(Investigative Ophthalmology and Visual Science. 2003;44:4006-4011.)
© 2003 by The Association for Research in Vision and Ophthalmology, Inc.
DOI: 10.1167/iovs.03-0040
Interleukin-6 in Retinal Ischemia Reperfusion Injury in Rats
Ruben N. Sanchez,1
Candy K. Chan,1
Sumit Garg,1
Jacky M. K. Kwong,2
Micheline J. Wong,1
Alfredo A. Sadun,1 and
Tim T. Lam1
1From the Department of Ophthalmology, Doheny Eye Institute, University of Southern California, Keck School of Medicine, Los Angeles, California; and the
2Glaucoma Division, Department of Ophthalmology, Jules Stein Eye Institute, University of California at Los Angeles School of Medicine, Los Angeles, California.
 |
Abstract
|
|---|
PURPOSE. To study the role of interleukin (IL)-6 after retinal ischemiareperfusion (I/R) injury in rats.
METHODS. Intraocular pressure of adult male Lewis albino rats was raised to create retinal ischemia for 1 hour. Retinal reperfusion was reestablished, and the animals were killed at various time points after the injury. Their eyes were enucleated and processed for immunohistochemistry to detect IL-6 and ED-1 (a marker of microglial/phagocytic cells), enzyme-linked immunosorbent assay (ELISA) of IL-6 protein, and semiquantitative real-time RT-PCR for IL-6 mRNA. The neuroprotective effect of IL-6 was evaluated by giving intravitreal injections of 150 or 300 ng rat recombinant IL-6 to eyes immediately after I/R injury and counting cresyl violetstained retinal ganglion cell layer cells (RGCLCs) and fluorochrome-labeled retinal ganglion cells (RGCs) on flat preparations of retinas at 7 days.
RESULTS. IL-6positive cells appeared after I/R injury in the inner plexiform layer (IPL) and the inner nuclear layer (INL). Their numbers were significantly higher 18 hours after the injury, and most of these cells were also ED-1 positive. ELISA showed noticeable increases in endogenous retinal IL-6 protein levels 8 hours after I/R injury. Semiquantitative real-time RT-PCR showed significant increases in endogenous retinal IL-6 mRNA levels between 2 and 18 hours. Exogenously added IL-6 prevented between 50% and 70% of RGC loss after I/R injury.
CONCLUSIONS. IL-6 is upregulated after retinal I/R injury, and its expression by microglia/phagocytic cells may protect RGC layer neurons from I/R injury. Exogenously added IL-6 protects the inner retina after I/R injury.
Interleukin (IL)-6 is a multifunctional cytokine that belongs to the GP130 family of cytokines. It is expressed in the brain in neurons,1 2 microglia,3 4 5 and glial cells6 after middle cerebral artery occlusion (MCAO) or intrastriatal injection of quinolinic acid. IL-6 protects cerebral neurons from ischemia7 and N-methyl-D-aspartate (NMDA)induced excitotoxicity8 in vivo, enhances retinal ganglion cell (RGC)9 and dorsal root ganglion cell10 survival in vitro, and protects cortical cell cultures from NMDA-induced excitotoxicity.11 However, it has been recently reported that IL-6 knockout (-/-) mice have an increased number of RGCs after optic nerve crush injury or glutamate-induced excitotoxicity,12 when compared with their wild-type counterparts, suggesting a neurodegenerative role for IL-6. In addition, increased plasma levels of IL-6 in patients who had had a stroke were associated with a poorer neurologic outcome.13 Therefore, the role of IL-6 in neuronal injury may be complicated.
Ischemia reperfusion (I/R) injury to the retina causes degeneration of inner retinal elements, including the RGCs,14 15 16 and leads to visual deficiency. Understanding the pathophysiology of I/R injury to the retina is important for development of therapeutic strategies for protecting these neurons. It has been reported that multiple cytokines such as IL-1ß,17 TNF-
, IFN-
, TGF-ß, and IL-6 are upregulated18 and that IL-1ß mediates the degeneration of inner retinal elements after I/R injury.19 However, the roles of IL-6 and other cytokines in retinal I/R injury are not clear.
In this study, we examined the possible involvement of IL-6 by localizing it with immunohistochemistry, profiling the temporal changes of its protein and mRNA with enzyme-linked immunosorbent assay (ELISA) and semiquantitative real-time RT-PCR, and evaluating the effect of exogenous IL-6 after I/R injury.
 |
Materials and Methods
|
|---|
Induction of Retinal I/R Injury in Rats
All animals used in this study adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Adult male Lewis albino rats (4550 days old) were kept under controlled lightdark conditions with food and water available ad libitum. A previously described procedure was used to induce retinal I/R in the rats.20 Briefly, animals were anesthetized with ketamine-xylazine (10 mg/kg and 4 mg/kg, respectively; Fort Dodge Animal Health, Fort Dodge, IA) intramuscularly, and retinal ischemia was induced by elevating the intraocular pressure to 110 mm Hg by cannulating the anterior chamber of the eye with a tube connected to an elevated reservoir containing saline. Ischemia was confirmed by ophthalmoscopic examination by noting the blanching of retinal arteries and loss of the red reflex. One hour later, the cannulating needles were removed to allow for reperfusion of the retinal vasculature. Animals were killed at various times with a pentobarbital overdose, and their eyes were enucleated.
Immunohistochemistry of IL-6 and ED-1
Normal eyes (n = 3) and eyes at 18 (n = 3) or 48 (n = 3) hours after reperfusion were obtained and fixed in 10% formalin in 0.1 M phosphate-buffered saline (PBS; pH 7.4) at 4°C overnight, processed, embedded in paraffin, and sectioned. Only sections containing the whole retina with visible portions of the optic nerve head were used for the studies. Standard protocol for immunohistochemistry of IL-6 using the avidin-biotin complex (ABC) method was followed, with a rabbit anti-rat IL-6 polyclonal antibody (1:100; Research Diagnostics Inc., Flanders, NJ) and a kit (EnVision+; Dako, Carpinteria, CA) used according to the manufacturers instructions. IL-6positive cells in the inner plexiform layer (IPL), inner nuclear layer (INL), and retinal ganglion cell layer (RGCL) of each retina were counted by two individuals independently with the samples masked.
Fluorescent double immunolabeling of IL-6 and ED-1 was performed according to a standard protocol, with a monoclonal mouse anti-rat ED-1 antibody (1:100; Serotec, Raleigh, NC) and a polyclonal rabbit anti-rat IL-6 antibody (1:100; Research Diagnostics, Inc.) as primary antibodies, and an anti-mouse antibody conjugated to tetramethylrhodamine isothiocyanate (TRITC; Dako) and an anti-rabbit antibody conjugated to FITC (Dako) as secondary antibodies on sections of eyes at 18 hours after I/R injury. Colocalization of IL-6 and ED-1 was visualized with a fluorescence confocal microscope (model 510; Carl Zeiss Meditech, Thornwood, NY).
ELISA for IL-6
Standard protocol for IL-6 ELISA was followed to measure the levels of immunoreactive IL-6 in retinas after I/R injury, according to the manufacturers instructions21 22 (Quantikine M rat IL-6 immunoassay kit; R&D Systems, Minneapolis, MN). Normal retinas and retinas at 0, 4, 8, 12, 18, 24, and 72 hours after I/R injury (n = 4 for each time point) were collected and homogenized for 30 seconds in 0.1 M PBS (pH 7.4). The homogenates were centrifuged for 10 minutes at 17,000g at 4°C, and 100 µL of the supernatant was used for each determination.19 The optical density of each sample (in triplicate) was determined with a microplate spectrophotometer (Benchmark Plus; Bio-Rad, Hercules, CA). IL-6 content was calculated according to the manufacturers instructions and reported as picograms per milligram protein. The assay was repeated, and the averages of the two runs were reported.
Relative Quantitative Real-Time RT-PCR of IL-6 mRNA
Retinal samples were obtained at 0 (n = 13), 2 (n = 4), 4 (n = 12), 8 (n = 12), 12 (n = 5), 18 (n = 5), 24 (n = 5), and 48 (n = 5) hours after reperfusion and homogenized with extraction RNA reagent (TRIzol; Invitrogen-Gibco, Carlsbad, CA). Total RNA was isolated by a standard guanidinium thiocyanate-phenol-chloroform extraction protocol,23 and DNA contamination was eliminated with a DNase I kit (Ambion, Austin, TX). One microgram of RNA was reverse transcribed with commercial reverse transcriptase (Promega, Madison, WI) under the following conditions: 22°C for 5 minutes; 42°C for 60 minutes; and 95°C for 5 minutes.
Primers for real-time PCR were designed on computer (Primer Express software; Applied Biosystems, Foster City, CA) and synthesized by Operon (Alameda, CA): TCAACTCCATCTGCCCTTCAG (sense) and AAGGCAACTGGCTGGAAGTCT (antisense) for IL-6 and TAAGCGAAACTGGCGGAAAC (sense) and CAGGATCTGGCCCTTGAATCT (anti-sense) for the housekeeping gene L-32. Semiquantitative real-time PCR was performed with a Light Cycler (Gene Amp 5700; Applied Biosystems). The reaction was initiated using 12.5 µL green nucleic acid gel stain (SYBR Green PCR Master Mix; Applied Biosystems), 2.5 µL forward primer, 2.5 µL reverse primer, 2.5 µL of ddH2O (Promega), and 5 µL cDNA (1:10 dilution). The following conditions were used for 40 cycles: denaturation at 95°C for 15 seconds and annealing and extension at 60°C for 60 seconds. Standard fit point analysis to generate a crossing-point time (Ct) for each PCR reaction as it achieved 1 unit of fluorescence was used for comparison of IL-6 mRNA levels relative to L-32.
Protective Effect of Exogenous IL-6
Rat recombinant IL-6 (R&D Systems) 150 and 300 ng in 2 µL 0.1 M PBS, 2 µL 0.1 M PBS, or 50 nanomoles MK-801 (positive control)24 in 2 µL 0.1 M PBS were injected into the vitreous body immediately after I/R injury.
For some retinas, the effect on RGCL cell (RGCLC) loss was evaluated by using a previously described procedure for flatmounted whole retinas, cresyl violet staining, and cell counting.25 26 27 Briefly, RGCLC densities were determined by counting RGC-like cells in 16 distinct areas of 5.06 x 10-2/mm2 each (four areas per retinal quadrant at 0.5 [central retina] and 4 mm [peripheral retina] from the optic nerve head). The averages of the four quadrants were reported, and each flat preparation was counted by two individuals independently with the samples masked.
To confirm that IL-6 protects RGCs after I/R injury, retinas were retrogradely labeled with a gold fluorochrome (FluoroGold; Fluorochrome, Englewood, CO) 5 days after I/R injury, according to a previously described procedure.28 29 Briefly, an incision was made in the conjunctiva close to the superior orbital rim, to expose the optic nerve (ON), which was subsequently transected approximately 1 mm from the posterior pole without damaging the retinal blood supply. A piece of gelfoam soaked in 2% aqueous fluorochrome was placed on the stump of the transected ON. Rats were killed 2 days later (7 days after I/R injury) by an overdose of pentobarbital. Retinas were dissected, fixed in 4% paraformaldehyde, and flatmounted onto glass slides. Cell counting was performed as previously described under a fluorescence microscope (Nikon, Melville, NY) equipped with a UV filter set (365/397 nm).28 RGC densities were determined by counting the tracer-labeled RGCs in 16 distinct areas of 1.36 x 10-1/mm2 each (four areas per retinal quadrant at 0.5 [central retina] and 4 mm [peripheral retina] from the optic nerve head). The averages of the four quadrants were recorded, and each flat preparation was counted by two individuals independently with the samples masked.
Statistical Analysis of Cell Counts with Fluorochrome Labeling or Cresyl Violet Staining
Cell densities for each retina are described in the text and shown in scatterplot format as the mean ± SD, representing the results in four to seven retinas. Statistical analyses were performed by the Student-Newman-Keuls method (ANOVA). Differences in cell numbers were considered significant at P < 0.05.
 |
Results
|
|---|
IL-6 Immunoreactivity in Rat Retinas after I/R Injury
Figure 1 illustrates the presence of IL-6positive cells in retinas at 18 hours after I/R injury. These IL-6 immunoreactive cells were pleiomorphic and were localized to the IPL and INL. Counting of the IL-6positive cells showed very few (2.2 ± 1.5) cells in normal retinas, significant elevations in the number of cells (41.3 ± 9.1, n = 3; P < 0.001 versus normal, Tukey test) at 18 hours, and a return to normal (13.0 ± 3.5) at 48 hours (Fig. 2) . Double immunostaining of retinas at 18 hours showed colocalization of IL-6 and ED-1, a marker for microglial/phagocytic cells, in most of the ED-1positive cells (Fig. 3) .

View larger version (116K):
[in this window]
[in a new window]
|
FIGURE 1. IL-6 immunoreactivity in rat retinas. Normal retina (A) and retina at 18 (B) and 48 (C) hours after I/R injury. Note the appearance of IL-6positive cells in the IPL and INL (arrows) after I/R injury.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
FIGURE 2. Quantitation of IL-6positive cells in the inner retina. Note a significant increase in the number of IL-6positive cells in the IPL and INL of retinas 18 hours after I/R injury (n = 3, *P < 0.001 versus normal; Tukey test). Data are expressed as the mean ± SEM of results in three retinas.
|
|

View larger version (133K):
[in this window]
[in a new window]
|
FIGURE 3. Double immunolabeling of IL-6 and ED-1. Note colocalization of IL-6 (A) and ED-1 (B) in cells (arrows) in the IPL and the INL at 18 hours after I/R injury.
|
|
Endogenous IL-6 Protein and mRNA Levels
Retinal IL-6 protein was significantly elevated 8 hours after I/R injury (40 ± 27 pg/mg, n = 4; P < 0.050 versus normal, Dunnett method; Fig. 4A ). There were no detectable levels of IL-6 mRNA in the normal nonischemic retinas; (Ct = 40 for all normal samples; n = 6; data not shown). Therefore, relative multiples of changes in IL-6 gene expression using L-32 as a reference were calculated in comparison with levels at hour 0 (n = 13) after I/R injury, rather than in normal retinas. IL-6 mRNA showed a rapid increase as early as 2 hours (270 ± 241-fold, n = 4; P < 0.05 vs. hour 0, Dunn method) and remained elevated 12 hours (349 ± 388-fold, n = 6; P < 0.05 versus 0 hours, Dunn method) after I/R injury (Fig. 4B) . Gene expression of IL-6 approached levels similar to 0 hour levels by 48 hours. Efficiency analysis demonstrated that IL-6 and L-32 primers had comparable efficiencies (data not shown).

View larger version (19K):
[in this window]
[in a new window]
|
FIGURE 4. IL-6 levels after I/R injury. (A) IL-6 protein levels were significantly elevated 8 hours after I/R injury (40 ± 27 pg/mg protein, n = 4; *P < 0.050 versus normal; Dunnett method). Data are expressed as the mean ± SEM of results in four retinas measured twice, each time in triplicate. (B) Relative IL-6 mRNA expression. Semiquantitative real-time RT-PCR showed significantly elevated levels (*P < 0.001 versus 0 hour, Tukey test) of IL-6 mRNA at 2 (n = 4), 4 (n = 12), 8 (n = 12), 12 (n = 5), and 18 (n = 5) hours when compared with 0-hour (n = 13) samples. L-32 was used as a housekeeping gene. Data are expressed as the mean ± SEM of results in 4 to 12 retinas.
|
|
Effect of Exogenous IL-6 after I/R Injury
Intravitreal injection of 150 or 300 ng recombinant IL-6 protected cells of the inner retina after I/R injury, as indicated by the elevated number of fluorochrome-labeled RGCs in central areas of 150-ng IL-6 treated retinas (1866 ± 222 RGCs/mm2, n = 7; P < 0.050 versus vehicle; Student-Newman-Keuls method) and 300 ng IL-6treated retinas (1739 ± 159 RGCs/mm2, n = 6; P < 0.050 versus vehicle; Student-Newman-Keuls method) when compared with the corresponding areas of vehicle-treated retinas (1400 ± 246 RGCs/mm2, n = 7). There were also significantly higher numbers of fluorochrome labeled RGCs in peripheral areas of 150-ng IL-6 treated retinas (1521 ± 167 RGCs/mm2, n = 7; P < 0.050 versus vehicle; Student-Newman-Keuls method) and 300 ng IL-6 treated retinas (1454 ± 171 RGCs/mm2, n = 6; P < 0.050 versus vehicle; Student-Newman-Keuls method) when compared with the corresponding areas of vehicle-treated retinas (1235 ± 99 RGCs/mm2, n = 7). The number of cells in normal retinas were 2059 ± 200 RGCs/mm2 (n = 5) and 1689 ± 135 RGCs/mm2 (n = 5) for central and peripheral areas respectively (Fig. 5A) .

View larger version (22K):
[in this window]
[in a new window]
|
FIGURE 5. (A) Effect of IL-6 on the number of RGCs after I/R injury. Significantly higher numbers of fluorochrome-labeled RGCs in central areas of 150-ng IL-6treated (1866 ± 222 RGCs/mm2, n = 7; P < 0.050 versus vehicle; Student-Newman-Keuls method) and 300-ng IL-6treated retinas (1739 ± 159 RGCs/mm2, n = 6; P < 0.050 versus vehicle; Student-Newman-Keuls method) when compared with the corresponding areas of vehicle-treated retinas (1400 ± 246 RGCs/mm2, n = 7). Also note the significantly higher number of fluorochrome-labeled RGCs in peripheral areas of 150-ng IL-6treated retinas (1521 ± 167 RGCs/mm2, n = 7; P < 0.050 versus vehicle; Student-Newman-Keuls method) and 300-ng IL-6treated retinas (1454 ± 171 RGCs/mm2, n = 6; P < 0.050 versus vehicle) when compared with the corresponding areas of vehicle-treated retinas (1235 ± 99 RGCs/mm2, n = 7.) Each data point represents the number of RGCs/mm2 per retina evaluated. The error bars represent the mean ± SD. (B) Effect of IL-6 on RGCLCs after I/R injury. There was a significantly higher number of cresyl violetstained RGCLCs in central areas of 150-ng IL-6treated retinas (5063 ± 508 RGCLCs/mm2, n = 4; P < 0.001 versus vehicle; Student-Newman-Keuls method) and 300-ng IL-6treated retinas (4847 ± 1011 RGCLCs/mm2, n = 6; P < 0.001 versus vehicle; Student-Newman-Keuls method) when compared with the corresponding areas of vehicle-treated retinas (2491 ± 615 RGCLCs/mm2, n = 5). MK-801treated retinas were used as the positive control (5286 ± 350 RGCLCs/mm2, n = 4; P < 0.001 versus vehicle; Student-Newman-Keuls method). There were also significantly higher numbers of cresyl violetstained RGCLCs in peripheral areas of 150-ng IL-6treated (4671 ± 161 RGCLCs/mm2, n = 4; P < 0.001 versus vehicle; Student-Newman-Keuls method) and 300-ng IL-6treated retinas (4626 ± 792, n = 6; P < 0.001 versus vehicle; Student-Newman-Keuls method) when compared with the corresponding areas of vehicle-treated retinas (2680 ± 588 RGCLCs/mm2, n = 5). MK-801treated retinas (4830 ± 744 RGCLCs/mm2, n = 4; P < 0.001 versus vehicle; Student-Newman-Keuls method) were used as the positive control. Each data point represents the number of RGCLCs per square millimeter per retina evaluated. The error bars represent the mean ± SD.
|
|
There was also a significantly higher number of cresyl violetstained RGCLCs 7 days after I/R injury in central areas of 150-ng IL-6treated (5063 ± 508 RGCLCs/mm2, n = 4; P < 0.001 versus vehicle; Student-Newman-Keuls method) and 300-ngtreated retinas (4847 ± 1011 RGCLCs/mm2, n = 6; P < 0.001 versus vehicle; Student-Newman-Keuls method) when compared with the corresponding areas of vehicle-treated retinas (2491 ± 615 RGCLCs/mm2, n = 5). Higher numbers of cresyl violetstained RGCLCs in peripheral areas of 150 ng IL-6 treated (4671 ± 161 RGCLCs/mm2, n = 4; P < 0.001 versus vehicle; Student-Newman-Keuls method) and 300 ng IL-6 treated retinas (4626 ± 792 RGCLCs/mm2, n = 6; P < 0.001 versus vehicle; Student-Newman-Keuls method) were also noted when compared with the corresponding areas of vehicle-treated retinas (2680 ± 588 RGCLCs/mm2, n = 5). In the normal, the number was 6164 ± 419.910 RGCLCs/mm2 (n = 4) and 5659 ± 167 RGCLCs/mm2 (n = 4) in the central and peripheral retinas, respectively (Fig. 5B) .
 |
Discussion
|
|---|
In this study, we demonstrated the presence of IL-6containing ED-1positive cells in the rat retina after retinal I/R injury. ELISA and relative quantitative real-time RT-PCR showed an upregulation of endogenous IL-6 protein and its mRNA, respectively, after I/R injury. In addition, exogenous IL-6 introduced immediately after I/R injury protected the RGCs. These results are consistent with the hypothesis that endogenous IL-6 is upregulated in the inner retina after neuronal injury as a self-defensive mechanism for RGCLCs, including RGCs after I/R injury, and that microglial/phagocytic cells play important roles in this self-defensiveprotective action.
Elevated IL-6 levels have been demonstrated in neurons of the substantia nigra1 and entopeduncular nucleus2 and microglial cells of the ischemic core and penumbra3 4 5 after MCAO. Expression of IL-6 in neurons and microglia in the gerbil forebrain that sustained direct ischemic injury during MCAO3 4 has also been reported. In addition, glial cells expressing IL-6 in striatal tissue that underwent neuronal degeneration as a direct result of stereotaxic injection of quinolinic acid were also noted.6 Hence, neurons, microglia/phagocytic cells, and other glial cells in neuronal tissue may express IL-6 after injury but the cell types that express IL-6 may vary. In contrast to these earlier studies showing a wide distribution of IL-6 in neuronal tissue after injury, we found little expression of IL-6 in neurons of the retina, and most IL-6 was localized in microglial/phagocytic cells that appeared after I/R injury. The reason for these differences is not clear. One of the possible explanations is that the studies that noted IL-6 exclusively in neurons focused on tissue response to I/R injury in areas of the brain that did not have an interruption of blood flow and that the response resulted from transsynaptic degeneration. In addition, our study is consistent with other studies that demonstrated microglial activation in many tissues during neurodegeneration30 31 32 33 and that microglia/phagocytic cells synthesize and secrete IL-6 on activation.3 4 5 Further studies are under way to examine the signaling pathways regulating the generation of IL-6 by these phagocytic cells in rat retinas after I/R injury.
It has been reported that optic nerve ligatureinduced I/R injury stimulates endogenous IL-6 gene expression in the retina at 6 and 12 hours.18 The locations or cell types containing IL-6 were not examined. We noted IL-6 mRNA elevation as early as 2 hours, suggesting that one of the earliest responses by the retina to I/R injury is gene expression of neuroprotective cytokines such as IL-6. This was similar to other studies in the brain showing IL-6 mRNA expression as early as 3 hours after MCAO11 34 35 and stereotaxic injection of quinolinic acid.6 Our study also suggests that IL-6 mRNA is translated into its protein by demonstrating a peak in IL-6 immunoreactivity at 8 hours with our ELISA and at 18 hours with our morphometric analysis of IL-6positive cells. These findings correlate with the data in Suzuki et al.,5 which demonstrated a peak in IL-6 protein within the first 24 hours after MCAO. Hence, early expression of IL-6 mRNA and subsequent synthesis and secretion of its protein may be a universal response to I/R injury in neural tissues.
In this study, we used two widely used techniques to assess the effect of IL-6 on retinal ganglion cell layer neurons: cresyl violet staining and RGCLC counting and fluorochrome labeling and RGC counting. Our study showed large differences between the number of RGCLCs observed in the cresyl violet assay and the RGCs counted in the fluorochrome labeling assay, with the former showing much higher numbers. This is not unexpected, because quantification through cresyl violet staining probably overestimates the number of RGCs, in that displaced amacrine cells constitute a substantial population of cells in the GCL.27 In contrast, our fluorochrome labeling may underestimate the total number of RGCs, because axotomy may affect retrograde transport of fluorescent gold label to the RGC bodies. Nonetheless, the number of fluorochrome-labeled RGCs/mm2 in the normal adult rat retina that we reported herein is between 200 and 500 RGCs/mm2 less than has been reported in other studies.28 36 37 38 In addition, consistent with the report of Gellrich and Gellrich27 our cresyl violet assay gave a good indication of changes in RGC number in the retina.27
Our observation that IL-6 is neuroprotective of the inner retina is consistent with other studies. IL-6 deficiency exacerbated 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)induced toxicity in dopaminergic neurons,39 aggravated degeneration of hippocampal neurons after hippocampal injection of kainic acid,40 and induced higher rates of apoptosis41 and decreased survival42 of cortical neurons in the frontoparietal cortex subjected to focal cryo-induced injury. In earlier studies, site-specific administration of IL-6 has also been shown to be neuroprotective after permanent MCAO in rats7 and NMDA-induced excitotoxicity of rat striatal cholinergic neurons.8 However, these finding are in contrast to the IL-6 knockout (-/-) mouse study by Fisher et al.,12 suggesting that IL-6 may exacerbate retinal injury. The reason for the discrepancy between these former findings and those of Fisher et al. remains unclear. Although, there is little information on the neuroprotective mechanism of IL-6 in the retina, it is widely believed that IL-6 exerts its activity through its receptor (IL-6R) and its associated glycoprotein GP130. Further studies are currently under way to characterize these downstream modulators of IL-6 in the retina after I/R injury.
Because neurodegenerative diseases involve the interplay of multiple cytokines, it is conceivable that cytokine therapies, particularly those that involve neuroprotective cytokines such as IL-6 may one day encompass our current pharmacological regimen for the treatment of these diseases. However, the route and timing of IL-6 administration are major concerns for cytokine-based therapies, and further studies are needed to address the possible side affects of such therapies, because systemic cytokine administration has induced systemic lupus erythematosus and thyroiditis,43 44 renal dysfunction,45 and reversible retinopathy.46 Local administration of IL-6 to the retina, although challenging, could be a powerful neuroprotective strategy.
In summary, we report an increased number of IL-6immunopositive microglial/phagocytic cells in the inner retina after I/R injury that show upregulation of endogenous IL-6 protein and its mRNA and that exogenous IL-6 protected neurons in the RGCL from I/R injury. These findings are consistent with our hypothesis that I/R injury induces phagocytic/microglial cells to protect RGCs against I/R injury through expression of IL-6. Although this hypothesis deviates from other studies that demonstrated that microglia aggravate cerebral ischemia through IL-1ß and TNF-
expression,47 48 49 it is possible that there are heterogenous populations of microglial/phagocytic cells in the retina and that they may synthesize and secrete different spectra of bioactive molecules after I/R injury. Therefore, it is important to characterize further these populations of phagocytic/microglial cells on the basis of the cytokines that they secrete, because future neuroprotective strategies may incorporate mechanisms to upregulate protective populations of microglial/phagocytic cells and/or downregulate neurodegenerative populations in response to neuronal injury.
 |
Acknowledgements
|
|---|
The authors thank Ghalib Manjurr, John Jin, Christine Spee, Antonio Rodriguez, and Ernesto Barron for technical assistance.
 |
Footnotes
|
|---|
Supported by a Medical Student Eye Fellowship from Research to Prevent Blindness (RNS), an American Heart Association Medical Student Research Fellowship (RNS), National Eye Institute Grant EY03040, and an unrestricted grant from Research to Prevent Blindness.
Submitted for publication January 14, 2003; revised April 14 and 30, 2003; accepted May 13, 2003.
Disclosure: R.N. Sanchez, None; C.K. Chan, None; S. Garg, None; J.M.K. Kwong, None; M.J. Wong, None; A.A. Sadun, None; T.T. Lam, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Tim T. Lam, Department of Ophthalmology, Doheny Eye Institute, University of Southern California, Keck School of Medicine, 1355 San Pablo Street, DVRC 307E, Los Angeles, CA 90033; tlam{at}usc.edu.
 |
References
|
|---|
- Dihne, M, Block, F. (2001) Focal ischemia induces transient expression of IL-6 in the substantia nigra pars reticulara Brain Res 889,165-173[CrossRef][Medline][Order article via Infotrieve]
- Dihne, M, Peters, M, Block, F. (2001) Interleukin-6 expression in exo-focal neurons after striatal cerebral ischemia Neuroreport 12,3143-3148[CrossRef][Medline][Order article via Infotrieve]
- Block, F, Peters, M, Nolden-Koch, M. (2000) Expression of IL-6 in the ischemic penumbra Neuroreport 11,963-967[Medline][Order article via Infotrieve]
- Suzuki, S, Tanaka, K, Nagata, E, Ito, D, Dembo, T, Fukuuchi, Y. (1999) Cerebral neurons express interleukin-6 after transient forebrain ischemia in gerbils Neurosci Lett 262,117-120[CrossRef][Medline][Order article via Infotrieve]
- Suzuki, S, Tanaka, K, Nogowa, S, Dembo, T, Kosakai, A, Fukuuchi, Y. (2000) Expression of IL-6 is suppressed by inhibition of voltage-sensitive Na+/Ca2+ channels after cerebral ischemia Neuroreport 11,2565-2569[Medline][Order article via Infotrieve]
- Scheifer, J, Topper, R, Schmidt, W, et al (1998) Expression of interleukin-6 in the rat striatum following stereotaxic injection of quinolinic acid J Neuroimmunol 89,168-176[CrossRef][Medline][Order article via Infotrieve]
- Loddick, SA, Turnbull, AV, Rothwell, NJ. (1998) Cerebral interleukin-6 is neuroprotective during permanent focal cerebral ischemia in the rat J Cereb Blood Flow Metab 18,176-179[CrossRef][Medline][Order article via Infotrieve]
- Toulmond, S, Vige, X, Fage, D, Benavides, J. (1992) Local infusion of interleukin-6 attenuates the neurotoxic effects of NMDA on rat striatal cholinergic neurons Neurosci Lett 144,49-52[CrossRef][Medline][Order article via Infotrieve]
- Torres, PM, Giestal de Araujo, E. (2001) Interleukin-6 increases the survival of retinal ganglion cells in vitro J Neuroimmunol 117,43-50[CrossRef][Medline][Order article via Infotrieve]
- Their, M, Marz, P, Otten, U, Weis, J, Rose-John, S. (1999) Interleukin-6 and its soluble receptor support survival of sensory neurons J Neurosci Res 55,411-422[CrossRef][Medline][Order article via Infotrieve]
- Ali, C, Nicole, O, Docagne, F, et al (2000) Ischemia-induced interleukin-6 as a potential endogenous neuroprotective cytokine against NMDA receptor-mediated excitotoxicity in the brain J Cereb Blood Flow Metab 20,956-966[Medline][Order article via Infotrieve]
- Fisher, J, Mizrahi, T, Schori, H, et al (2001) Increased post-traumatic survival of neurons in IL-6-knockout mice on a background of EAE susceptibility J Neuroimmunol 119,1-9[CrossRef][Medline][Order article via Infotrieve]
- Vila, N, Castillo, J, Davalos, A, Chamorro, A. (2000) Proinflammatory cytokines and early neurological worsening in ischemic stroke Stroke 31,2325-2329[Abstract/Free Full Text]
- Lam, TT, Abler, AS, Tso, MO. (1999) Apoptosis and caspases after ischemia-reperfusion injury in rat retina Invest Ophthalmol Vis Sci 40,967-975[Abstract/Free Full Text]
- Gehlbach, PL, Purple, RL. (1994) A paired comparison of two models of experimental retinal ischemia Curr Eye Res 13,597-602[Medline][Order article via Infotrieve]
- Buchi, ER, Suivaizdis, I, Fu, J. (1991) Pressure-induced retinal ischemia in rats: an experimental model for quantitative study Ophthalmologica 203,138-147[Medline][Order article via Infotrieve]
- Hangai, M, Yoshimura, N, Yoshida, M, Yabuuchi, K, Honda, Y. (1995) Interleukin-1 gene expression in transient retinal ischemia in the rat Invest Ophthalmol Vis Sci 36,571-578[Abstract/Free Full Text]
- Hangai, M, Yoshimura, N, Honda, Y. (1996) Increased cytokine gene expression in rat retina following transient ischemia Ophthalmic Res 28,248-254[Medline][Order article via Infotrieve]
- Yoneda, S, Tanihara, H, Kido, N, et al (2001) Interleukin-1ß mediates ischemic injury in the rat retina Exp Eye Res 73,661-667[CrossRef][Medline][Order article via Infotrieve]
- Chiang, SK, Lam, TT. (2000) Post-treatment at 12 or 18 hours with 3-aminobenzamide ameliorates retinal ischemia-reperfusion damage Invest Ophthalmol Vis Sci 41,3210-3214[Abstract/Free Full Text]
- Robak, E, Sysa-Jedrzejowska, A, Stepien, H, Robak, T. (1997) Circulating interleukin-6 type cytokines in patients with systemic lupus erythematosus Eur Cytokine Netw 8,281-286[Medline][Order article via Infotrieve]
- Shvidel, L, Duksin, C, Tzimanis, A, et al (2002) Cytokine release by activated T-cells in large granular lymphocytic leukemia associated with autoimmune disorders Hematol J 3,32-37[CrossRef][Medline][Order article via Infotrieve]
- Chomcznski, P, Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal Biochem 162,156-159[Medline][Order article via Infotrieve]
- Lam, TT, Siew, E, Chu, R, Tso, MO. (1997) Ameliorative effect of MK-801 on retinal ischemia J Ocul Pharmacol Ther 13,129-137[Medline][Order article via Infotrieve]
- Schmidt-Kastner, R, Eysel, UT. (1994) Ischemic damage visualized in flat mounts of rat retina after photochemically induced thrombosis Brain Res Bull 34,487-491[CrossRef][Medline][Order article via Infotrieve]
- Lam, TT, Abler, AS, Kwong, JK, Tso, MO. (1999) N-methyl-D-aspartate (NMDA)induced apoptosis in the rat retina Invest Ophthalmol Vis Sci 40,2391-2397[Abstract/Free Full Text]
- Gellrich, MM, Gellrich, NC. (1996) Quantitative relations in the retinal ganglion cell layer of the rat: neurons, glia and capillaries before and after optic nerve section Graefes Arch Clin Exp Ophthalmol 234,315-323[Medline][Order article via Infotrieve]
- Nakazawa, T, Tamai,, Mori, N. (2002) Brain-derived neurotrophic factor prevents axotomized retinal ganglion cell death through MAPK and PI3K signaling pathways Invest Ophthalmol Vis Sci 43,3319-3326[Abstract/Free Full Text]
- Nakazawa, T, Tomita, H, Yamaguchi, K, et al (2002) Neuroprotective effect of nipradilol on axotomized rat retinal ganglion cells Curr Eye Res 24,114-122[CrossRef][Medline][Order article via Infotrieve]
- Garden, GA. (2002) Microglia in human immunodeficiency virus-associated neurodegeneration Glia 40,240-251[CrossRef][Medline][Order article via Infotrieve]
- Eikelenboom, P, Bate, C, Van Gool, WA, et al (2002) Neuroinflammation in Alzheimers disease and prion disease Glia 40,232-239[CrossRef][Medline][Order article via Infotrieve]
- Brabeck, C, Michetti, F, Geloso, MC, et al (2002) Expression of EMAP-II by activated monocytes/microglial cells in different regions of the rat hippocampus after trimethyltin-induced brain damage Exp Neurol 177,341-346[CrossRef][Medline][Order article via Infotrieve]
- Kriz, J, Nguyen, MD, Julien, JP. (2002) Minocycline slows disease progression in a mouse model of amyotrophic lateral sclerosis Neurobiol Dis 10,268-278[CrossRef][Medline][Order article via Infotrieve]
- Berti, R, Williams, AJ, Moffett, JR, et al (2002) Quantitative real-time RT-PCR analysis of inflammatory gene expression associated with ischemia-reperfusion brain injury J Cereb Blood Flow Metab 22,1068-1079[CrossRef][Medline][Order article via Infotrieve]
- Wang, X, Yue, TL, Young, PR, Barone, FC, Feuerstein, GZ. (1995) Expression of interleukin-6, c-fos, and zif268 mRNAs in rat ischemic cortex J Cereb Blood Flow Metab 15,166-171[Medline][Order article via Infotrieve]
- Rejdak, R, Zarnowski, T, Turski, WA, et al (2003) Alterations of kynurenic acid content in the retina in response to retinal ganglion cell damage Vision Res 43,497-503[CrossRef][Medline][Order article via Infotrieve]
- Lafuente, MP, Villegas-Perez, MP, Sobrado-Calvo, P, Garcia-Aviles, A, Miralles de Imperial, J, Vidal-Sanz, M. (2001) Neuroprotective effects of alpha(2)-selective adrenergic agonists against ischemia-induced retinal ganglion cell death Invest Ophthalmol Vis Sci 42,2074-2084[Abstract/Free Full Text]
- Selles-Navarro, I, Villegas-Perez, MP, Salvador-Silva, M, Ruiz-Gomez, JM, Vidal-Sanz, M. (1996) Retinal ganglion cell death after different transient periods of pressure-induced ischemia and survival intervals: a quantitative in vivo study Invest Ophthalmol Vis Sci 37,2002-2014[Abstract/Free Full Text]
- Bolin, LM, Strycharska-Orczyk, I, Murray, R, Langston, JW, Di Monte, D. (2002) Increased vulnerability of dopaminergic neurons in MPTP-lesioned interleukin-6 deficient mice J Neurochem 83,167-175[CrossRef][Medline][Order article via Infotrieve]
- Penkowa, M, Molinero, A, Carrasco, J, Hidalgo, J. (2001) Interleukin-6 deficiency reduces the brain inflammatory response and increases oxidative stress and neurodegeneration after kainic acid-induced seizures Neuroscience 102,805-818[CrossRef][Medline][Order article via Infotrieve]
- Penkowa, M, Giralt, M, Carrasco, J, Hadberg, H, Hidalgo, J. (2000) Impaired inflammatory response and increased oxidative stress and neurodegeneration after brain injury in interleukin-6-deficient mice Glia 32,271-285[CrossRef][Medline][Order article via Infotrieve]
- Penkowa, M, Moos, T, Carrasco, J, et al (1999) Strongly compromised inflammatory response to brain injury in interleukin-6-deficient mice Glia 25,343-357[CrossRef][Medline][Order article via Infotrieve]
- Conlon, KC, Urba, WJ, Smith, JW, Steis, RG, Longo, DL, Clark, JW. (1990) Exacerbation of symptoms of autoimmune disease in patients receiving alpha-interferon therapy Cancer 65,2237-2242[CrossRef][Medline][Order article via Infotrieve]
- Vial, T, Descotes, J. (1995) Immune-mediated side-effects of cytokines in humans Toxicology 105,31-57[CrossRef][Medline][Order article via Infotrieve]
- Phillips, TM. (1996) Interferon-
induces renal dysfunction and injury Curr Opin Nephrol Hypertens 5,380-383[CrossRef][Medline][Order article via Infotrieve]
- Guyer, DR, Tiedeman, J, Yannuzzi, LA. (1993) Interferon-associated retinopathy Arch Ophthalmol 111,350-356[Abstract]
- Davies, CA, Loddick, SA, Toulmond, S, Stroemer, RP, Hunt, J, Rothwell, NJ. (1999) The progression and topographic distribution of interleukin-1beta expression after permanent middle cerebral artery occlusion in the rat J Cereb Blood Flow Metab 19,87-98[Medline][Order article via Infotrieve]
- Barone, FC, Arvin, B, White, RF, et al (1997) Tumor necrosis factor-alpha: a mediator of focal ischemic brain injury Stroke 28,1233-1244[Abstract/Free Full Text]
- Feuerstein, G, Wang, X, Barone, FC. (1998) Cytokines in brain ischemia: the role of TNF alpha Cell Mol Neurobiol 18,695-701[CrossRef][Medline][Order article via Infotrieve]
This article has been cited by other articles:

|
 |

|
 |
 
R. M. Sappington and D. J. Calkins
Contribution of TRPV1 to Microglia-Derived IL-6 and NF{kappa}B Translocation with Elevated Hydrostatic Pressure
Invest. Ophthalmol. Vis. Sci.,
July 1, 2008;
49(7):
3004 - 3017.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Y. Chong, C. S. Boehlke, Q.-D. Zheng, L. Zhang, Y. Han, and D. N. Zacks
Interleukin-6 as a Photoreceptor Neuroprotectant in an Experimental Model of Retinal Detachment
Invest. Ophthalmol. Vis. Sci.,
July 1, 2008;
49(7):
3193 - 3200.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. S. Farivar, H. E. Merry, M. J. Fica-Delgado, A. S. McCourtie, B. C. Mackinnon-Patterson, and M. S. Mulligan
Interleukin-6 Regulation of Direct Lung Ischemia Reperfusion Injury
Ann. Thorac. Surg.,
August 1, 2006;
82(2):
472 - 478.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. Sappington, M. Chan, and D. J. Calkins
Interleukin-6 protects retinal ganglion cells from pressure-induced death.
Invest. Ophthalmol. Vis. Sci.,
July 1, 2006;
47(7):
2932 - 2942.
[Abstract]
[Full Text]
[PDF]
|
 |
|