (Figs. 1C 1D ; 2C 2D) . The conjunctival cell line formed a more regular, spherical, hollow aggregate, the walls of which had the three to four cell layers similar to that of a stratified conjunctival epithelium (Fig. 2D) . By comparison, the HCLE cells formed aggregates, but the cells did not form a regular "epithelial-like" wall (Fig. 1D) . If serum was not added to the media of HCjE cells, however, lumens did not form (data not shown).



View larger version (104K):
[in this window]
[in a new window]
 
FIGURE 1. Microscopic appearance of cultures of HCLE cells. (A) Cells cultured in high-calcium media on plastic. (B) Cross-section of cells cultured in high-calcium medium on type I collagen-coated culture inserts. (C) Cell aggregates that formed when cells were cultured on Matrigel-coated inserts. (D) Cross-section of a cell aggregate similar to those shown in (C). Note the several lumens within the aggregate. Bars, 25 µm.

 


View larger version (126K):
[in this window]
[in a new window]
 
FIGURE 2. Microscopic appearance of cultures of HCjE cells. (A) Cells cultured in high-calcium medium on plastic. (B) Cross-section of cells cultured in high-calcium medium on culture inserts coated with type I collagen. (C) Spherical cell aggregates that formed when cells were grown on Matrigel-coated culture inserts. (D) Cross section of a cell aggregate similar to those in (C). Note the central lumen and the three to four cell layers of the wall of the spherical cell aggregate. (E) Cells grown on culture inserts and then implanted under kidney capsule for 5 days. Stratified layers of cells were present along the insert, but no cells with goblet cell morphology were observed. Bars, 25 µm.

 
To determine whether goblet cells differentiate from immortalized conjunctival epithelia, HCjE cells were grown on uncoated cell culture inserts to 95% confluence. The inserts with attached cells were cut into 1-mm2 pieces and implanted into the renal subcapsular space of C.B-17-scid mice.36 37 By 5 days, cells on the implants grew to a stratified epithelial-like architecture, with four to five cell layers, but completely differentiated goblet cells were not found. By day 21, implanted cells were no longer discernible. In pilot studies, we injected cells subcutaneously,50 but we were not able to locate the injected cells after 11 days.

To verify that the corneal and conjunctival cell lines retain the keratin expression patterns of their native epithelia, the keratins K3, K12, and K19 were immunolocalized in the HCLE and HCjE cells, grown on type I collagen–coated inserts for 7 days in stratification medium. As demonstrated in Figure 3 , the cornea-specific keratins K3 and K12 were present within the corneal cells, with only occasional cell binding in the conjunctiva-derived cells (Figs. 3A 3B 3C 3D) , and K19, a widely expressed keratin, was present in both cornea- and conjunctiva-derived cells (Figs. 3E 3F) . These data indicate that the immortalized cell lines expressed the keratins of their native epithelia, as summarized by Risse Marsh et al.6 and Kurpakus et al.39



View larger version (114K):
[in this window]
[in a new window]
 
FIGURE 3. Immunofluorescence microscopy demonstrating keratin expression in HCLE and HCjE cells cultured on type I collagen–coated culture inserts. Keratin K3 antibodies, considered to be corneal epithelium specific, bind to the HCLE cells (A); only occasional HCjE cells (B) bind the antibody. Similarly, antibodies to keratin K12, also considered to be corneal epithelium specific, bind to HCLE (C), but not to HCjE (D). Antibodies to keratin K19 bind to both HCLE (E) and HCjE (F) cells. All micrographs are of the same magnification. Bar, 25 µm.

 
Mucin mRNA Expression in Immortalized Human Keratinocytes
In initial studies to determine which mucin genes were expressed by the HCLE and HCjE cells, conventional RT-PCR assays were performed on cells grown on plastic for 7 days in stratification medium. mRNAs for MUC1, -4, and -16 were found, whereas MUC-2, -5B, -6, -13, and -17 were not found. In addition, mRNA for MUC11 was detected by RT-PCR in the HCLE and HCjE cells, as well as in native cornea and conjunctiva (data not shown), but because only tandem repeat sequence is available for MUC11, further studies of this poorly described mucin were not conducted.

The quantitation of mucin transcripts in the immortalized human corneal and conjunctival keratinocytes cultured under different conditions was performed with real-time PCR, selecting the mucin mRNA values of corneal and conjunctival biopsy specimens as the calibrator (relative expression = 1). All membrane-associated mucins expressed by the native corneal and conjunctival epithelia, MUC-1, -4, and -16,4 40 50 were detected in the immortalized corneal (HCLE) and conjunctival (HCjE) epithelial cell lines (Figs. 4A 4B) .



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 4. Real-time PCR assay of relative mRNA levels of the membrane-associated mucins MUC1, -4, and -16 in HCLE (A) and HCjE (B, C) cells after culture for 7 days in stratification medium on plastic-, type I collagen–, or Matrigel-coated culture inserts (A, B), or after coculture with fibroblasts for 4 days in stratification medium (C). mRNA levels were compared with that in native tissue, which is set at 1. For experiments in (A) and (B), the minimum number of replicates was three, except for primary cultures and native cornea, where n = 1. For (C), n = 2 for control and conjunctival fibroblast coculture, and n = 5 for coculture with corneal fibroblasts. Data are shown as mean ± SEM (error bars) where possible.

 
The expression of MUC1 was similar in cells grown on plastic, type I collagen and Matrigel, although, of the membrane-associated mucins, the number of MUC1 mucin transcripts was the lowest compared with primary cultures of corneal and conjunctival epithelia and native tissue. HCLE and HCjE cells grown on plastic expressed MUC1 mRNA at levels 21- and 7-fold lower than native tissue, respectively. By comparison to MUC1, the expression of MUC-4 and -16 varied between culture substrates. The HCLE and HCjE cells grown on plastic maintained a greater capacity to express the MUC4 and -16 mRNA mucins, HCLE being nearly equivalent to primary cultures of corneal epithelium and native tissue. However, when cell lines were grown on type I collagen and, especially, Matrigel, the expression of MUC4 and -16 mucin mRNA was reduced (Figs. 4A 4B) .

To test the effects of coculture with either corneal or conjunctival fibroblasts on expression of membrane-associated mucins, HCjE cells were grown on culture inserts, with or without fibroblasts in the lower chamber (Fig. 4C) . Although there was a slight increase in expression of MUC-1, -4, and -16, when HCjE cells were grown with corneal or conjunctival fibroblasts, the increase did not reach significance. The source of fibroblasts, either corneal or conjunctival, did not differentially affect mucin mRNA expression.

To determine whether the mucin genes were inducible in the conjunctival cell line, cells were cultured in the presence of 10-6 M dexamethasone. MUC1 mRNA was 6.5-fold higher in the dexamethasone-treated cells compared with the control (Fig. 5) . By comparison, MUC4 and -16 showed minimal increases (1- and 0.75-fold, respectively) in response to dexamethasone.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 5. Real-time PCR assay of relative mRNA levels of the membrane-associated mucins, MUC1, -4, and -16 in stratified cultures of HCjE cells treated for 24 hours with 10-6 M dexamethasone after 48 hours of serum starvation. mRNA levels of the dexamethasone-treated cultures are compared with the mean of the no dexamethasone control cultures, which is set at 1. Data are shown as the mean ± SEM (error bars); n = 2 for each group.

 
The most dramatic difference between HCjE and native tissue was the low expression of the conjunctival goblet cell mucin MUC5AC (Fig. 6) . Note that data in Figure 6 are graphed on a logarithmic scale. The level of MUC5AC expression in HCjE cells was approximately 4.3 x 104-fold lower than that of native tissue when cells were cultured on plastic, indicating that only a very small population of cells in culture expressed MUC5AC transcripts (as verified by immunohistochemistry and in situ hybridization, discussed later). When the different substrates were compared, the HCjE cells grown on type I collagen had the highest levels of MUC5AC transcripts, approximately 80-fold higher as compared to plastic substrate (P < 0.05), but still 500-fold less than native tissue. Cocultures with corneal or conjunctival fibroblasts enhanced MUC5AC expression slightly (11- or 6-fold higher than on plastic, respectively). The goblet-cell–specific MUC5AC mucin was not detected in any of the immortalized human corneal epithelial cell cultures nor in native corneal tissue, as determined by real-time PCR (data not shown).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 6. Real-time PCR assay of mRNA levels of the goblet cell mucin MUC5AC in HCjE cells cultured for 7 days in stratification medium on plastic, type I collagen, or Matrigel. Message on plastic and Matrigel was extremely low, whereas culture on type I collagen was detected at CT’s of 30 to 37. MUC5AC mRNA levels on type I collagen were significantly higher than on the other substrates examined (P < 0.05). As demonstrated by the logarithmic scale, native conjunctival tissues express MUC5AC mRNA at levels significantly greater than those of the primary culture and HCjE cells (P < 0.0001). For cells grown on plastic, collagen, or Matrigel, n = 7 to 10. For coculture experiments, n = 2 to 5. For primary culture, n = 1. For conjunctival tissue, n = 8. Data are shown as the mean ± SEM (error bars).

 
Mucin Protein Synthesis in Immortalized Keratinocytes as Determined by Immunohistochemistry and Immunoblot Analysis
Immunohistochemical localization of MUC1 and -16 in both the HCLE and HCjE cell lines after culture on type I collagen is shown in Figure 7 . Scattered apical cells of the stratified cultured epithelia bound the antibody to MUC1 (HMFG-2; Figs. 7A 7B ) and to MUC16 (OC125; Figs. 7C 7D ). Confocal imaging of the cells allowed reconstruction of the cross-section of the cultures, demonstrating that the binding of the antibodies was on the apical surfaces of the cultured cells (Fig. 7E) . Despite attempts to make antibodies to MUC4 peptides and trials with commercially available MUC4 antibodies, to date we have found no antibodies that work well in immunohistochemistry. Therefore, we did not immunolocalize that membrane-associated mucin.



View larger version (114K):
[in this window]
[in a new window]
 
FIGURE 7. Immunolocalization of membrane-associated mucins on HCLE and HCjE cells after culture on type I collagen for 7 days in stratification medium. MUC1, localized by using HMFG-2 antibody, was present on apical cells in stratified cultures of HCLE (A) and HCjE (B). MUC16, localized by using a CA125 antibody, also was present on apical cells of both HCLE (C) and HCjE (D) cells. Proof that the membrane-associated mucins are on apical cells was demonstrated by reconstruction of vertical sections from stacked confocal images of the labeled cultures (E). The micrographs in (E) are of cultures immunolabeled to localize MUC16. (F) and (G) show lack of nonspecific binding of secondary antibody to corneal and conjunctival cells, respectively. All images are of the same magnification. Bar, 25 µm.

 
After culture on type I collagen, HCjE cells expressed some message for MUC5AC (Fig. 6) . In those cultures, MUC5AC was detected by antibody binding to scattered cells (Figs. 8A 8B) , whereas no binding was found to cell cultures grown on cross-linked type I collagen, which did not express MUC5AC mRNA (Figs. 8C) . The binding of the antibody appeared to be in endoplasmic reticulum and Golgi apparatus (Figs. 8A 8B) . In situ hybridization using riboprobes to MUC5AC verified the expression of goblet cell mucin by the small subpopulation of cells (Figs. 8E 8F) . Many attempts were made to induce the expression of MUC5AC and thereby induce differentiation of goblet cells in the HCjE cultures. Neither culture on Matrigel or in SCID mice, nor coculture with fibroblasts (Fig. 6) , nor feeding cells nutrient-rich medium from the basal aspect of the cell culture (data not shown) induced MUC5AC mRNA. Nevertheless, there was a small population of cells within the cultures, particularly those on type I collagen, that expressed MUC5AC.



View larger version (97K):
[in this window]
[in a new window]
 
FIGURE 8. Immunolocalization of MUC5AC protein and in situ hybridization of MUC5AC mRNA in HCjE cells cultured on type I collagen for 7 days in stratification medium. (A, B) Two examples of binding of MUC5AC antibody to subpopulations of cells within the cultures. (C) MUC5AC antibody did not bind to cells that did not express MUC5AC mRNA, when cultured on cross-linked type I collagen. (D) No nonspecific binding of secondary antibody (primary antibody omitted) was observed. Fluorescence in situ hybridization of the MUC5AC riboprobe shows message for the mucin in individual cells of the HCjE culture (E, F). Sense control incubations showed no binding to cells (G). Magnification is the same in (A), (C), and (D) and in (B), (E), (F), and (G). Bars, 25 µm.

 
Immunohistochemistry using an antibody to a carbohydrate epitope on MUC16, (designated H185; see Ref. 40 , in the current issue) demonstrate that both HCLE and HCjE cell lines glycosylate MUC16 in culture (Fig. 9) . As with immunolocalization of the membrane-spanning mucins MUC1 and -16, scattered apical cells of the stratified cultures bound the H185 antibody. Immunoblot analysis (Fig. 10) verified the immunohistochemical analysis. Both MUC1 and -16 proteins were detected by immunoblot of cell lysates of HCLE grown on type I collagen and HCjE grown on plastic, and the presence of glycosylated MUC16 in both cell lines is confirmed by the binding of the H185 antibody (Fig. 10) .



View larger version (74K):
[in this window]
[in a new window]
 
FIGURE 9. Immunolocalization of H185 antibody, which recognizes a carbohydrate epitope on MUC16 on HCLE (A) and HCjE (B) cells. These data indicate that both cell lines glycosylate MUC16. No nonspecific binding of secondary antibody (primary antibody omitted) was present in each culture (C, HCLE; D, HCjE). Bar, 25 µm

 


View larger version (70K):
[in this window]
[in a new window]
 
FIGURE 10. Western blot experiments demonstrating the presence of the MUC1 and -16 mucins and the H185 epitope in protein extracts of cultures of HCLE and HCjE cells. Lane A: primary cultures of nontransformed human corneal keratinocytes grown on plastic, with 100 µg protein loaded per lane. Lane B: cultures of immortalized HCLE grown on type I collagen, with 50 µg protein loaded per lane. Lane C: cultures of immortalized human conjunctival keratinocytes (HCjE) grown on plastic, with 50 µg protein loaded per lane. Western blot analysis was performed with the HFMG-1 monoclonal antibody against the MUC1 mucin, the CA125 against the MUC16 mucin, and the H185 hybridoma cell culture supernatant against the H185 epitope. Experiments were performed on two to three preparations with reproducible results. Negative controls included blots probed with primary antibody omitted and blots of cell culture medium supernatants of equivalent protein load (data not shown).

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The immortalized human corneal and conjunctival epithelial cell lines described in the current study exhibited some but not all the characteristics of their native epithelia. Since the corneal cell line expressed the same membrane-associated mucins, as well as keratins K3 and K12, that are expressed in native corneal epithelium, and since the conjunctival cell line expressed MUC5AC (at low levels) and keratin K19, but not K3 or K12, it can be said that the cell lines retained several of the unique characteristics of their native epithelia. As in the native state, the cultures stratified, and as in the native tissue, it was the flattened apical cells that expressed the membrane-associated mucins. In addition, there was evidence of glycosylation of membrane-associated mucins. Under the culture conditions used to date, neither cell line fully differentiated to form well-polarized epithelia exhibiting cuboidal basal cells, nor, in the case of the conjunctival cell line, did fully differentiated goblet cells form, despite some MUC5AC expression. We conclude from the studies performed with these cell lines that they will be useful tools, particularly for studies of the regulation of expression, glycosylation, and function of membrane-associated mucins. The data showing that MUC1 can be upregulated by dexamethasone in the HCjE cell line demonstrate the potential of the cell line. Moreover, the HCLE cell line has been used to demonstrate that the H185 antibody recognizes a carbohydrate epitope on MUC16.40

There is considerable literature in which cell cultures have been used to study regulation of mucin gene expression. To date, most of the studies of mucin gene expression have been performed in primary cultures of epithelia or cancer cell lines. Because of the role of mucins in cystic fibrosis, studies of primary cultured tracheal epithelia have been undertaken to determine regulators of tracheal mucin expression.52 53 Similarly, because mucin genes are upregulated and aberrantly expressed in breast, colonic, and endometrial cancers, there have been studies of these cell types in culture.54 55 56 To our knowledge, three cell lines immortalized from normal tissue have used expression of MUC1 and -4 as an indicator of differentiation. Breast epithelial and endometrial cell lines immortalized from normal epithelia by E6, E7, and SV40, respectively, express MUC1,57 58 and tracheal gland cells immortalized by SV40 express MUC1 and -4.59 With the exception of the cancer cell lines, the results of studies to determine mucin expression patterns on the primary cell cultures or cell lines derived from normal epithelia indicate that each epithelial cell culture retains the repertoire of mucin genes expressed by their native tissue. Data from our corneal and conjunctival epithelial cell lines are thus comparable to those in previous studies in this regard. As in the native corneal epithelium, the corneal cell line expresses MUC1, -4, -11, and -16 but not MUC13 or -17. Similarly, the conjunctival cell line expresses MUC1, -4, -11, -16, and -5AC but not MUC2, -5B, or -6. Because specific epithelia express their unique repertoire of mucins, and because primary cell cultures and cell lines immortalized from normal epithelia retain that repertoire, the value of having ocular surface epithelial cell lines for study of specifics of tear film mucin expression, glycosylation, and function are apparent.

Other corneal epithelial cell lines that have been developed have been immortalized by the SV40 large T antigen.5 17 In our hands, as evidenced by the absence of binding of the H185 antibody that recognizes a carbohydrate epitope on MUC16, these cell lines did not glycosylate mucins (data not shown). It was for this reason that the hTERT method of immortalization, with its potential to preserve differentiation characteristics, was undertaken for the corneal and conjunctival epithelia. Both HCLE and HCjE glycosylate MUC16, but glycosylation of the other mucins has yet to be studied.

Primary cultures of the simple epithelia of tracheal and colonic origin express and synthesize the large gel-forming mucins MUC5AC and -5B.60 Cells similar to goblet cells differentiate in these cultures and secrete mucin that has a gel-like character at the culture surfaces.61 Although a few cells in the HCjE cell line described herein expressed MUC5AC, particularly with culture on type I collagen, we did not see goblet cell morphology or evidence of secreted mucins in the cultures. A variety of culture conditions were used to induce MUC5AC expression and goblet cell differentiation. The variations included, in addition to the culture on type I collagen, Matrigel, and coculture with fibroblasts reported herein, culture media (RPMI-1640, stratification medium from day 1), time in culture (up to 17 days), plating density, and addition of galactose, a precursor for O-linked mucin-type sugars.62 None of these variations dramatically enhanced MUC5AC expression, nor did we see goblet cell morphology (data not shown).

The question remains, is there a small subpopulation of cells of a goblet cell lineage in the immortalized conjunctival cell line, and are there culture deficiencies by way of the effector molecules, substrates, or coculture conditions that are required for goblet cell differentiation that have not been met by our experiments to date? The fact that we found no evidence of mature goblet cells when the epithelial cells were cultured under the kidney capsule in SCID mice, where conditions are purportedly ideal for differentiation, suggests that the differentiation pathway for goblet cells within the cell line may have been altered by the immortalization procedures. Indeed, Weinberg et al.25 caution that inactivation of cell cycle pathways may affect the differentiation process. The possibility also exists that most of the cells transduced in the primary cultures were cells that had left the pluripotent cell compartment. Perhaps only a few stem cells were transduced, and it was these pluripotent stem cells that gave rise to the small subpopulation of cells that expressed MUC5AC. Isolation and culture of this subpopulation may be informative.

The second conclusion of this study is that culture substrate can influence mucin gene expression. Matrigel negatively affected MUC4 expression in both cell lines, and there was upregulation of MUC5AC mRNA when the conjunctival cell line was cultured on type I collagen. This observation has been made with culture of other types of epithelial cells. Airway epithelial cells, grown on collagen gels or a type I collagen gel matrix in the presence of retinoids, produce mucin-like glycoproteins.63 64 Similarly, Caco-2 cells, a colon cancer cell line, produces a greater amount of mucin if grown on type I and IV collagens.65 The later studies measured the effect of collagens on mucin glycoprotein product, not on mucin mRNA. In contrast, studies of the effect of Matrigel on expression and SMC protein levels (SMC is the rat homologue of MUC4) have demonstrated no effect on mRNA transcripts, but protein levels were significantly reduced.66 67 Perhaps this difference is a species variation. Perhaps collagen upregulates mucin production because this substrate fosters epithelial differentiation and cell polarization. Polarization supports synthesis of mucins that are either in apical membranes or secreted apically.

Several studies have demonstrated that mucin gene expression and mucin glycosylation are altered in ocular surface disease. MUC5AC levels are decreased in conjunctival epithelia of patients with Sjögren dry eye.38 There is alteration in expression and/or glycosylation of the cell-associated MUC16, as evidenced by altered H185 binding in non-Sjögren dry eye.68 In a rat model of vitamin A deficiency,69 both rMuc4 and rMuc5AC were downregulated. Finally, there is a loss of GalNAc-transferases, the isoenzymes that initiate O-glycosylation of mucins, in the keratinized dry ocular surface of conjunctival epithelia of patients with ocular cicatricial pemphigoid. This suggests alteration of glycosylation of ocular surface mucins in keratinized, human ocular surface disease.70 Study of mucin gene expression in the HCLE and HCjE cell lines will yield information regarding regulation, glycosylation, and functions of mucins specific to the surface of the eye. Such information may provide a better understanding of and potential therapeutic treatments for ocular surface diseases.


    Acknowledgements
 
The authors thank Gale Unger for editorial assistance.


    Footnotes
 
Supported by CIBA Vision (corneal-limbal epithelial cell line), Inspire Pharmaceuticals (conjunctival cell line), and National Eye Institute Grant R01 EY03306-24 (IKG).

Submitted for publication August 20, 2002; revised November 20, 2002; accepted January 26, 2003.

Disclosure: I.K. Gipson, None; S. Spurr-Michaud, None; P. Argüeso, None; A. Tisdale, None; T.F. Ng, None; C.L. Russo, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Ilene K. Gipson, Schepens Eye Research Institute, Harvard Medical School, 20 Staniford Street, Boston, MA 02114; gipson{at}vision.eri.harvard.edu.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Holly, FJ, Lemp, MA. (1977) Tear physiology and dry eye Surv Ophthalmol 22,69-87[CrossRef][Medline][Order article via Infotrieve]
  2. Gipson, IK. (1994) Anatomy of the conjunctiva, cornea, and limbus Smolin, G Thoft, RA eds. The Cornea ,3-24 Little, Brown Boston.
  3. Gipson, IK, Ho, SB, Spurr-Michaud, SJ, et al (1997) Mucin genes expressed by human female reproductive tract epithelia Biol Reprod 56,999-1011[Abstract]
  4. Argueso, P, Gipson, IK. (2001) Epithelial mucins of the ocular surface: structure, biosynthesis and function Exp Eye Res 73,281-289[CrossRef][Medline][Order article via Infotrieve]
  5. Kahn, CR, Young, E, Lee, IH, Rhim, JS. (1993) Human corneal epithelial primary cultures and cell lines with extended life span: in vitro model for ocular studies Invest Ophthalmol Vis Sci 34,3429-3441[Abstract/Free Full Text]
  6. Risse Marsh, BC, Massaro-Giordano, M, Marshall, CM, Lavker, RM, Jensen, PJ. (2002) Initiation and characterization of keratinocyte cultures from biopsies of normal human conjunctiva Exp Eye Res 74,61-69[CrossRef][Medline][Order article via Infotrieve]
  7. Pellegrini, G, Golisano, O, Paterna, P, et al (1999) Location and clonal analysis of stem cells and their differentiated progeny in the human ocular surface J Cell Biol 145,769-782[Abstract/Free Full Text]
  8. Watanabe, H, Fabricant, M, Tisdale, AS, Spurr-Michaud, SJ, Lindberg, K, Gipson, IK. (1995) Human corneal and conjunctival epithelia produce a mucin-like glycoprotein for the apical surface Invest Ophthalmol Vis Sci 36,337-344[Abstract/Free Full Text]
  9. Gamache, DA, Dimitrijevich, SD, Weimer, LK, et al (1997) Secretion of proinflammatory cytokines by human conjunctival epithelial cells Ocul Immunol Inflamm 5,117-128[Medline][Order article via Infotrieve]
  10. Tsai, RJ, Ho, YS, Chen, JK. (1994) The effects of fibroblasts on the growth and differentiation of human bulbar conjunctival epithelial cells in an in vitro conjunctival equivalent Invest Ophthalmol Vis Sci 35,2865-2875[Abstract/Free Full Text]
  11. North-Root, H, Yackovich, F, Demetrulias, J, Gacula, M, Jr, Heinze, JE. (1982) Evaluation of an in vitro cell toxicity test using rabbit corneal cells to predict the eye irritation potential of surfactants Toxicol Lett 14,207-212[CrossRef][Medline][Order article via Infotrieve]
  12. Yang, W, Acosta, D. (1994) Cytotoxicity potential of surfactant mixtures evaluated by primary cultures of rabbit corneal epithelial cells Toxicol Lett 70,309-318[CrossRef][Medline][Order article via Infotrieve]
  13. Lindberg, K, Brown, ME, Chaves, HV, Kenyon, KR, Rheinwald, JG. (1993) In vitro propagation of human ocular surface epithelial cells for transplantation Invest Ophthalmol Vis Sci 34,2672-2679[Abstract/Free Full Text]
  14. Pellegrini, G, Traverso, CE, Franzi, AT, Zingirian, M, Cancedda, R, De Luca, M. (1997) Long-term restoration of damaged corneal surfaces with autologous cultivated corneal epithelium Lancet 349,990-993[CrossRef][Medline][Order article via Infotrieve]
  15. Zieske, JD, Mason, VS, Wasson, ME, et al (1994) Basement membrane assembly and differentiation of cultured corneal cells: importance of culture environment and endothelial cell interaction Exp Cell Res 214,621-633[CrossRef][Medline][Order article via Infotrieve]
  16. Griffith, M, Osborne, R, Munger, R, et al (1999) Functional human corneal equivalents constructed from cell lines Science 286,2169-2172[Abstract/Free Full Text]
  17. Araki-Sasaki, K, Ohashi, Y, Sasabe, T, et al (1995) An SV40-immortalized human corneal epithelial cell line and its characterization Invest Ophthalmol Vis Sci 36,614-621[Abstract/Free Full Text]
  18. Offord, EA, Sharif, NA, Mace, K, et al (1999) Immortalized human corneal epithelial cells for ocular toxicity and inflammation studies Invest Ophthalmol Vis Sci 40,1091-1101[Abstract/Free Full Text]
  19. Franco, M, Nealey, PF, Campbell, S, Teixeira, AI, Murphy, CJ. (2000) Adhesion and proliferation of corneal epithelial cells on self-assembled monolayers J Biomed Mater Res 52,261-269[CrossRef][Medline][Order article via Infotrieve]
  20. Ebihara, N, Mizushima, H, Miyazaki, K, et al (2000) The functions of exogenous and endogenous laminin-5 on corneal epithelial cells Exp Eye Res 71,69-79[CrossRef][Medline][Order article via Infotrieve]
  21. Murphy, CJ, Campbell, S, Araki-Sasaki, K, Marfurt, CF. (1998) Effect of norepinephrine on proliferation, migration, and adhesion of SV-40 transformed human corneal epithelial cells Cornea 17,529-536[Medline][Order article via Infotrieve]
  22. McDermott, AM, Kern, TS, Murphy, CJ. (1998) The effect of elevated extracellular glucose on migration, adhesion and proliferation of SV40 transformed human corneal epithelial cells Curr Eye Res 17,924-932[CrossRef][Medline][Order article via Infotrieve]
  23. Bodnar, AG, Ouellette, M, Frolkis, M, et al (1998) Extension of life-span by introduction of telomerase into normal human cells Science 279,349-352[Abstract/Free Full Text]
  24. Vaziri, H, Benchimol, S. (1998) Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span Curr Biol 8,279-282[CrossRef][Medline][Order article via Infotrieve]
  25. Weinberg, RA. (1998) Bumps on the road to immortality Nature 396,23-24[Medline][Order article via Infotrieve]
  26. Kiyono, T, Foster, SA, Koop, JI, McDougall, JK, Galloway, DA, Klingelhutz, AJ. (1998) Both Rb/p16INK4a inactivation and telomerase activity are required to immortalize human epithelial cells Nature 396,84-88[CrossRef][Medline][Order article via Infotrieve]
  27. Rheinwald, JG, Hahn, WC, Ramsey, MR, et al (2002) A two-stage, p16INK4A- and p53-dependent keratinocyte senescence mechanism that limits replicative potential independent of telomere status Mol Cell Biol 22,5157-5172[Abstract/Free Full Text]
  28. Shapiro, GI, Edwards, CD, Ewen, ME, Rollins, BJ. (1998) p16INK4A participates in a G1 arrest checkpoint in response to DNA damage Mol Cell Biol 18,378-387[Abstract/Free Full Text]
  29. Wolfel, T, Hauer, M, Schneider, J, et al (1995) A p16INK4a-insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma Science 269,1281-1284[Abstract/Free Full Text]
  30. Shaulian, E, Zauberman, A, Ginsberg, D, Oren, M. (1992) Identification of a minimal transforming domain of p53: negative dominance through abrogation of sequence-specific DNA binding Mol Cell Biol 12,5581-5592[Abstract/Free Full Text]
  31. Gottlieb, E, Haffner, R, von Ruden, T, Wagner, EF, Oren, M. (1994) Down-regulation of wild-type p53 activity interferes with apoptosis of IL-3-dependent hematopoietic cells following IL-3 withdrawal EMBO J 13,1368-1374[Medline][Order article via Infotrieve]
  32. Hahn, WC, Counter, CM, Lundberg, AS, Beijersbergen, RL, Brooks, MW, Weinberg, RA. (1999) Creation of human tumour cells with defined genetic elements Nature 400,464-468[CrossRef][Medline][Order article via Infotrieve]
  33. Dickson, MA, Hahn, WC, Ino, Y, et al (2000) Human keratinocytes that express hTERT and also bypass a p16INK4a-enforced mechanism that limits lifespan become immortal yet retain normal growth and differentiation characteristics Mol Cell Biol 20,1436-1447[Abstract/Free Full Text]
  34. Pirisi, L, Yasumoto, S, Feller, M, Doniger, J, DiPaolo, JA. (1987) Transformation of human fibroblasts and keratinocytes with human papillomavirus type 16 DNA J Virol 61,1061-1066[Abstract/Free Full Text]
  35. Schon, M, Rheinwald, JG. (1996) A limited role for retinoic acid and the RAR{alpha} and RARß receptors in regulating keratin 19 expression and keratinization in oral and epidermal keratinocytes J Invest Dermatol 107,428-438[CrossRef][Medline][Order article via Infotrieve]
  36. Hori, J, Joyce, N, Streilein, JW. (2000) Epithelium-deficient corneal allografts display immune privilege beneath the kidney capsule Invest Ophthalmol Vis Sci 41,443-452[Abstract/Free Full Text]
  37. Wenkel, H, Streilein, JW. (2000) Evidence that retinal pigment epithelium functions as an immune-privileged tissue Invest Ophthalmol Vis Sci 41,3467-3473[Abstract/Free Full Text]
  38. Argueso, P, Balaram, M, Spurr-Michaud, S, Keutmann, HT, Dana, MR, Gipson, IK. (2002) Decreased levels of the goblet cell mucin MUC5AC in tears of patients with Sjögren syndrome Invest Ophthalmol Vis Sci 43,1004-1011[Abstract/Free Full Text]
  39. Kurpakus, MA, Maniaci, MT, Esco, M. (1994) Expression of keratins K12, K4 and K14 during development of ocular surface epithelium Curr Eye Res 13,805-814[Medline][Order article via Infotrieve]
  40. Argueso, P, Spurr-Michaud, S, Russo, CL, Tisdale, A, Gipson, IK. (2003) MUC16 mucin is expressed by the human ocular surface epithelia and carries the H185 carbohydrate epitope Invest Ophthalmol Vis Sci 44,2487-2495[Abstract/Free Full Text]
  41. Gipson, IK. (2000) In situ hybridization techniques for localizing mucin mRNA Methods Mol Biol 125,323-336[Medline][Order article via Infotrieve]
  42. Inatomi, T, Spurr-Michaud, S, Tisdale, AS, Zhan, Q, Feldman, ST, Gipson, IK. (1996) Expression of secretory mucin genes by human conjunctival epithelia Invest Ophthalmol Vis Sci 37,1684-1692[Abstract/Free Full Text]
  43. Inatomi, T, Spurr-Michaud, S, Tisdale, AS, Gipson, IK. (1995) Human corneal and conjunctival epithelia express MUC1 mucin Invest Ophthalmol Vis Sci 36,1818-1827[Abstract/Free Full Text]
  44. Finkbeiner, WE, Carrier, SD, Teresi, CE. (1993) Reverse transcription-polymerase chain reaction (RT-PCR) phenotypic analysis of cell cultures of human tracheal epithelium, tracheobronchial glands, and lung carcinomas Am J Respir Cell Mol Biol 9,547-556
  45. Gipson, IK, Spurr-Michaud, S, Moccia, R, et al (1999) MUC4 and MUC5B transcripts are the prevalent mucin messenger ribonucleic acids of the human endocervix Biol Reprod 60,58-64[Abstract/Free Full Text]
  46. Williams, SJ, McGuckin, MA, Gotley, DC, Eyre, HJ, Sutherland, GR, Antalis, TM. (1999) Two novel mucin genes down-regulated in colorectal cancer identified by differential display Cancer Res 59,4083-4089[Abstract/Free Full Text]
  47. Williams, SJ, Wreschner, DH, Tran, M, Eyre, HJ, Sutherland, GR, McGuckin, MA. (2001) Muc13, a novel human cell surface mucin expressed by epithelial and hemopoietic cells J Biol Chem 276,18327-18336[Abstract/Free Full Text]
  48. Yin, BW, Lloyd, KO. (2001) Molecular cloning of the CA125 ovarian cancer antigen: identification as a new mucin (MUC16) J Biol Chem 276,27371-27375[Abstract/Free Full Text]
  49. Gum, JR, Jr, Crawley, SC, Hicks, JW, Szymkowski, DE, Kim, YS. (2002) MUC17, a novel membrane-tethered mucin Biochem Biophys Res Commun 291,466-475[CrossRef][Medline][Order article via Infotrieve]
  50. Wei, Z-G, Lin, T, Sun, T-T, Lavker, RM. (1997) Clonal analysis of the in vivo differentiation potential of keratinocytes Invest Ophthalmol Vis Sci 38,753-761[Abstract/Free Full Text]
  51. Gipson, IK, Inatomi, T. (1997) Mucin genes expressed by the ocular surface epithelium Prog Retinal Eye Res 16,81-98[CrossRef]
  52. Kai, H, Yoshitake, K, Hisatsune, A, et al (1996) Dexamethasone suppresses mucus production and MUC-2 and MUC-5AC gene expression by NCI-H292 cells Am J Physiol 271,L484-L488
  53. Levine, SJ, Larivee, P, Logun, C, Angus, CW, Ognibene, FP, Shelhamer, JH. (1995) Tumor necrosis factor-alpha induces mucin hypersecretion and MUC-2 gene expression by human airway epithelial cells Am J Respir Cell Mol Biol 12,196-204[Abstract]
  54. de Bolos, C, Guma, M, Barranco, C, Garrido, M, Kim, YS, Real, FX. (1998) MUC6 expression in breast tissues and cultured cells: abnormal expression in tumors and regulation by steroid hormones Int J Cancer 77,193-199[CrossRef][Medline][Order article via Infotrieve]
  55. Gollub, EG, Goswami, S, Kouba, D, Marom, Z. (1993) Regulation of mucin gene expression in secretory epithelial cells Biochem Biophys Res Commun 197,667-673[CrossRef][Medline][Order article via Infotrieve]
  56. Han, SY, Lee, MS, Kim, HR, et al (2000) Phorbol 12-myristate 13-acetate induces alteration in mucin gene expression and biological properties of colon cancer cells Int J Oncol 17,487-494[Medline][Order article via Infotrieve]
  57. Gudjonsson, T, Villadsen, R, Nielsen, HL, Ronnov-Jessen, L, Bissell, MJ, Petersen, OW. (2002) Isolation, immortalization, and characterization of a human breast epithelial cell line with stem cell properties Genes Dev 16,693-706[Abstract/Free Full Text]
  58. Merviel, P, Degeorges, A, Salat-Baroux, J, Calvo, F. (1994) Normal human endometrial cells in culture: characterization and immortalization of epithelial and stromal cells by SV 40 large T antigen Biol Cell 80,187-193
  59. LoGuidice, JM, Merten, MD, Lamblin, G, et al (1997) Mucins secreted by a transformed cell line derived from human tracheal gland cells Biochem J 326,431-437
  60. Thornton, DJ, Gray, T, Nettesheim, P, Howard, M, Koo, JS, Sheehan, JK. (2000) Characterization of mucins from cultured normal human tracheobronchial epithelial cells Am J Physiol 278,L1118-L1128
  61. Kim, KC, Brody, JS. (1989) Use of primary cell culture to study regulation of airway surface epithelial mucus secretion Symp Soc Exp Biol 43,231-239[Medline][Order article via Infotrieve]
  62. Pinto, M, Appay, MD, Simon-Assman, P, et al (1982) Enterocytic differentiation of cultured human colon cancer cells by replacement of glucose by galactose in the medium Biol Cell 44,193-196
  63. Kim, KC. (1985) Possible requirement of collagen gel substratum for production of mucin-like glycoproteins by primary rabbit tracheal epithelial cells in culture In Vitro Cell Dev Biol 21,617-621[Medline][Order article via Infotrieve]
  64. Rearick, JI, Jetten, AM. (1989) Effect of substratum and retinoids upon the mucosecretory differentiation of airway epithelial cells in vitro Environ Health Perspect 80,229-237[Medline][Order article via Infotrieve]
  65. Gesell, MS, Luk, GD. (1993) A defined collagen substrate and nutrient diffusion gradient culture system allows human colon cancer cells to assume a more differentiated phenotype Epithelial Cell Biol 2,45-54[Medline][Order article via Infotrieve]
  66. Price-Schiavi, SA, Carraway, CA, Fregien, N, Carraway, KL. (1998) Post-transcriptional regulation of a milk membrane protein, the sialomucin complex (ascites sialoglycoprotein (ASGP)-1/ASGP-2, rat Muc4), by transforming growth factor ß J Biol Chem 273,35228-35237[Abstract/Free Full Text]
  67. Price-Schiavi, SA, Zhu, X, Aquinin, R, Carraway, KL. (2000) Sialomucin complex (rat Muc4) is regulated by transforming growth factor-ß in mammary gland by a novel post-translational mechanism J Biol Chem 275,17800-17807[Abstract/Free Full Text]
  68. Danjo, Y, Watanabe, H, Tisdale, AS, et al (1998) Alteration of mucin in human conjunctival epithelia in dry eye Invest Ophthalmol Vis Sci 39,2602-2609[Abstract/Free Full Text]
  69. Tei, M, Spurr-Michaud, SJ, Tisdale, AS, Gipson, IK. (2000) Vitamin A deficiency alters the expression of mucin genes by the rat ocular surface epithelium Invest Ophthalmol Vis Sci 41,82-88[Abstract/Free Full Text]
  70. Argueso, P, Tisdale, A, Mandel, U, Letko, E, Foster, CS, Gipson, IK. (2003) The cell-layer and cell-type specific distribution of GalNAc-transferases in the ocular surface epithelia is altered during keratinization Invest Ophthalmol Vis Sci 44,87-92



This article has been cited by other articles:


Home page
IOVSHome page
U. Pattamatta, M. Willcox, F. Stapleton, N. Cole, and Q. Garrett
Bovine Lactoferrin Stimulates Human Corneal Epithelial Alkali Wound Healing In Vitro
Invest. Ophthalmol. Vis. Sci., April 1, 2009; 50(4): 1636 - 1643.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. Ricciuto, S. R. Heimer, M. S. Gilmore, and P. Argueso
Cell Surface O-Glycans Limit Staphylococcus aureus Adherence to Corneal Epithelial Cells
Infect. Immun., November 1, 2008; 76(11): 5215 - 5220.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Q. Garrett, S. Xu, P. A. Simmons, J. Vehige, J. L. Flanagan, and M. D. Willcox
Expression and Localization of Carnitine/Organic Cation Transporter OCTN1 and OCTN2 in Ocular Epithelium
Invest. Ophthalmol. Vis. Sci., November 1, 2008; 49(11): 4844 - 4849.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
E. R. Block and J. K. Klarlund
Wounding Sheets of Epithelial Cells Activates the Epidermal Growth Factor Receptor through Distinct Short- and Long-Range Mechanisms
Mol. Biol. Cell, November 1, 2008; 19(11): 4909 - 4917.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
T. D. Blalock, S. J. Spurr-Michaud, A. S. Tisdale, and I. K. Gipson
Release of Membrane-Associated Mucins from Ocular Surface Epithelia
Invest. Ophthalmol. Vis. Sci., May 1, 2008; 49(5): 1864 - 1871.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. Sumiyoshi, J. Ricciuto, A. Tisdale, I. K. Gipson, F. Mantelli, and P. Argueso
Antiadhesive Character of Mucin O-glycans at the Apical Surface of Corneal Epithelial Cells
Invest. Ophthalmol. Vis. Sci., January 1, 2008; 49(1): 197 - 203.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Kumar, L. D. Hazlett, and F.-S. X. Yu
Flagellin Suppresses the Inflammatory Response and Enhances Bacterial Clearance in a Murine Model of Pseudomonas aeruginosa Keratitis
Infect. Immun., January 1, 2008; 76(1): 89 - 96.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
I. K Gipson, T. Blalock, A. Tisdale, S. Spurr-Michaud, S. Allcorn, A. Stavreus-Evers, and K. Gemzell
MUC16 Is Lost from the Uterodome (Pinopode) Surface of the Receptive Human Endometrium: In Vitro Evidence That MUC16 Is a Barrier to Trophoblast Adherence
Biol Reprod, January 1, 2008; 78(1): 134 - 142.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
I. K. Gipson
The Ocular Surface: The Challenge to Enable and Protect Vision: The Friedenwald Lecture
Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4391 - 4398.
[Full Text] [PDF]


Home page
IOVSHome page
T. D. Blalock, S. J. Spurr-Michaud, A. S. Tisdale, S. R. Heimer, M. S. Gilmore, V. Ramesh, and I. K. Gipson
Functions of MUC16 in Corneal Epithelial Cells
Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4509 - 4518.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Kumar, J. Yin, J. Zhang, and F.-S. X. Yu
Modulation of Corneal Epithelial Innate Immune Response to Pseudomonas Infection by Flagellin Pretreatment
Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4664 - 4670.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
M.-K. Shyu, M.-C. Lin, J.-C. Shih, C.-N. Lee, J. Huang, C.-H. Liao, I-F. Huang, H.-Y. Chen, M.-C. Huang, and F.-J. Hsieh
Mucin 15 is expressed in human placenta and suppresses invasion of trophoblast-like cells in vitro
Hum. Reprod., October 1, 2007; 22(10): 2723 - 2732.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Q. Garrett, P. A. Simmons, S. Xu, J. Vehige, Z. Zhao, K. Ehrmann, and M. Willcox
Carboxymethylcellulose Binds to Human Corneal Epithelial Cells and Is a Modulator of Corneal Epithelial Wound Healing
Invest. Ophthalmol. Vis. Sci., April 1, 2007; 48(4): 1559 - 1567.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
R. Duan, L. Remeijer, J. M. van Dun, A. D. M. E. Osterhaus, and G. M. G. M. Verjans
Granulocyte Macrophage Colony-Stimulating Factor Expression in Human Herpetic Stromal Keratitis: Implications for the Role of Neutrophils in HSK
Invest. Ophthalmol. Vis. Sci., January 1, 2007; 48(1): 277 - 284.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
P. Argueso and M. Sumiyoshi
Characterization of a carbohydrate epitope defined by the monoclonal antibody H185: sialic acid O-acetylation on epithelial cell-surface mucins
Glycobiology, December 1, 2006; 16(12): 1219 - 1228.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
C. L. Russo, S. Spurr-Michaud, A. Tisdale, J. Pudney, D. Anderson, and I. K. Gipson
Mucin gene expression in human male urogenital tract epithelia
Hum. Reprod., November 1, 2006; 21(11): 2783 - 2793.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. R. Mazie, J. K. Spix, E. R. Block, H. B. Achebe, and J. K. Klarlund
Epithelial cell motility is triggered by activation of the EGF receptor through phosphatidic acid signaling
J. Cell Sci., April 15, 2006; 119(8): 1645 - 1654.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
N. J. Weyand, S. W. Lee, D. L. Higashi, D. Cawley, P. Yoshihara, and M. So
Monoclonal Antibody Detection of CD46 Clustering beneath Neisseria gonorrhoeae Microcolonies
Infect. Immun., April 1, 2006; 74(4): 2428 - 2435.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
E. Sekiyama, T. Nakamura, L. J. Cooper, S. Kawasaki, J. Hamuro, N. J. Fullwood, and S. Kinoshita
Unique distribution of thrombospondin-1 in human ocular surface epithelium.
Invest. Ophthalmol. Vis. Sci., April 1, 2006; 47(4): 1352 - 1358.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
P. Argueso, A. Tisdale, S. Spurr-Michaud, M. Sumiyoshi, and I. K. Gipson
Mucin Characteristics of Human Corneal-Limbal Epithelial Cells that Exclude the Rose Bengal Anionic Dye
Invest. Ophthalmol. Vis. Sci., January 1, 2006; 47(1): 113 - 119.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Y. Hori, S. J. Spurr-Michaud, C. L. Russo, P. Argueso, and I. K. Gipson
Effect of Retinoic Acid on Gene Expression in Human Conjunctival Epithelium: Secretory Phospholipase A2 Mediates Retinoic Acid Induction of MUC16
Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4050 - 4061.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Ophthalmol.Home page
J S Mehta, C E Futter, S R Sandeman, R G A F Faragher, K A Hing, K E Tanner, and B D S Allan
Hydroxyapatite promotes superior keratocyte adhesion and proliferation in comparison with current keratoprosthesis skirt materials
Br. J. Ophthalmol., October 1, 2005; 89(10): 1356 - 1362.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
D. M. Robertson, L. Li, S. Fisher, V. P. Pearce, J. W. Shay, W. E. Wright, H. D. Cavanagh, and J. V. Jester
Characterization of Growth and Differentiation in a Telomerase-Immortalized Human Corneal Epithelial Cell Line
Invest. Ophthalmol. Vis. Sci., February 1, 2005; 46(2): 470 - 478.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Kumar, J. Zhang, and F.-S. X. Yu
Innate Immune Response of Corneal Epithelial Cells to Staphylococcus aureus Infection: Role of Peptidoglycan in Stimulating Proinflammatory Cytokine Secretion
Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3513 - 3522.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Y. Hori, S. Spurr-Michaud, C. L. Russo, P. Argueso, and I. K. Gipson
Differential Regulation of Membrane-Associated Mucins in the Human Ocular Surface Epithelium
Invest. Ophthalmol. Vis. Sci., January 1, 2004; 45(1): 114 - 122.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Y. Diebold, M. Calonge, A. E. de Salamanca, S. Callejo, R. M. Corrales, V. Saez, K. F. Siemasko, and M. E. Stern
Characterization of a Spontaneously Immortalized Cell Line (IOBA-NHC) from Normal Human Conjunctiva
Invest. Ophthalmol. Vis. Sci., October 1, 2003; 44(10): 4263 - 4274.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
P. Argueso, S. Spurr-Michaud, C. L. Russo, A. Tisdale, and I. K. Gipson
MUC16 Mucin Is Expressed by the Human Ocular Surface Epithelia and Carries the H185 Carbohydrate Epitope
Invest. Ophthalmol. Vis. Sci., June 1, 2003; 44(6): 2487 - 2495.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gipson, I. K.
Right arrow Articles by Russo, C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gipson, I. K.
Right arrow Articles by Russo, C. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS