|
|
||||||||
1From the Division of Head and Neck Cancer Research, Department of Otolaryngology-Head and Neck Surgery, The Johns Hopkins University School of Medicine, Baltimore, Maryland; 3The Wilmer Eye Institute, Johns Hopkins University School of Medicine, Baltimore, Maryland; the 4Laboratory of Molecular Pathology, "Casa Sollievo della Sofferenza," San Giovanni Rotondo, Italy; and the 5Department of Ophthalmology, Hadassah University Hospital and the Hebrew University Hadassah School of Medicine, Jerusalem, Israel.
| Abstract |
|---|
|
|
|---|
METHODS. Twenty-nine formalin-fixed, paraffin-embedded posterior uveal melanomas were included in the study. DNA was extracted from the paraffin sections followed by PCR amplification of exon 15 and detection of the common BRAF missense mutation (T
A transversion at nucleotide 1796) using restriction enzyme analysis.
RESULTS. Although positive cutaneous melanoma control cell lines harbored the T1796A BRAF mutation, none of the 29 uveal melanomas harbored the mutation.
CONCLUSIONS. These data suggest that BRAF T1796A activating mutation is not common in primary uveal melanoma. These findings are in accord with known differences in tumorigenesis between uveal and cutaneous melanomas.
Uveal and cutaneous melanomas originate from a common precursor cell, the melanocyte, which migrates from the neural crest to the respective site during the embryonic development period.5 The similar genetic background and some common histologic characteristics suggest a similar pathogenesis in these tumors.6 7 Although risk factors such as fair skin complexion and blue iris color may be shared,4 UV radiation and sunlight effect appears to play a significant role only in cutaneous melanoma.8 Furthermore, uveal melanoma metastasizes hematogenously, with the liver frequently affected,9 whereas cutaneous melanoma tends to spread through the lymphatic system, usually affecting the regional lymph nodes.10
Unlike cutaneous melanoma, little is known about the underlying molecular pathogenesis of uveal melanoma. Loss of gene function due to deletions or inactivating mutations, as well as gain-of-function mutations is the hallmark of cancer cells.11 To date, no oncogenes or tumor-suppressor genes have been linked to uveal melanoma. Cytogenetic analyses of uveal melanoma have identified chromosome 3 monosomy and increased chromosome 8, short arm, copy number in more than 50% of the tumors.12 13 This alteration also correlates significantly with metastasis and decreased survival.1 14
The importance of oncogenic mutations in the RAS/ RAF/ MEK/ERK pathway has been well documented in human cancer. More than 15% of all human cancers harbor point mutations of RAS.15 Constant activation of this pathway provides a potent promitogenic force, resulting in abnormal proliferation and differentiation in many human cancers.16 The association between RAS mutations and human uveal melanomas was investigated in several studies.17 18 Soparker et al.18 screened Ha-ras, Ki-ras, and N-ras at codons 12, 13, and 61 and could not find any mutations. It is still not known whether other genes in the RAS/ RAF/ MEK/ERK pathway have a role in the development of uveal melanoma.
Mutations in one of the RAF genes, BRAF, have been recently discovered in the majority of cutaneous melanomas,15 cutaneous nevi,19 and papillary thyroid carcinoma20 and to a lesser extent in other cancers.15 21 The predominant mutation reported in cutaneous melanoma and cutaneous nevi was a thymine-to-adenine (T
A) transversion at nucleotide position 1796 (corresponding to an amino-acid swap of glutamate for valine at residue 599; V599E). This transversion resulted in constant activation of BRAF and, in turn, of the MEK/ERK pathway. To screen for a possible shared etiologic factor between uveal and cutaneous melanomas, we screened 29 cases of primary posterior uveal melanoma tumors for the T1796A BRAF mutation.
| Materials and Methods |
|---|
|
|
|---|
DNA Extraction
Tumor tissue was microdissected from an area in the sections with more than 75% malignant cells. DNA was purified by standard phenol-chloroform extraction followed by ethanol precipitation.13
BRAF Exon 15 PCR Amplification
Approximately 100 ng of total cellular DNA was used in each PCR amplification. The PCR was performed using specific BRAF exon 15 primers: forward primer: TCATAATGCTTGCTCTGATAGGA; reverse primer: GGCCAAAAATTTAATCAGTGGA, as described elsewhere.15 A step-down PCR protocol was used as follows: 95°C for 2 minutes, 1 cycle; 95°C for 1 minute, 60°C for 1 minute, 72°C for 1 minute, 2 cycles; 95°C for 1 second, 58°C for 1 minute, 72°C for 1 minute, 2 cycles; 95°C, for 1 minute, 56°C for 1 minute, and 72°C for 1 minute for 30 cycles and a final extension at 72°C for 5 minutes.
Analysis of BRAF T1796A Mutations
Analysis of BRAF T1796A mutations was performed as described previously.20 Briefly, 10 µL of PCR product was incubated with 1 µL of TspRI restriction enzyme (10 U/ µL New England Biolabs, Beverly, MA) in a 30-µL reaction volume overnight at 65°C. The same reaction replacing the enzyme with deionized (d)H2O was used as negative control. The samples were loaded and run on a nondenaturing 10% polyacrylamide gel. The gels were stained with ethidium bromide, and the bands were visualized under a UV lamp.
| Results |
|---|
|
|
|---|
|
| Discussion |
|---|
|
|
|---|
Although common in cutaneous nevi and cutaneous melanoma, the T1796A BRAF mutation was absent in uveal melanomas. Because we did not sequence the complete exon 15 in the present study, we cannot exclude completely the presence of other less common BRAF mutations (V599D, V599K, V599R)15 19 in uveal melanoma. However, the very common T1796A (V599E) BRAF mutation in cutaneous nevi and cutaneous melanomas does not play a role in the pathogenesis of uveal melanoma. This result is in accord with the known epidemiologic and histologic differences previously described between these two melanoma subtypes.3 9 22 It is conceivable that uveal melanoma arises from a series of genetic changes divergent from those of cutaneous melanoma. Although chromosome 3 monosomy and 8q trisomy are common in uveal melanoma, they are rarely observed in cutaneous melanoma.2 Integrin expression, which is essential for growth and metastatic capacity of cutaneous melanoma cells, as well as the expression of melanoma-associated antigens and the melanocortin-1 receptor, differ markedly between uveal and cutaneous melanomas.3 23 24 25 Our findings thus support further genetic diversity between cutaneous and uveal melanomas.
| Footnotes |
|---|
Submitted for publication December 28, 2002; revised February 12, 2003; accepted February 21, 2003.
Disclosure: Y. Cohen, None; N. Goldenberg-Cohen, None; P. Parrella, None; I. Chowers, None; S.L. Merbs, None; J. Peer, None; D. Sidransky, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: David Sidransky, Division of Head and Neck Cancer Research, Department of Otolaryngology-Head and Neck Surgery, Johns Hopkins University, 720 Rutland Avenue, Ross Building 818, Baltimore, MD 21205-2196; dsidrans{at}jhmi.edu.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. Lefevre, N. Babchia, A. Calipel, F. Mouriaux, A.-M. Faussat, S. Mrzyk, and F. Mascarelli Activation of the FGF2/FGFR1 Autocrine Loop for Cell Proliferation and Survival in Uveal Melanoma Cells Invest. Ophthalmol. Vis. Sci., March 1, 2009; 50(3): 1047 - 1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sekulic, P. Haluska Jr, A. J. Miller, J. G. De Lamo, S. Ejadi, J. S. Pulido, D. R. Salomao, E. C. Thorland, R. G. Vile, D. L. Swanson, et al. Malignant Melanoma in the 21st Century: The Emerging Molecular Landscape Mayo Clin. Proc., July 1, 2008; 83(7): 825 - 846. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Babchia, A. Calipel, F. Mouriaux, A.-M. Faussat, and F. Mascarelli 17-AAG and 17-DMAG-Induced Inhibition of Cell Proliferation through B-Raf Downregulation in WTB-Raf-Expressing Uveal Melanoma Cell Lines Invest. Ophthalmol. Vis. Sci., June 1, 2008; 49(6): 2348 - 2356. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Maat, E. Kilic, G. P. M. Luyten, A. de Klein, M. J. Jager, N. A. Gruis, and P. A. Van der Velden Pyrophosphorolysis Detects B-RAF Mutations in Primary Uveal Melanoma Invest. Ophthalmol. Vis. Sci., January 1, 2008; 49(1): 23 - 27. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Henriquez, C. Janssen, E. G. Kemp, and F. Roberts The T1799A BRAF Mutation Is Present in Iris Melanoma Invest. Ophthalmol. Vis. Sci., November 1, 2007; 48(11): 4897 - 4900. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Merhavi, Y. Cohen, B. C. R. Avraham, S. Frenkel, I. Chowers, J. Pe'er, and N. Goldenberg-Cohen Promoter Methylation Status of Multiple Genes in Uveal Melanoma Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4403 - 4406. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chin, L. A. Garraway, and D. E. Fisher Malignant melanoma: genetics and therapeutics in the genomic era. Genes & Dev., August 15, 2006; 20(16): 2149 - 2182. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Kokkinakis, A. G. Brickner, J. M. Kirkwood, X. Liu, J. E. Goldwasser, A. Kastrama, C. Sander, D. Bocangel, and S. Chada Mitotic Arrest, Apoptosis, and Sensitization to Chemotherapy of Melanomas by Methionine Deprivation Stress Mol. Cancer Res., August 1, 2006; 4(8): 575 - 589. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Calipel, F. Mouriaux, A.-L. Glotin, F. Malecaze, A.-M. Faussat, and F. Mascarelli Extracellular Signal-regulated Kinase-dependent Proliferation Is Mediated through the Protein Kinase A/B-Raf Pathway in Human Uveal Melanoma Cells J. Biol. Chem., April 7, 2006; 281(14): 9238 - 9250. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Beeram, A. Patnaik, and E. K. Rowinsky Raf: A Strategic Target for Therapeutic Development Against Cancer J. Clin. Oncol., September 20, 2005; 23(27): 6771 - 6790. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Goldenberg-Cohen, Y. Cohen, E. Rosenbaum, Z. Herscovici, I. Chowers, D. Weinberger, J. Pe'er, and D. Sidransky T1799A BRAF Mutations in Conjunctival Melanocytic Lesions Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3027 - 3030. [Abstract] [Full Text] [PDF] |
||||
![]() |
C W Wong, Y S Fan, T L Chan, A S W Chan, L C Ho, T K F Ma, the Cancer Genome Project, S T Yuen, and S Y Leung BRAF and NRAS mutations are uncommon in melanomas arising in diverse internal organs J. Clin. Pathol., June 1, 2005; 58(6): 640 - 644. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Gear, H. Williams, E. G. Kemp, and F. Roberts BRAF Mutations in Conjunctival Melanoma Invest. Ophthalmol. Vis. Sci., August 1, 2004; 45(8): 2484 - 2488. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lefevre, A.-L. Glotin, A. Calipel, F. Mouriaux, T. Tran, Z. Kherrouche, C.-A. Maurage, C. Auclair, and F. Mascarelli Roles of Stem Cell Factor/c-Kit and Effects of Glivec(R)/STI571 in Human Uveal Melanoma Cell Tumorigenesis J. Biol. Chem., July 23, 2004; 279(30): 31769 - 31779. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Cohen, E. Rosenbaum, S. Begum, D. Goldenberg, C. Esche, O. Lavie, D. Sidransky, and W. H. Westra Exon 15 BRAF Mutations Are Uncommon in Melanomas Arising in Nonsun-Exposed Sites Clin. Cancer Res., May 15, 2004; 10(10): 3444 - 3447. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Goodall, S. Martinozzi, T. J. Dexter, D. Champeval, S. Carreira, L. Larue, and C. R. Goding Brn-2 Expression Controls Melanoma Proliferation and Is Directly Regulated by {beta}-Catenin Mol. Cell. Biol., April 1, 2004; 24(7): 2915 - 2922. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Goodall, C. Wellbrock, T. J. Dexter, K. Roberts, R. Marais, and C. R. Goding The Brn-2 Transcription Factor Links Activated BRAF to Melanoma Proliferation Mol. Cell. Biol., April 1, 2004; 24(7): 2923 - 2931. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Calipel, G. Lefevre, C. Pouponnot, F. Mouriaux, A. Eychene, and F. Mascarelli Mutation of B-Raf in Human Choroidal Melanoma Cells Mediates Cell Proliferation and Transformation through the MEK/ERK Pathway J. Biol. Chem., October 24, 2003; 278(43): 42409 - 42418. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |