IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2003;44:2876-2878.)
© 2003 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.02-1329

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cohen, Y.
Right arrow Articles by Sidransky, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cohen, Y.
Right arrow Articles by Sidransky, D.

Lack of BRAF Mutation in Primary Uveal Melanoma

Yoram Cohen,1,2 Nitza Goldenberg-Cohen,2,3 Paola Parrella,4 Itay Chowers,3 Shannath L. Merbs,3 Jacob Pe’er,5 and David Sidransky1

1From the Division of Head and Neck Cancer Research, Department of Otolaryngology-Head and Neck Surgery, The Johns Hopkins University School of Medicine, Baltimore, Maryland; 3The Wilmer Eye Institute, Johns Hopkins University School of Medicine, Baltimore, Maryland; the 4Laboratory of Molecular Pathology, "Casa Sollievo della Sofferenza," San Giovanni Rotondo, Italy; and the 5Department of Ophthalmology, Hadassah University Hospital and the Hebrew University Hadassah School of Medicine, Jerusalem, Israel.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. BRAF T1796A activating mutations have been found in a high proportion of cutaneous melanomas, cutaneous nevi, and papillary thyroid carcinoma and in a small fraction of other cancers. This study was designed to investigate the incidence of BRAF T1796A mutation in uveal melanoma.

METHODS. Twenty-nine formalin-fixed, paraffin-embedded posterior uveal melanomas were included in the study. DNA was extracted from the paraffin sections followed by PCR amplification of exon 15 and detection of the common BRAF missense mutation (T->A transversion at nucleotide 1796) using restriction enzyme analysis.

RESULTS. Although positive cutaneous melanoma control cell lines harbored the T1796A BRAF mutation, none of the 29 uveal melanomas harbored the mutation.

CONCLUSIONS. These data suggest that BRAF T1796A activating mutation is not common in primary uveal melanoma. These findings are in accord with known differences in tumorigenesis between uveal and cutaneous melanomas.


Uveal melanoma is the most common form of primary eye cancer in adults, with an annual incidence of six to seven cases per million.1 It accounts for 80% of the noncutaneous melanomas and for 13% of all deaths caused by melanoma.2 This tumor carries up to a 50% 5-year mortality from metastasis that is associated with both histologic and demographic prognostic factors such as cell type, tumor diameter and location, chromosomal aberration, age, and sex.1 3 4

Uveal and cutaneous melanomas originate from a common precursor cell, the melanocyte, which migrates from the neural crest to the respective site during the embryonic development period.5 The similar genetic background and some common histologic characteristics suggest a similar pathogenesis in these tumors.6 7 Although risk factors such as fair skin complexion and blue iris color may be shared,4 UV radiation and sunlight effect appears to play a significant role only in cutaneous melanoma.8 Furthermore, uveal melanoma metastasizes hematogenously, with the liver frequently affected,9 whereas cutaneous melanoma tends to spread through the lymphatic system, usually affecting the regional lymph nodes.10

Unlike cutaneous melanoma, little is known about the underlying molecular pathogenesis of uveal melanoma. Loss of gene function due to deletions or inactivating mutations, as well as gain-of-function mutations is the hallmark of cancer cells.11 To date, no oncogenes or tumor-suppressor genes have been linked to uveal melanoma. Cytogenetic analyses of uveal melanoma have identified chromosome 3 monosomy and increased chromosome 8, short arm, copy number in more than 50% of the tumors.12 13 This alteration also correlates significantly with metastasis and decreased survival.1 14

The importance of oncogenic mutations in the RAS/ RAF/ MEK/ERK pathway has been well documented in human cancer. More than 15% of all human cancers harbor point mutations of RAS.15 Constant activation of this pathway provides a potent promitogenic force, resulting in abnormal proliferation and differentiation in many human cancers.16 The association between RAS mutations and human uveal melanomas was investigated in several studies.17 18 Soparker et al.18 screened Ha-ras, Ki-ras, and N-ras at codons 12, 13, and 61 and could not find any mutations. It is still not known whether other genes in the RAS/ RAF/ MEK/ERK pathway have a role in the development of uveal melanoma.

Mutations in one of the RAF genes, BRAF, have been recently discovered in the majority of cutaneous melanomas,15 cutaneous nevi,19 and papillary thyroid carcinoma20 and to a lesser extent in other cancers.15 21 The predominant mutation reported in cutaneous melanoma and cutaneous nevi was a thymine-to-adenine (T->A) transversion at nucleotide position 1796 (corresponding to an amino-acid swap of glutamate for valine at residue 599; V599E). This transversion resulted in constant activation of BRAF and, in turn, of the MEK/ERK pathway. To screen for a possible shared etiologic factor between uveal and cutaneous melanomas, we screened 29 cases of primary posterior uveal melanoma tumors for the T1796A BRAF mutation.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Pathologic Specimens
Formalin-fixed, paraffin-embedded sections from 29 posterior uveal melanomas were included in the study. The sections were collected from the Wilmer Eye Institute at the Johns Hopkins University School of Medicine (Baltimore, MD) and the ophthalmic pathology laboratory of the Hadassah University Hospital (Jerusalem, Israel). All tumor samples were removed as part of the patient’s treatment and with local ethics committee approval for use of the tissue in this study. The study protocol adhered to the tenets of the Declaration of Helsinki.

DNA Extraction
Tumor tissue was microdissected from an area in the sections with more than 75% malignant cells. DNA was purified by standard phenol-chloroform extraction followed by ethanol precipitation.13

BRAF Exon 15 PCR Amplification
Approximately 100 ng of total cellular DNA was used in each PCR amplification. The PCR was performed using specific BRAF exon 15 primers: forward primer: TCATAATGCTTGCTCTGATAGGA; reverse primer: GGCCAAAAATTTAATCAGTGGA, as described elsewhere.15 A step-down PCR protocol was used as follows: 95°C for 2 minutes, 1 cycle; 95°C for 1 minute, 60°C for 1 minute, 72°C for 1 minute, 2 cycles; 95°C for 1 second, 58°C for 1 minute, 72°C for 1 minute, 2 cycles; 95°C, for 1 minute, 56°C for 1 minute, and 72°C for 1 minute for 30 cycles and a final extension at 72°C for 5 minutes.

Analysis of BRAF T1796A Mutations
Analysis of BRAF T1796A mutations was performed as described previously.20 Briefly, 10 µL of PCR product was incubated with 1 µL of TspRI restriction enzyme (10 U/ µL New England Biolabs, Beverly, MA) in a 30-µL reaction volume overnight at 65°C. The same reaction replacing the enzyme with deionized (d)H2O was used as negative control. The samples were loaded and run on a nondenaturing 10% polyacrylamide gel. The gels were stained with ethidium bromide, and the bands were visualized under a UV lamp.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
To detect BRAF mutations in posterior uveal melanoma, we screened the gene for the T1796A transversion by PCR and restriction enzyme analysis. TspRI digestion of the PCR fragment yielded three major bands at 125, 87, and 12 bp in the wild-type allele. The T1796A mutation abolished one restriction site, resulting in a prominent 212-bp band from the mutant allele and residual bands from the normal allele (Fig. 1) . As positive controls for the BRAF T1796A mutation, we tested the cutaneous melanoma cell lines HTB71, HTB72, and A2058 with known mutation; ME180 (cervical cancer) and HCT116 (colon cancer) served as the negative control. All 29 cases of uveal melanoma screened were negative for the BRAF T1796A mutation. This hot spot was chosen because the reported BRAF-activating mutations in cutaneous nevi and cutaneous melanoma occur almost exclusively in this position.15 19



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 1. Restriction enzyme analysis of the T1796A mutation in exon 15 of the BRAF gene. (A) The presence of the T1796A mutation was determined using the restriction enzyme TspRI. Exon 15 was amplified by PCR and digested with TspRI. The T->A base transversion eliminates a TspRI restriction site within the 224-bp amplified product. PCR, uncut PCR product; WT, wild-type allele (T1796); M, mutant allele (A1796). (B) Digestion products were electrophoresed on 10% polyacrylamide gel and visualized with ethidium bromide stain. Hilo: molecular weight marker; lanes 1 and 2: negative cases; lanes 3 and 4: positive control cell lines.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Although advances in molecular genetics have made possible the identification of genetic changes and particular mutant genes in human tumors, relatively little is known about the molecular genetic alterations leading to the development of uveal melanoma. In an attempt to better understand the molecular events that lead to uveal melanoma, we searched for a BRAF mutation that has been found to occur in up to 80% of cutaneous nevi and cutaneous melanomas.15 19

Although common in cutaneous nevi and cutaneous melanoma, the T1796A BRAF mutation was absent in uveal melanomas. Because we did not sequence the complete exon 15 in the present study, we cannot exclude completely the presence of other less common BRAF mutations (V599D, V599K, V599R)15 19 in uveal melanoma. However, the very common T1796A (V599E) BRAF mutation in cutaneous nevi and cutaneous melanomas does not play a role in the pathogenesis of uveal melanoma. This result is in accord with the known epidemiologic and histologic differences previously described between these two melanoma subtypes.3 9 22 It is conceivable that uveal melanoma arises from a series of genetic changes divergent from those of cutaneous melanoma. Although chromosome 3 monosomy and 8q trisomy are common in uveal melanoma, they are rarely observed in cutaneous melanoma.2 Integrin expression, which is essential for growth and metastatic capacity of cutaneous melanoma cells, as well as the expression of melanoma-associated antigens and the melanocortin-1 receptor, differ markedly between uveal and cutaneous melanomas.3 23 24 25 Our findings thus support further genetic diversity between cutaneous and uveal melanomas.


    Footnotes
 
2 Contributed equally to the work and therefore should be considered equivalent authors. Back

Submitted for publication December 28, 2002; revised February 12, 2003; accepted February 21, 2003.

Disclosure: Y. Cohen, None; N. Goldenberg-Cohen, None; P. Parrella, None; I. Chowers, None; S.L. Merbs, None; J. Pe’er, None; D. Sidransky, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: David Sidransky, Division of Head and Neck Cancer Research, Department of Otolaryngology-Head and Neck Surgery, Johns Hopkins University, 720 Rutland Avenue, Ross Building 818, Baltimore, MD 21205-2196; dsidrans{at}jhmi.edu.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Prescher, G, Bornfeld, N, Hirche, H, Horsthemke, B, Jockel, KH, Becher, R. (1996) Prognostic implications of monosomy 3 in uveal melanoma Lancet 347,1222-1225[CrossRef][Medline][Order article via Infotrieve]
  2. Edmunds, SC, Kelsell, DP, Hungerford, JL, Cree, IA. (2002) Mutational analysis of selected genes in the TGFbeta, Wnt, pRb, and p53 pathways in primary uveal melanoma Invest Ophthalmol Vis Sci 43,2845-2851[Abstract/Free Full Text]
  3. Iwamoto, S, Burrows, RC, Kalina, RE, et al (2002) Immunophenotypic differences between uveal and cutaneous melanomas Arch Ophthalmol 120,466-470[Abstract/Free Full Text]
  4. Gallagher, RP, Elwood, JM, Rootman, J, et al (1985) Risk factors for ocular melanoma: Western Canada Melanoma Study J Natl Cancer Inst 74,775-778
  5. Soufir, N, Bressac-de Paillerets, B, Desjardins, L, et al (2000) Individuals with presumably hereditary uveal melanoma do not harbour germline mutations in the coding regions of either the P16INK4A, P14ARF or cdk4 genes Br J Cancer 82,818-822[CrossRef][Medline][Order article via Infotrieve]
  6. Tucker, MA, Shields, JA, Hartge, P, Augsburger, J, Hoover, RN, Fraumeni, JF, Jr (1985) Sunlight exposure as risk factor for intraocular malignant melanoma N Engl J Med 313,789-792[Abstract]
  7. Rootman, J, Gallagher, RP. (1984) Color as a risk factor in iris melanoma Am J Ophthalmol 98,558-561[Medline][Order article via Infotrieve]
  8. Guenel, P, Laforest, L, Cyr, D, et al (2001) Occupational risk factors, ultraviolet radiation, and ocular melanoma: a case-control study in France Cancer Causes Control 12,451-459[CrossRef][Medline][Order article via Infotrieve]
  9. Didolkar, MS, Elias, EG, Barber, NA, Moore, RH. (1980) Biologic behavior of ocular malignant melanoma and comparison with melanoma of the head and neck Am J Surg 140,522-526[CrossRef][Medline][Order article via Infotrieve]
  10. Chang, AE, Karnell, LH, Menck, HR. (1998) The National Cancer Data Base report on cutaneous and noncutaneous melanoma: a summary of 84,836 cases from the past decade. The American College of Surgeons Commission on Cancer and the American Cancer Society Cancer 83,1664-1678[CrossRef][Medline][Order article via Infotrieve]
  11. Hanahan, D, Weinberg, RA. (2000) The hallmarks of cancer Cell 100,57-70[CrossRef][Medline][Order article via Infotrieve]
  12. Horsthemke, B, Prescher, G, Bornfeld, N, Becher, R. (1992) Loss of chromosome 3 alleles and multiplication of chromosome 8 alleles in uveal melanoma Genes Chromosomes Cancer 4,217-221[Medline][Order article via Infotrieve]
  13. Parrella, P, Sidransky, D, Merbs, SL. (1999) Allelotype of posterior uveal melanoma: implications for a bifurcated tumor progression pathway Cancer Res 59,3032-3037[Abstract/Free Full Text]
  14. Scholes, AG, Liloglou, T, Maloney, P, et al (2001) Loss of heterozygosity on chromosomes 3, 9, 13, and 17, including the retinoblastoma locus, in uveal melanoma Invest Ophthalmol Vis Sci 42,2472-2477[Abstract/Free Full Text]
  15. Davies, H, Bignell, GR, Cox, C, et al (2002) Mutations of the BRAF gene in human cancer Nature 417,949-954[CrossRef][Medline][Order article via Infotrieve]
  16. Avruch, J, Khokhlatchev, A, Kyriakis, JM, et al (2001) Ras activation of the Raf kinase: tyrosine kinase recruitment of the MAP kinase cascade Recent Prog Horm Res 56,127-155[Abstract]
  17. Mooy, CM, Van der Helm, MJ, Van der Kwast, TH, De Jong, PT, Ruiter, DJ, Zwarthoff, EC. (1991) No N-ras mutations in human uveal melanoma: the role of ultraviolet light revisited Br J Cancer 64,411-413[Medline][Order article via Infotrieve]
  18. Soparker, CN, O’Brien, JM, Albert, DM. (1993) Investigation of the role of the ras protooncogene point mutation in human uveal melanomas Invest Ophthalmol Vis Sci 34,2203-2209[Abstract/Free Full Text]
  19. Pollock, PM, Harper, UL, Hansen, KS, et al (2003) High frequency of BRAF mutations in nevi Nat Genet 33,19-20[CrossRef][Medline][Order article via Infotrieve]
  20. Cohen, Y, Xing, M, Mambo, E, et al (2003) BRAF mutation in papillary thyroid carcinoma J Natl Cancer Inst 95,625-627[Abstract/Free Full Text]
  21. Rajagopalan, H, Bardelli, A, Lengauer, C, Kinzler, KW, Vogelstein, B, Velculescu, VE. (2002) Tumorigenesis: RAF/RAS oncogenes and mismatch-repair status Nature 418,934[CrossRef][Medline][Order article via Infotrieve]
  22. Shors, AR, Iwamoto, S, Doody, DR, Weiss, NS. (2002) Relationship of uveal and cutaneous malignant melanoma in persons with multiple primary tumors Int J Cancer 102,266-268[CrossRef][Medline][Order article via Infotrieve]
  23. Mooy, CM, De Jong, PT. (1996) Prognostic parameters in uveal melanoma: a review Surv Ophthalmol 41,215-228[CrossRef][Medline][Order article via Infotrieve]
  24. Marshall, JF, Rutherford, DC, Happerfield, L, et al (1998) Comparative analysis of integrins in vitro and in vivo in uveal and cutaneous melanomas Br J Cancer 77,522-529[Medline][Order article via Infotrieve]
  25. Metzelaar-Blok, JA, ter Huurne, JA, Hurks, HM, Keunen, JE, Jager, MJ, Gruis, NA. (2001) Characterization of melanocortin-1 receptor gene variants in uveal melanoma patients Invest Ophthalmol Vis Sci 42,1951-1954[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
IOVSHome page
N. Babchia, A. Calipel, F. Mouriaux, A.-M. Faussat, and F. Mascarelli
The PI3K/Akt and mTOR/P70S6K Signaling Pathways in Human Uveal Melanoma Cells: Interaction with B-Raf/ERK
Invest. Ophthalmol. Vis. Sci., January 1, 2010; 51(1): 421 - 429.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
G. Lefevre, N. Babchia, A. Calipel, F. Mouriaux, A.-M. Faussat, S. Mrzyk, and F. Mascarelli
Activation of the FGF2/FGFR1 Autocrine Loop for Cell Proliferation and Survival in Uveal Melanoma Cells
Invest. Ophthalmol. Vis. Sci., March 1, 2009; 50(3): 1047 - 1057.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
A. Sekulic, P. Haluska Jr, A. J. Miller, J. G. De Lamo, S. Ejadi, J. S. Pulido, D. R. Salomao, E. C. Thorland, R. G. Vile, D. L. Swanson, et al.
Malignant Melanoma in the 21st Century: The Emerging Molecular Landscape
Mayo Clin. Proc., July 1, 2008; 83(7): 825 - 846.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
N. Babchia, A. Calipel, F. Mouriaux, A.-M. Faussat, and F. Mascarelli
17-AAG and 17-DMAG-Induced Inhibition of Cell Proliferation through B-Raf Downregulation in WTB-Raf-Expressing Uveal Melanoma Cell Lines
Invest. Ophthalmol. Vis. Sci., June 1, 2008; 49(6): 2348 - 2356.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
W. Maat, E. Kilic, G. P. M. Luyten, A. de Klein, M. J. Jager, N. A. Gruis, and P. A. Van der Velden
Pyrophosphorolysis Detects B-RAF Mutations in Primary Uveal Melanoma
Invest. Ophthalmol. Vis. Sci., January 1, 2008; 49(1): 23 - 27.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
F. Henriquez, C. Janssen, E. G. Kemp, and F. Roberts
The T1799A BRAF Mutation Is Present in Iris Melanoma
Invest. Ophthalmol. Vis. Sci., November 1, 2007; 48(11): 4897 - 4900.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
E. Merhavi, Y. Cohen, B. C. R. Avraham, S. Frenkel, I. Chowers, J. Pe'er, and N. Goldenberg-Cohen
Promoter Methylation Status of Multiple Genes in Uveal Melanoma
Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4403 - 4406.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
L. Chin, L. A. Garraway, and D. E. Fisher
Malignant melanoma: genetics and therapeutics in the genomic era.
Genes & Dev., August 15, 2006; 20(16): 2149 - 2182.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
D. M. Kokkinakis, A. G. Brickner, J. M. Kirkwood, X. Liu, J. E. Goldwasser, A. Kastrama, C. Sander, D. Bocangel, and S. Chada
Mitotic Arrest, Apoptosis, and Sensitization to Chemotherapy of Melanomas by Methionine Deprivation Stress
Mol. Cancer Res., August 1, 2006; 4(8): 575 - 589.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Calipel, F. Mouriaux, A.-L. Glotin, F. Malecaze, A.-M. Faussat, and F. Mascarelli
Extracellular Signal-regulated Kinase-dependent Proliferation Is Mediated through the Protein Kinase A/B-Raf Pathway in Human Uveal Melanoma Cells
J. Biol. Chem., April 7, 2006; 281(14): 9238 - 9250.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. Beeram, A. Patnaik, and E. K. Rowinsky
Raf: A Strategic Target for Therapeutic Development Against Cancer
J. Clin. Oncol., September 20, 2005; 23(27): 6771 - 6790.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
N. Goldenberg-Cohen, Y. Cohen, E. Rosenbaum, Z. Herscovici, I. Chowers, D. Weinberger, J. Pe'er, and D. Sidransky
T1799A BRAF Mutations in Conjunctival Melanocytic Lesions
Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3027 - 3030.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
C W Wong, Y S Fan, T L Chan, A S W Chan, L C Ho, T K F Ma, the Cancer Genome Project, S T Yuen, and S Y Leung
BRAF and NRAS mutations are uncommon in melanomas arising in diverse internal organs
J. Clin. Pathol., June 1, 2005; 58(6): 640 - 644.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
H. Gear, H. Williams, E. G. Kemp, and F. Roberts
BRAF Mutations in Conjunctival Melanoma
Invest. Ophthalmol. Vis. Sci., August 1, 2004; 45(8): 2484 - 2488.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Lefevre, A.-L. Glotin, A. Calipel, F. Mouriaux, T. Tran, Z. Kherrouche, C.-A. Maurage, C. Auclair, and F. Mascarelli
Roles of Stem Cell Factor/c-Kit and Effects of Glivec(R)/STI571 in Human Uveal Melanoma Cell Tumorigenesis
J. Biol. Chem., July 23, 2004; 279(30): 31769 - 31779.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Cohen, E. Rosenbaum, S. Begum, D. Goldenberg, C. Esche, O. Lavie, D. Sidransky, and W. H. Westra
Exon 15 BRAF Mutations Are Uncommon in Melanomas Arising in Nonsun-Exposed Sites
Clin. Cancer Res., May 15, 2004; 10(10): 3444 - 3447.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Goodall, S. Martinozzi, T. J. Dexter, D. Champeval, S. Carreira, L. Larue, and C. R. Goding
Brn-2 Expression Controls Melanoma Proliferation and Is Directly Regulated by {beta}-Catenin
Mol. Cell. Biol., April 1, 2004; 24(7): 2915 - 2922.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Goodall, C. Wellbrock, T. J. Dexter, K. Roberts, R. Marais, and C. R. Goding
The Brn-2 Transcription Factor Links Activated BRAF to Melanoma Proliferation
Mol. Cell. Biol., April 1, 2004; 24(7): 2923 - 2931.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Calipel, G. Lefevre, C. Pouponnot, F. Mouriaux, A. Eychene, and F. Mascarelli
Mutation of B-Raf in Human Choroidal Melanoma Cells Mediates Cell Proliferation and Transformation through the MEK/ERK Pathway
J. Biol. Chem., October 24, 2003; 278(43): 42409 - 42418.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cohen, Y.
Right arrow Articles by Sidransky, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cohen, Y.
Right arrow Articles by Sidransky, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS