IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2004;45:3555-3559.)
© 2004 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.04-0338

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crowston, J. G.
Right arrow Articles by Weinreb, R. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crowston, J. G.
Right arrow Articles by Weinreb, R. N.

Effect of Latanoprost on Intraocular Pressure in Mice Lacking the Prostaglandin FP Receptor

Jonathan G. Crowston,1,2 James D. Lindsey,1,2 Makoto Aihara,3 and Robert N. Weinreb1,2

1From the Hamilton Glaucoma Center and the 2Department of Ophthalmology, University of California San Diego, La Jolla, California; and the 3Department of Ophthalmology, University of Tokyo, Tokyo, Japan.


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
PURPOSE. To determine whether latanoprost lowers IOP in prostaglandin FP receptor knockout mice.

METHODS. Mean IOP difference between treated and untreated fellow eyes was measured on three separate occasions, 2 hours after a 200-ng dose of latanoprost to the right eye of homozygous (n = 9) and heterozygous (n = 15) FP knockout mice. C57BL/6 (n = 10) and NIH Swiss white mice (n = 17), which have normal FP receptor expression, provided the control population. The investigator was masked to the genotype of the FP knockout mice at the time of IOP measurement.

RESULTS. Latanoprost had no effect on IOP in the homozygous FP knockout mice, with an average difference in IOP between treated and untreated fellow eyes of +0.25 mm Hg and a 95% confidence interval (CI) for the difference between means of –0.019 to +0.69. In contrast, latanoprost reduced IOP in the treated eye of the heterozygous FP knockout, C57BL/6, and Swiss white mice with mean differences and 95% CI of the difference in means of –0.52 (–0.91 to –0.14), –1.38 (–2.1 to –0.70), and –1.29 (–1.78 to –0.79) mm Hg, respectively.

CONCLUSIONS. FP receptor signaling plays a crucial role in the early IOP response to latanoprost in the mouse eye.


Topically administered prostaglandin (PG) F2{alpha} lowers intraocular pressure (IOP) in humans,1 nonhuman primates,2 3 and rodents.4 5 Although effective as an ocular hypotensive, (PG)F2{alpha} has several ocular side effects that preclude developing it for clinical use. In contrast, topical application of latanoprost (PhXA41), a PGF2{alpha} analogue that is a selective agonist of the PG FP receptor6 is well tolerated and has become the most commonly used drug to treat glaucoma and ocular hypertension.7 Although it is generally well accepted that latanoprost reduces IOP by increasing pressure-independent outflow, the exact molecular mechanisms responsible for this are not fully understood.

The FP receptor is a G-protein–coupled receptor that is expressed in the tissues of the uveoscleral outflow pathway including iris, ciliary body,8 and sclera,9 as well as in the trabecular meshwork.10 Pharmacologic studies indicate an important role for FP receptor activation in the IOP response to latanoprost.11 12 13 Despite the receptor selectivity demonstrated in vitro, prostaglandin analogues may act through mechanisms that do not involve FP receptor signaling in vivo. For example, studies that investigated the response to PGF2{alpha} and its analogues in the cat have suggested that IOP reduction and relaxation of the ciliary muscle were not mediated by FP receptor signaling.14 15 The role of the FP receptor in latanoprost-mediated lowering of IOP therefore needs further clarification.

The recent development of techniques that allow accurate measurement of IOP and aqueous humor dynamics in the mouse eye16 provides the opportunity for the investigation of knockout mice that lack the FP receptor.17 These mice were generated by homologous recombination with a target vector that replaces the second exon of the FP gene with the ß-galactosidase– and neomycin-resistant gene. Homozygous knockout mice do not transcribe FP receptor mRNA, whereas heterozygous knockouts transcribe reduced amounts.17 Both the homozygous and heterozygous knockout mice develop normally and have no gross abnormalities in behavior, macro- and microscopic anatomy, or biochemical or hematologic indices.17

Hence, the purpose of this study was to determine whether latanoprost lowers IOP in mice that do not express the PG FP receptor.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Animal Husbandry
All experiments were performed in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. FP knockout mice were obtained as a gift from Shuh Narumiya (Kyoto University, Kyoto, Japan). Because homozygote knockout females fail to initiate parturition,17 heterozygous (female) and homozygous (male) mating pairs were used to generate an F1 generation. C57BL/6 mice, which constitute the background species of the FP knockout mice, were used as the wild-type control. NIH Swiss white mice were used as a further control population. Mice were bred and housed in clear cages covered loosely with air filters and containing white pine shavings for bedding. The environment was kept at 21°C with a 12-hour light (6 AM to 6 PM) and 12-hour dark cycle. All mice were fed ad libitum. Animal age ranged from 6 to 8 months. All measurements were performed between 2 and 6 PM, to minimize the influence of diurnal IOP rhythm and hence possible diurnal variation of mouse IOP.

Drug Application
Four µL 0.005% latanoprost solution (200 ng total; Pfizer, New York, NY) was applied to the right eye of each mouse. During the administration of treatment, animals were gently restrained in a tapered plastic film tube (Decapicone; Braintree Scientific Inc., Braintree, MA) to avoid stress. This 200-ng dose of latanoprost has been found to be the minimum needed to achieve a maximum IOP response in the Swiss white mouse.4

Anesthesia
The mice were anesthetized by intraperitoneal injection of a mixture of ketamine (100 mg/kg, Ketaset; Fort Dodge Animal Health, Fort Dodge, IA) and xylazine (9 mg/kg, TranquiVed; VEDCO Inc., St. Joseph, MO). Each mouse was monitored carefully, to assess the state of anesthesia. If the mouse did not respond to gentle pinching of the back skin, it was placed on the platform for IOP measurement.

Determination of Mouse Genotype by PCR
DNA was extracted from 8-mm tail biopsy samples of anesthetized adult mice (DNeasy tissue kit, cat. no. 69504; Qiagen, Valencia, CA) according to the manufacturer’s guidelines. The oligonucleotide primers used to detect homologous translocation were: 5F (GCCCATCCTTGGACACCGAGA), 6R (AGAGTCGGCAAGCTGTGACTT), and NeoII (TGATATTGCTGAAGAGCTTGG). Amplification was performed over 35 cycles of 94°C for 30 seconds, 65°C for 30 seconds, and 75°C for 10 minutes. Products were analyzed by electrophoresis in 1% agarose gels. The PCR product sizes were 700 bp for the FP receptor and 450 bp corresponding to the LacZ/neo(r) cassette. Thus, DNA from the heterozygous FP+/– mice produced two bands at 700 bp and at 450 bp, whereas DNA from the homozygous FP–/– knockout mice produced a single band at 450 bp (Fig. 1) .



View larger version (61K):
[in this window]
[in a new window]
 
FIGURE 1. FP knockout mice were generated with a target vector LacZ/Neo(r), which replaces the second exon of the FP gene (A). PCR products showing single bands for homozygous knockout mice (FP–/–, {cjs3656}) and double bands for heterozygous FP+/– mice (B). Right lane: 100-bp molecular weight standard.

 
Anterior Segment Histology
Nine-month-old homozygous FP knockout and C57BL/6 mice were euthanatized by CO2 inhalation followed by intracardiac perfusion of approximately 40 mL of fixative containing paraformaldehyde (2%) and glutaraldehyde (2.5%) in 0.15 M sodium cacodylate buffer (pH 7.3). A full-thickness hole was cut in the posterior segment to allow free access of fixative and embedding medium. Eyes were enucleated, incubated overnight in fixative, and embedded in Epon. One- to 2-µm-thick sections were stained with toluidine blue, examined by light microscopy (Eclipse E800; Nikon, Melville, NY) and photographed with a cooled digital camera (SPOT Digital camera system; Diagnostic Instruments, Sterling Heights, MI).

Measurement of IOP
IOP measurements were performed by cannulation of the anterior chamber, as described previously.4 Microneedles were made of borosilicate glass with a tip diameter between 75 and 100 µm.16 The microneedle was mounted on a micromanipulator to enable accurate positioning. It was connected to a pressure transducer (Model BLPR; WPI, Sarasota, FL) which was calibrated against a manometer over the range of 0 to 30 mm Hg, as described previously.4 IOP was measured in both eyes within 7 minutes of the anesthetic injection, to minimize the effect of anesthesia.4 18 Left and right eyes were measured first in alternating rotation in successive mice. The second IOP was measured within 1 minute of the first eye recording. The investigator was masked to mouse genotype at the time of IOP measurement. The IOP response to latanoprost was measured three times in the FP knockout mice, because small IOP alterations could have been masked by physiological intermouse and intereye differences in IOP. As a larger reduction in IOP has been demonstrated previously in wild-type mice,4 the response to latanoprost in these mice was measured only once. A 1-week washout period was used between measurements.

Statistical Analysis
Paired Student’s t-tests were used to compare the IOP in treated and untreated fellow eyes of mice of the same genotype. The average reduction in IOP (mean IOP in treated eyes minus mean IOP in fellow eyes) was expressed as the mean difference and 95% confidence interval (CI) for the difference between means. A significant reduction in IOP was defined by a 95% CI range that was less than zero. The Student t-test and analysis of variance (ANOVA) were used to compare the mean difference in IOP between genotypes. For comparison of two means, P < 0.05 was considered to be statistically significant. The Tukey-Kramer post hoc modification of ANOVA was performed to adjust for comparison between multiple groups.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Baseline Characteristics in FP Knockout IOP
The F1 generation of heterozygous female and homozygous male breeding pairs consisted of 15 heterozygous and 9 homozygous FP knockout mice. Two distinct bands were identified after electrophoresis of the PCR products: a 700-bp band corresponding to the FP gene and a 450-bp band corresponding to the lacZ/neo(r) cassette (Fig. 1) .

Slit lamp biomicroscopy, gonioscopy, and fundoscopy revealed no anatomic difference between FP knockout and C57BL/6 mice. In addition, examination of toluidine-blue–stained plastic sections of eyes from adult FP homozygous knockout and C57BL/6 wild-type mice did not reveal any anatomic differences (Fig. 2) . IOP in untreated eyes of the heterozygous FP knockout mice tended to be lower than in the homozygous FP knockout mice (Table 1) . The mean difference and 95% CI for the difference in means was –1.9 mm Hg (–3.5 to +0.41) for comparisons of right eyes and –1.4 mm Hg (–3.6 to +0.02) for left eye comparison. These differences were not statistically significant (P = 0.05 OD, P = 0.11 OS, nonpaired t-test assuming unequal variance). In addition, there was no significant difference in IOP between left and right eyes within either genotype. The baseline IOP in C57BL/6 mice was significantly lower in both eyes, compared with that in the FP homozygous mouse (P = 0.0013 OD, P = 0.0013 OS). There was a trend toward lower IOP in the C57BL/6 mice compared with heterozygous FP knockout mice (P = 0.066 OD, P = 0.046).



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 2. Anterior segment histology showing the angle structures in C57BL/6 (left) and homozygous FP knockout (right) mice. No significant anatomic differences were detected between the two genotypes.

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Baseline IOP for FP Knockout Mice

 
Effect of Latanoprost on IOP
Average IOP difference between the latanoprost-treated and untreated fellow eye in the homozygous FP knockout mice was +0.25 mm Hg with a 95% CI of the mean IOP difference crossing zero (–0.19 to +0.69). This indicates that latanoprost did not lower IOP in the homozygous FP knockout. In contrast, IOP was reduced in the treated eye of the heterozygous FP knockout, C57BL/6, and Swiss white mice, as the 95% CI for the mean difference in IOP between treated and fellow eyes did not cross zero (Table 2 , Fig. 3 ). ANOVA showed that the mean difference in IOP between treated and untreated fellow eyes of the homozygous FP knockout mice was significantly smaller than the mean difference in IOP for the FP heterozygous (P = 0.03) C57BL/6 (P < 0.0001) and Swiss white mice (P = 0.006).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Mean Difference in IOP between Latanoprost-Treated and Fellow Untreated Eyes

 


View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 3. Difference in IOP between treated and untreated eyes, 2 hours after a single dose (4 µL) of latanoprost (0.005%). Horizontal bar: group means; dashed lines: 95% CI. Heterozygous mice (n = 15), homozygous FP knockout mice (n = 9), C57BL/6 mice (n = 9), and Swiss white mice (n = 17).

 

    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
These data demonstrate that latanoprost does not reduce IOP in knockout mice that lack the FP receptor. This finding is consistent with the view that latanoprost-mediated lowering of IOP is a direct result of FP receptor signaling. Furthermore, the small reduction in IOP in the heterozygous mice that transcribe reduced quantities of FP mRNA17 and the larger reduction in IOP observed in the wild-type mice points to a possible dose relationship between drug response and FP receptor expression.

We examined the effect of latanoprost in the FP knockout mouse, as this is a selective agonist of the FP receptor. These data can provide a template for comparison with other PGs to determine whether their mechanism of action is independent of FP receptor signaling. Several potential limitations, however, should be considered. First, the IOP response was measured at a single time point in response to a single dose of latanoprost. The measurement time and dosage strategy chosen in this study were based on previous work that showed that latanoprost induces maximum lowering of IOP in the mouse eye 2 hours after application of a 200-ng dose.4 Although it is possible that maximum lowering of IOP may be altered by the genetic background or by gene elimination, it is unlikely that such a shift would completely account for the elimination of IOP reduction. This is supported by the significant reduction in IOP in the treated eyes of heterozygous FP knockout mice at 2 hours. Second, IOP lowering was presented in terms of mean IOP reduction in the treated eye compared with the untreated fellow eye. It is possible that a contralateral response in the untreated eye would minimize the difference observed between the two eyes. This approach was used to minimize the variability in IOP among mice of the same species that could mask small changes in IOP induced by latanoprost. Despite these potential limitations, these results provide strong evidence that the mechanism of early reduction of IOP by latanoprost in the mouse is critically dependent on FP receptor expression.

Activation of the FP receptor initiates several downstream events, including an increase in inositol phosphate, protein kinase C activation, calcium release, and myosin light chain phosphorylation.10 19 20 21 How these events in turn lead to the lowering of IOP is not completely understood, but several different mechanisms may play a role. There is evidence that an increase in uveoscleral outflow after multiple applications is a consequence of extracellular matrix remodeling.22 These changes may result from drug-induced upregulation of matrix metalloproteinases, a family of neutral proteinases, which specifically degrade extracellular matrix.23 Latanoprost acid, the active metabolite of latanoprost, increases the expression of matrix metalloproteinases at the protein24 and RNA levels25 in cultured human ciliary smooth muscle cells and in sclera.22 In addition, repeat treatment with latanoprost leads to a reduction in collagens I, III, and IV; fibronectin; laminin; and hyaluronan in the ciliary muscles of monkeys, which was associated with increased expression of MMP-2 and -3.26 However, it is unlikely that extracellular matrix remodeling occurs within the 2-hour time-point examined here, as experimental studies indicate this time is insufficient for the induction of MMP gene transcription.25 Whether the FP receptor is critical for the IOP reduction after repeat applications of latanoprost remains to be investigated. Further studies to determine the effect of treatment on MMP expression and extracellular matrix remodeling in the FP knockout and wild-type mice would further clarify the role of the FP receptor in prostaglandin-mediated alterations of the aqueous outflow pathways.

This study is the first to report the use of genetically modified mice to investigate the mechanism of action of an ocular hypotensive agent. The observation that mice that lack the FP receptor do not respond to latanoprost provides definitive evidence that the FP receptor is critical for the early IOP response in the mouse. Further studies with genetically modified mice should help clarify the molecular mechanism of PG-mediated IOP lowering.


    Footnotes
 
Supported in part by the National Eye Institute EY05990 (RNW), and the Margaret and Robert Boemer Research Fund of the Foundation for Eye Research (JGC).

Submitted for publication March 25, 2004; revised June 7, 2004; accepted June 8, 2004.

Disclosure: J.G. Crowston, None; J.D. Lindsey, None; M. Aihara, None; R.N. Weinreb, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Robert N. Weinreb, Hamilton Glaucoma Center, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0946; weinreb{at}eyecenter.ucsd.edu.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. Giuffre G. The effects of prostaglandin F2{alpha} in the human eye. Graefes Arch Clin Exp Ophthalmol. 1985;222:139–141.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  2. Gabelt BT, Kaufman PL. The effect of prostaglandin F2{alpha} on trabecular outflow facility in cynomolgus monkeys. Exp Eye Res. 1990;51:87–91.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  3. Camras CB, Bito LZ. Reduction of intraocular pressure in normal and glaucomatous primate (Aotus trivirgatus) eyes by topically applied prostaglandin F2{alpha}. Curr Eye Res. 1981;1:205–209.[Web of Science][Medline][Order article via Infotrieve]
  4. Aihara M, Lindsey JD, Weinreb RN. Reduction of intraocular pressure in mouse eyes treated with latanoprost. Invest Ophthalmol Vis Sci. 2002;43:146–150.[Abstract/Free Full Text]
  5. Benozzi J, Nahum LP, Campanelli JL, Rosenstein RE. Effect of hyaluronic acid on intraocular pressure in rats. Invest Ophthalmol Vis Sci. 2002;43:2196–2200.[Abstract/Free Full Text]
  6. Weinreb RN, Toris CB, Gabelt BT, Lindsey JD, Kaufman PL. Effects of prostaglandins on the aqueous humor outflow pathways. Surv Ophthalmol. 2002;47(suppl 1)S53–S64.
  7. Alm A. Prostaglandin derivates as ocular hypotensive agents. Prog Retin Eye Res. 1998;17:291–312.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  8. Ocklind A, Lake S, Wentzel P, Nister M, Stjernschantz J. Localization of the prostaglandin F2{alpha} receptor messenger RNA and protein in the cynomolgus monkey eye. Invest Ophthalmol Vis Sci. 1996;37:716–726.[Abstract/Free Full Text]
  9. Anthony TL, Lindsey JD, Aihara M, Weinreb RN. Detection of prostaglandin EP(1), EP(2), and FP receptor subtypes in human sclera. Invest Ophthalmol Vis Sci. 2001;42:3182–3186.[Abstract/Free Full Text]
  10. Anthony TL, Pierce KL, Stamer WD, Regan JW. Prostaglandin F2{alpha} receptors in the human trabecular meshwork. Invest Ophthalmol Vis Sci. 1998;39:315–321.[Abstract/Free Full Text]
  11. Resul B, Stjernschantz J, Selen G, Bito L. Structure-activity relationships and receptor profiles of some ocular hypotensive prostanoids. Surv Ophthalmol. 1997;41(suppl 2)S47–S52.
  12. Nakajima T, Matsugi T, Goto W, et al. New fluoroprostaglandin F2{alpha} derivatives with prostanoid FP-receptor agonistic activity as potent ocular-hypotensive agents. Biol Pharm Bull. 2003;26:1691–1695.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  13. Stjernschantz J, Selen G, Sjoquist B, Resul B. Preclinical pharmacology of latanoprost, a phenyl-substituted PGF2 alpha analogue. Adv Prostaglandin Thromboxane Leukot Res. 1995;23:513–518.[Web of Science][Medline][Order article via Infotrieve]
  14. Chen J, Woodward DF. Prostanoid-induced relaxation of precontracted cat ciliary muscle is mediated by EP2 and DP receptors. Invest Ophthalmol Vis Sci. 1992;33:3195–3201.[Abstract/Free Full Text]
  15. Woodward DF, Burke JA, Williams LS, et al. Prostaglandin F2{alpha} effects on intraocular pressure negatively correlate with FP-receptor stimulation. Invest Ophthalmol Vis Sci. 1989;30:1838–1842.[Abstract/Free Full Text]
  16. Aihara M, Lindsey JD, Weinreb RN. Aqueous humor dynamics in mice. Invest Ophthalmol Vis Sci. 2003;44:5168–5173.[Abstract/Free Full Text]
  17. Sugimoto Y, Yamasaki A, Segi E, et al. Failure of parturition in mice lacking the prostaglandin F receptor. Science. 1997;277:681–683.[Abstract/Free Full Text]
  18. Aihara M, Lindsey JD, Weinreb RN. Twenty-four-hour pattern of mouse intraocular pressure. Exp Eye Res. 2003;77:681–686.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  19. Ansari HR, Davis AM, Kaddour-Djebbar I, Abdel-Latif AA. Effects of prostaglandin F2{alpha} and latanoprost on phosphoinositide turnover, myosin light chain phosphorylation and contraction in cat iris sphincter. J Ocul Pharmacol Ther. 2003;19:217–231.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  20. Ansari HR, Kaddour-Djebbar I, Abdel-Latif AA. Effects of prostaglandin F2{alpha}, latanoprost and carbachol on phosphoinositide turnover, MAP kinases, myosin light chain phosphorylation and contraction and functional existence and expression of FP receptors in bovine iris sphincter. Exp Eye Res. 2004;78:285–296.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  21. Husain S, Abdel-Latif AA. Effects of prostaglandin F2{alpha} and carbachol on MAP kinases, cytosolic phospholipase A2 and arachidonic acid release in cat iris sphincter smooth muscle cells. Exp Eye Res. 2001;72:581–590.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  22. Sagara T, Gaton DD, Lindsey JD, Gabelt BT, Kaufman PL, Weinreb RN. Topical prostaglandin F2{alpha} treatment reduces collagen types I, III, and IV in the monkey uveoscleral outflow pathway. Arch Ophthalmol. 1999;117:794–801.[Abstract/Free Full Text]
  23. Lindsey JD, Kashiwagi K, Boyle D, Kashiwagi F, Firestein GS, Weinreb RN. Prostaglandins increase proMMP-1 and proMMP-3 secretion by human ciliary smooth muscle cells. Curr Eye Res. 1996;15:869–875.[Web of Science][Medline][Order article via Infotrieve]
  24. Weinreb RN, Kashiwagi K, Kashiwagi F, Tsukahara S, Lindsey JD. Prostaglandins increase matrix metalloproteinase release from human ciliary smooth muscle cells. Invest Ophthalmol Vis Sci. 1997;38:2772–2780.[Abstract/Free Full Text]
  25. Weinreb RN, Lindsey JD. Metalloproteinase gene transcription in human ciliary muscle cells with latanoprost. Invest Ophthalmol Vis Sci. 2002;43:716–722.[Abstract/Free Full Text]
  26. Ocklind A. Effect of latanoprost on the extracellular matrix of the ciliary muscle: a study on cultured cells and tissue sections. Exp Eye Res. 1998;67:179–191.[CrossRef][Web of Science][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
IOVSHome page
T. Saeki, T. Ota, M. Aihara, and M. Araie
Effects of Prostanoid EP Agonists on Mouse Intraocular Pressure
Invest. Ophthalmol. Vis. Sci., May 1, 2009; 50(5): 2201 - 2208.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Y. Zhang, B. R. Davidson, W. D. Stamer, J. K. Barton, L. Y. Marmorstein, and A. D. Marmorstein
Enhanced Inflow and Outflow Rates Despite Lower IOP in Bestrophin-2-Deficient Mice
Invest. Ophthalmol. Vis. Sci., February 1, 2009; 50(2): 765 - 770.
[Abstract] [Full Text] [PDF]


Home page
Br J OphthalmolHome page
C B Camras, N A Sharif, M B Wax, and J Stjernschantz
Bimatoprost, the prodrug of a prostaglandin analogue
Br J Ophthalmol, June 1, 2008; 92(6): 862 - 863.
[Full Text] [PDF]


Home page
IOVSHome page
J. G. Crowston, C. A. Morris, J. D. Lindsey, and R. N. Weinreb
Prostaglandin FP Receptors Do Not Contribute to 24-hour Intraocular Pressure Variation in Mice
Invest. Ophthalmol. Vis. Sci., May 1, 2007; 48(5): 2095 - 2098.
[Abstract] [Full Text] [PDF]


Home page
Br J OphthalmolHome page
T. Ota, M. Aihara, T. Saeki, S. Narumiya, and M. Araie
The IOP-lowering effects and mechanism of action of tafluprost in prostanoid receptor-deficient mice
Br J Ophthalmol, May 1, 2007; 91(5): 673 - 676.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
T. Ota, M. Aihara, T. Saeki, S. Narumiya, and M. Araie
The Effects of Prostaglandin Analogues on Prostanoid EP1, EP2, and EP3 Receptor-Deficient Mice.
Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3395 - 3399.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
J. G. Crowston, J. D. Lindsey, C. A. Morris, L. Wheeler, F. A. Medeiros, and R. N. Weinreb
Effect of Bimatoprost on Intraocular Pressure in Prostaglandin FP Receptor Knockout Mice
Invest. Ophthalmol. Vis. Sci., December 1, 2005; 46(12): 4571 - 4577.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
T. Ota, M. Aihara, S. Narumiya, and M. Araie
The Effects of Prostaglandin Analogues on IOP in Prostanoid FP-Receptor-Deficient Mice
Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4159 - 4163.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
T. Ota, H. Murata, E.-i. Sugimoto, M. Aihara, and M. Araie
Prostaglandin Analogues and Mouse Intraocular Pressure: Effects of Tafluprost, Latanoprost, Travoprost, and Unoprostone, Considering 24-Hour Variation
Invest. Ophthalmol. Vis. Sci., June 1, 2005; 46(6): 2006 - 2011.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crowston, J. G.
Right arrow Articles by Weinreb, R. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crowston, J. G.
Right arrow Articles by Weinreb, R. N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS