IOVS Pharmacological Reviews
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

(Investigative Ophthalmology and Visual Science. 2003;44:3310-3316.)
© 2003 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.03-0031
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ha, N. T.
Right arrow Articles by Kanai, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ha, N. T.
Right arrow Articles by Kanai, A.

Mutation Analysis of the Carbohydrate Sulfotransferase Gene in Vietnamese with Macular Corneal Dystrophy

Nguyen Thanh Ha,1 Hoang Minh Chau,2 Le Xuan Cung,1,2 Ton Kim Thanh,2 Keiko Fujiki,1 Akira Murakami,1 Yoshimune Hiratsuka,1 and Atsushi Kanai1

1From the Department of Ophthalmology, Juntendo University School of Medicine, Tokyo, Japan; and the 2National Institute of Ophthalmology, Hanoi, Vietnam.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Mutations in a new carbohydrate sulfotransferase gene (CHST6) encoding corneal N-acetylglucosamine-6-sulfotransferase (C-GlcNac-6-ST) have been identified as the cause of macular corneal dystrophy (MCD) in various ethnicities. This study was conducted to examine the CHST6 gene in Vietnamese with MCD.

METHODS. Nineteen unrelated families, including 35 patients and 38 unaffected relatives were examined clinically. Blood samples were collected. Fifty normal Vietnamese individuals served as control subjects. Genomic DNA was extracted from leukocytes. Analysis of the CHST6 gene was performed with polymerase chain reaction and direct sequencing. Corneal buttons were studied histopathologically.

RESULTS. A slit lamp examination revealed clinical features of MCD with gray-white opacities and stromal haze between. On histopathology, corneal sections showed positive staining with colloidal iron. Sequencing of the CHST6 gene revealed six homozygous and three compound heterozygous mutations. The homozygous mutations, including L59P, V66L, R211Q, W232X, Y268C, and 1067-1068ins(GGCCGTG) were detected, respectively, in two, one, eight, one, one, and two families. Compound heterozygous mutations R211Q/Q82X, S51L/Y268C, and Y268C/1067-1068ins(GGCCGTG) were identified, each in one family. A single heterozygous change at codon 76 (GTG->ATG) was detected in family L, resulting in a valine-to-methionine substitution (V76M). None of these mutations was detected in the control group.

CONCLUSIONS. Mutations identified in the CHST6 gene cosegregated with the disease phenotype in all but one family studied and thus caused MCD. Among these, the R211Q detected in 9 of 19 families may be the most common mutation in Vietnamese. These data also indicate that significant allelic heterogeneity exists for MCD.

Macular corneal dystrophy (MCD; MIM 217800; http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD) is a rare corneal dystrophy characterized by progressive stromal clouding and central corneal thinning.1 2 MCD is inherited as an autosomal recessive trait and is clinically severe in pedigrees with consanguinity. The disease becomes apparent in the first decade of life, starting with a fine superficial stromal haze in the central stroma. Gradually, this opacification extends to the periphery and usually involves the entire thickness of the cornea. Multiple, irregular gray-white nodular opacities develop within the haze. The opacities are more superficial and prominent in the central cornea, but deeper and more discrete in the periphery. As a treatment, penetrating keratoplasty is performed when useful vision has been lost.

Although clinically indistinguishable, MCD has been subdivided into three immunophenotypes (MCD types I, IA, and II) based on measurement of the serum level of sulfated keratan sulfate (KS) and an immunohistochemical evaluation of the corneal tissue.3 4 Histopathologically, MCD is characterized by accumulation of glycosaminoglycans in the epithelium, Bowman’s layer, stroma, Descemet’s membrane, and endothelium, as well as within stromal keratocytes.5 6

A gene responsible for MCD types I and II has been linked to chromosome 16 (q22).7 8 9 Recently, mutations in a new carbohydrate sulfotransferase gene (CHST6) encoding corneal glucosamine N-acetyl-6-sulfotransferase (C-GlcNac-6-ST) have been identified as the cause of MCD.10 In the subjects with MCD type I or IA, numerous missense mutations of CHST6 gene were found to be responsible (Bao W, Smith CF, Al-Rajhi A, Chandler JW, Karcioglu ZA, Akama TO, Fukuda MN, Klintworth GK, ARVO Abstract 2609, 2001).10 11 12 For MCD type II, deletion and/or rearrangements in the upstream region and, recently, a missense mutation were described.10 12

In this study, we analyzed the CHST6 gene for mutations in 19 Vietnamese families with clinical diagnosis of MCD, including 2 families affected by MCD in two consecutive generations.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Subjects
Nineteen unrelated Vietnamese families with MCD from 12 different provinces of the northern and central regions of Vietnam were examined. The affected subjects, including 19 males and 16 females were aged from 14 to 68 (average, 37) years at time of recruitment. All had been under observation at the Department of Corneal and External Diseases, National Institute of Ophthalmology (NIO), Hanoi, Vietnam. Clinical diagnosis of MCD in our patients was based on pedigree structure and the following clinical features: bilateral ground-glass–like haze in the superficial stroma and multiple gray-white opacities with irregular borders within this hazy matrix. Blood samples were obtained from a peripheral blood vessel. Fifty normal Vietnamese subjects were the control subjects. Leukocytes were pelleted and transferred to Juntendo University.

The study was performed according to the tenets of the World Medical Association’s Declaration of Helsinki regarding research involving human subjects. Informed signed consent was obtained from the affected and unaffected family members and from control subjects. This was a joint research project between the NIO, Hanoi, Vietnam, and Juntendo University, Tokyo, Japan, approved by the Ministry of Health of Vietnam (Agreement 10887 YT/QT) and the Ethics Committee of Juntendo University (No. 109).

Mutation Analysis
Genomic DNA was extracted from blood leukocytes by standard procedures.13 The coding region of the CHST6 gene was amplified by polymerase chain reaction (PCR) using each pair of primers and PCR conditions by Akama et al.10 except for the middle coding region, where primers 743F (5'-GCAGACCTTCCTCCTCCTCT-3') and 1578R (5'-TGAGACTGAGCCCAGTGAAG-3') were used. The upstream regions of the CHST6 gene (regions A and B) were analyzed for deletion and replacement mutation by PCR.10 The promoter region (326 bp upstream from start codon) was amplified with a pair of primers: forward/reverse (GGTAATGTGGGTAGGTAGAAC/AGAAAGAGGAGGAGGAAGGTC). For direct sequencing, PCR products were purified with a kit (High Pure PCR Purification; Roche Diagnostics GmbH, Mannheim, Germany)14 15 and then the terminator reaction was performed with a DNA sequencing kit (Big Dye Terminator Cycle Sequencing, Ready Reaction; Applied Biosystems, Foster City, CA). Sequencing was performed in an automated DNA Sequencer (model 377; Applied Biosystems) in both sense and antisense strands. Nucleotide sequences were compared with the published cDNA sequence of the CHST6 gene (GenBank accession number AF219990; http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD).

Pathologic Study
Corneal buttons obtained from 32- and 45-year-old patients at keratoplasty were fixed in 10% buffered formaldehyde solution for routine paraffin wax embedding and light microscopy. Cross sections of each button were prepared and stained with colloidal iron. Unfortunately, we could not perform an assay of KS in serum.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Slit lamp examination of the affected individuals showed superficial stromal cloudiness studded by irregular rounded gray-white opacities in both the central and peripheral cornea (Fig. 1A) . The corneal opacities were deep, involving Descemet’s membrane and the endothelium. In some advanced cases, they enlarged and coalesced, taking on the appearance of a corneal scar, with overlying surface irregularity. Although the age of onset was not determined with certainty, the visual disturbance was usually noticed in the first decade of life. Consanguinity was not a feature in any family. Almost half of the patients with MCD in this study were members of families with more than one affected individual. Of these, the pedigree of family V1 showed numerous individuals affected with MCD (Fig. 1B) .



View larger version (52K):
[in this window]
[in a new window]
  		FIGURE 1. (A) Photograph of the cornea in a patient with MCD shows irregular rounded gray-white opacities with intervening stromal haze, extending to the periphery. (B) Pedigree of family V1 showing numerous individuals affected with MCD. Open symbols: clinically unaffected members; filled symbols: clinically affected members. () Members who were examined clinically; (•) members who were examined genetically. Arrow: the proband. (C) Pathologic section of MCD-affected cornea shows the abnormal accumulations in the subepithelial area, stroma, Descemet’s membrane, and endothelium, stained positively with colloidal iron.

 
Histopathologic sections of two corneal specimens showed the abnormal corneal accumulations in subepithelial area, stroma, Descemet’s membrane, and endothelium stained positively with colloidal iron, indicating glycosaminoglycans of these deposits (Fig. 1C) .

Sequencing of the CHST6 gene within the coding region revealed nine different mutations in 19 unrelated families (Table 1) . Of these, six changes were homozygous and were detected in most of the families. The nucleotide changes: T868C at codon 59 (CTC->CCC), G888C at codon 66 (GTC->CTC), G1324A at codon 211 (CGG->CAG), G1388A at codon 232 (TGG->TGA), and A1495G at codon 268 (TAC->TGC) were identified, resulting, respectively, in a leucine-to-proline (L59P), a valine-to-leucine (V66L), an arginine-to-glutamine (R211Q), a tryptophan-to-stop (W232X), and a tyrosine-to-cysteine (Y268C) substitution (Figs. 2a 2B 2C 2D 2E) . In two families, an insertion of 7 bp between nucleotides 1067 and 1068—nt 1067-1068ins(GGCCGTG)—was identified, resulting in a frameshift after codon 125 (frameshift after 125V; Fig. 2F ).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Mutations of the CHST6 Gene Found in the Present Study

 



View larger version (101K):
[in this window]
[in a new window]
  		FIGURE 2. Homozygous mutations identified by sequencing of the CHST6 gene. (A) Sequence around codon 59 revealed a change of the second nucleotide at codon 59 (CTC->CCC), resulting in a leucine-to-proline substitution (L59P). (B) Sequence around codon 66 revealed a change of the first nucleotide at codon 66 (GTC->CTC), resulting in a valine-to-leucine substitution (V66L). (C) Sequence around codon 211 revealed a change of the second nucleotide at codon 211 (CGG->CAG), resulting in an arginine-to-glutamine substitution (R211Q). (D) Sequence around codon 232 revealed a change of the third nucleotide at codon 232 (TGG->TGA), resulting in a tryptophan-to-stop substitution (W232X). (E) Sequence around codon 268 revealed a change of the second nucleotide (TAC->TGC), resulting in a tyrosine-to-cysteine substitution (Y268C). (F) Sequence around codon 125 revealed an insertion of 7 bp between nucleotides 1067 and 1068—nt 1067-1068ins(GGCCGTG)—resulting in a frameshift after 125V.

 
In addition, compound heterozygous mutations were detected in several families. In family T, two heterozygous changes: C844T at codon 51 (TCG->TTG) and A1495C at codon 268 (TAC->TGC) were identified, predicting an amino acid change of serine to leucine (S51L) and tyrosine to cysteine (Y268C), respectively (Figs. 3A 3B) . In family N, a heterozygous change, C936T at codon 82 (CAG->TAG), replacing a glutamine with a stop codon was detected, along with a G1324A change at codon 211 (CGG->CAG, R211Q; Figs. 3C 3D ). In family V2, heterozygous changes, A1495G, at codon 268 (TAC->TGC, Y268C) and nt1067-1068ins(GGCCGTG) were identified (Figs. 3E 3F) . In family L, a single heterozygous change, G918A, at codon 76 (GTG->ATG) was detected, resulting in a valine-to-methionine substitution (V76M; Fig. 3G ).




View larger version (86K):
[in this window]
[in a new window]
  		FIGURE 3. Heterozygous mutations identified by sequencing of the CHST6 gene. (A) Family T: sequence around codon 51 revealed a change of the second nucleotide at codon 51 (TCG->TTG), resulting in a serine-to-leucine substitution (S51L). (B) Family T: sequence around codon 268 revealed a change of the second nucleotide at codon 268 (TAC->TGC), resulting in a tyrosine-to-cysteine substitution (Y268C). (C) Family N: sequence around codon 82 revealed a heterozygous change of C to T at codon 82 (CAG->TAG), replacing glutamine with a stop codon. (D) Family N: sequence around codon 211 revealed a heterozygous change of the second nucleotide at codon 211 (CGG->CAG), replacing an arginine with glutamine (R211Q). (E) Family V2: sequence around codon 268 revealed a heterozygous change of A to G at codon 268 (TAC->TGC), resulting in a tyrosine-to-cysteine substitution (Y268C). (F) Family V2: sequence around codon 125 revealed a heterozygous nt1067-1068ins(GGCCGTG) change, causing a frameshift after 125V (double-wave peaks after 7-bp insertion are due to nonmatching of nucleotide sequence in two alleles). (G) Family L: sequence around codon 76 revealed a heterozygous change of the first nucleotide at codon 76 (GTG->ATG), resulting in a valine-to-methionine substitution (V76M).

 
Sequencing analysis of this family failed to detect any nucleotide change in the promoter region. Neither a replacement nor a deletion mutation was found in the upstream regions (A and B) of the CHST6 gene by PCR (data not shown). None of the mutations described earlier was detected by direct sequencing in the control population of Vietnamese origin (data not shown).


   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
Macular corneal dystrophy is the least common of the classic stromal dystrophies. This disorder is more common in Iceland, however, representing the most frequent indication for penetrating keratoplasty.16 In the present study, we collected 19 unrelated Vietnamese families with clinically diagnosed MCD. These were considered sporadic cases, because consanguinity was not recognized in any pedigree. Slit lamp examination of the affected individuals showed corneal opacities and stromal haze, characteristic of MCD, as described elsewhere.12 17 Histopathologic examination of corneal buttons showed positive staining with colloidal iron, confirming clinical diagnosis of MCD.

Sequencing analysis of the CHST6 coding region revealed nine distinct alterations of the nucleotide sequence in the patients from 19 families. Of these, six changes, T868C, G888C, G1324A, A1495G, G1388A, and a 7-bp insertion between nucleotides 1067 and 1068, were identified as homozygous. The nucleotide change results in missense mutations with modification of amino acids in the protein product (L59P, V66L, R211Q, and Y268C), causes an early stop codon (W232X), and affects the translated protein (frameshift after 125V). Two other changes: heterozygous C844T and C936T were found in association with the changes A1495G, G1324A, and 1067-1068ins(GGCCGTG), resulting in a compound of different mutations on each allele: S51L/Y268C (family T), R211Q/Q82X (family N), and Y268C frameshift after 125V (family V2). These compound heterozygous mutations could also account for MCD as a recessive disorder. A single heterozygous alteration G918A identified in family L could not be regarded as a cause of the MCD phenotype; further investigation upstream of the CHST6 gene (other than regions A and B) for deletion or replacement mutation or analysis of the other genes, such as CHST4 and CHST5, would be necessary. None of these nucleotide alterations was detected in the 50 control subjects of Vietnamese origin, indicating that these were true disease-causing mutations. Six homozygous and three compound heterozygous mutations cosegregated with the disease phenotype in each pedigree and thus caused MCD in our patients.

The molecular basis of the manifestation of MCD has not yet been elucidated. It has been shown that the decrease in C-GlcNac-6-ST activity in the cornea of patients with MCD may result in the formation of poorly or nonsulfated KS and cause corneal opacity.18 The mutations of the CHST6 gene found in our patients infer an essential role of C-GlcNac-6-ST, the CHST6 protein product, in the production of normally functioning KS. Among various mutations found in Vietnamese patients, R211Q was detected at a relatively high frequency (eight families were homozygous and one family was heterozygous for the mutation).

Although the immunophenotypes of our patients could not be subdivided, most genetic alterations identified herein were missense mutations. Those were described in patients with MCD type I or IA. In our patients, all mutations were detected within the middle coding region amplified with primers 743F and 1578R. Therefore, using this pair of primers may facilitate mutation screening of patients with MCD. The mutations identified in Vietnamese are completely different from the ones reported previously in Asians (Japanese)10 or whites (British and Icelandic).11 12 Together with previous reports,10 11 12 our data indicate that significant allelic heterogeneity exists for MCD.


   Acknowledgements
 
The authors thank Vu Thi Minh Thu, National Institute of Ophthalmology, Hanoi, Vietnam, for valuable technical assistance.


   Footnotes
 
Supported by Grants-in-Aid B05454477 and B07457417 for Scientific Research from the Ministry of Education, Culture, and Sport, Tokyo, Japan.

Submitted for publication January 13, 2003; revised February 27, 2003; accepted March 6, 2003.

Disclosure: N.T. Ha, None; H.M. Chau, None; L.X. Cung, None; T.K. Thanh, None; K. Fujiki, None; A. Murakami, None; Y. Hiratsuka, None; A. Kanai, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Nguyen Thanh Ha, Department of Ophthalmology, Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan; hant02{at}yahoo.com.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Klintworth, GK. (1980) Research into the pathogenesis of macular corneal dystrophy Trans Ophthalmol Soc UK 100,186-194[Medline][Order article via Infotrieve]
  2. Donnenfeld, ED, Cohen, EJ, Ingraham, HJ, et al (1986) Corneal thinning in macular corneal dystrophy Am J Ophthalmol 3,112-113
  3. Yang, CJ, SundarRaj, N, Thonar, EJ. (1988) Immunohistochemical evidence of heterogeneity in macular corneal dystrophy Am J Ophthalmol 106,65-71[Medline][Order article via Infotrieve]
  4. Klintworth, GK, Oshima, E, Al-Rajhi,, et al (1997) Macular corneal dystrophy in Saudi Arabia: a study of 56 cases and recognition of a new immunophenotype Am J Ophthalmol 124,9-18[Medline][Order article via Infotrieve]
  5. Snip, RC, Kenyon, KR, Green, WR. (1973) Macular corneal dystrophy: ultrastructural pathology of corneal endothelium and Descemet’s membrane Invest Ophthalmol Vis Sci 12,88-97[Abstract/Free Full Text]
  6. Francois, J, Hansenns, M, Teuchy, H. (1975) Ultrastructural findings in corneal macular dystrophy (Groenouw type II) Ophthalmic Res 7,80-98
  7. Vance, JM, Jonasson, F, Lennon, F, et al (1996) Linkage of a gene for macular corneal dystrophy to chromosome 16 Am J Hum Genet 58,757-762[Medline][Order article via Infotrieve]
  8. Liu, NP, Baldwin, J, Jonasson, F, et al (1998) Haplotype analysis in Icelandic families defines a minimal interval for the macular corneal dystrophy type I gene Am J Hum Genet 63,912-917[CrossRef][Medline][Order article via Infotrieve]
  9. Liu, NP, Dew-Knight, S, Jonasson, F, et al (2000) Physical and genetic mapping of the macular corneal dystrophy locus on chromosome 16q and exclusion of TAT and LCAT as candidate genes Mol Vis 6,95-100[Medline][Order article via Infotrieve]
  10. Akama, TO, Nishida, K, Nakayama, J, et al (2000) Macular corneal dystrophy type I and type II are caused by distinct mutations in a new sulfotransferase gene Nat Genet 26,237-241[CrossRef][Medline][Order article via Infotrieve]
  11. Liu, NP, Dew-Knight, S, Rayner, M, et al (2000) Mutations in corneal carbohydrate sulfotransferase6 gene (CHST6) cause macular corneal dystrophy in Iceland Mol Vis 6,261-264[Medline][Order article via Infotrieve]
  12. El-Ashry, MF, El-Aziz, MM, Wilkins, S, et al (2002) Identification of novel mutations in the carbohydrate sulfotransferase gene (CHST6) causing macular corneal dystrophy Invest Ophthalmol Vis Sci 43,377-382[Abstract/Free Full Text]
  13. Blin, N, Stafford, DW. (1976) A general method for isolation of high molecular weight DNA from eukaryotes Nucleic Acids Res 3,2303-2308
  14. Sanger, F, Nicklen, S, Coulson, AR. (1977) DNA sequencing with chain terminating inhibitors Proc Natl Acad Sci USA 74,5463-5467[Abstract/Free Full Text]
  15. Smith, LM, Sanders, JZ, Kaiser, RJ, et al (1986) Fluorescence detection in automated DNA sequence analysis Nature 321,674-679[CrossRef][Medline][Order article via Infotrieve]
  16. Jonasson, F, Johannsson, JH, Garner, A, Rice, NS. (1989) Macular corneal dystrophy in Iceland Eye 3,446-454
  17. Jonasson, F, Oshima, E, Thonar, EJ, Smith, CF, Johannsson, JH, Klintworth, GK. (1996) Macular corneal dystrophy in Iceland: a clinical, genealogic, and immunohistochemical study of 28 patients Ophthalmology 103,1111-1117[Medline][Order article via Infotrieve]
  18. Hasegawa, N, Takayoshi, T, Kato, T, et al (2000) Decreased GlcNAc 6-O-sulfotransferase activity in the cornea with macular corneal dystrophy Invest Ophthalmol Vis Sci 41,3670-3677[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Arch OphthalmolHome page
A. J. Aldave and B. Sonmez
Elucidating the Molecular Genetic Basis of the Corneal Dystrophies: Are We There Yet?
Arch Ophthalmol, February 1, 2007; 125(2): 177 - 186.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
Y. Hayashida, T. O. Akama, N. Beecher, P. Lewis, R. D. Young, K. M. Meek, B. Kerr, C. E. Hughes, B. Caterson, A. Tanigami, et al.
Matrix morphogenesis in cornea is mediated by the modification of keratan sulfate by GlcNAc 6-O-sulfotransferase
PNAS, September 5, 2006; 103(36): 13333 - 13338.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ha, N. T.
Right arrow Articles by Kanai, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ha, N. T.
Right arrow Articles by Kanai, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS