IOVS Journal of Nutrition
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2004;45:828-833.)
© 2004 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.03-0309

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lines, M. A.
Right arrow Articles by Walter, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lines, M. A.
Right arrow Articles by Walter, M. A.

Characterization and Prevalence of PITX2 Microdeletions and Mutations in Axenfeld-Rieger Malformations

Matthew A. Lines,1 Kathy Kozlowski,1 Stephen C. Kulak,1 R. Rand Allingham,2 Elise Héon,3 Robert Ritch,4 Alex V. Levin,3 M. Bruce Shields,5 Karim F. Damji,6 Anna Newlin,7 and Michael A. Walter1

1From the Department of Ophthalmology, University of Alberta, Edmonton, Alberta, Canada; 2Duke University Eye Center, Durham, North Carolina; the 3Department of Ophthalmology, The Hospital for Sick Children, Toronto, Ontario, Canada; 4The New York Ear and Eye Infirmary, New York, New York; the 5Department of Ophthalmology and Visual Science, Yale University School of Medicine, New Haven, Connecticut; the 6University of Ottawa Eye Institute and Ottawa Health Research Institute, Ottawa, Ontario, Canada; and the 7University of Illinois at Chicago Eye Center, Chicago, Illinois.


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
PURPOSE. Mutations of the homeodomain protein PITX2 produce Axenfeld-Rieger (AR) malformations of the anterior chamber, an autosomal dominant disorder accompanied by a 50% risk of glaucoma. Twenty-nine mutations of PITX2 have been described, with a mutational prevalence estimated between 10% and 60% in AR. In the current study, the possible role of altered PITX2 gene dosage in the etiology of AR was investigated. Gross gene deletions and duplications should alter PITX2 activity analogously to hypomorphic and hypermorphic mutations, respectively.

METHODS. Sixty-four patients with AR, iridogoniodysgenesis (IGD), iris hypoplasia (IH), or anterior segment dysgenesis (ASD) were screened for PITX2 mutations by sequencing. PITX2 gene dosage was concurrently examined in these patients by real-time quantitative PCR. Microsatellite markers were used to map 4q25 microdeletions at a contig scale, as well as for haplotype analysis in an extended AR kindred. An additional 27 patients with other assorted ocular phenotypes were evaluated by similar methods, amounting to a total of 91 cases analyzed.

RESULTS. Three novel mutations of PITX2 (4.7%) were identified among 64 patients with AR, IGD, IH, or ASD. Deletions of PITX2 were as frequent as mutations in our sample. Chromosome 4q25 microdeletions were physically mapped relative to several microsatellite markers in each patient. Cosegregation of AR and a PITX2 deletion was demonstrated in an extended kindred.

CONCLUSIONS. Point mutations and gross deletions of PITX2 appear to produce an equivalent haploinsufficiency phenotype. Quantitative PCR is an efficient means of detecting causative PITX2 deletions in patients with AR and may increase the detection rate at this locus.


A xenfeld-Rieger (AR) malformation comprises a group of autosomal dominant clinical disorders affecting anterior eye structures derived from constituents of the embryonic neural crest (NC).1 Classic ocular features of AR include iridocorneal synechiae, iris hypoplasia, corectopia, polycoria, and/or prominent Schwalbe’s line.2 3 4 AR is often associated with small, malformed, or missing teeth and/or excessive periumbilical skin.5 6 7 The phenotype occasionally includes cardiac septal defects and/or sensorineural hearing loss.8 9 AR is situated at the severe end of a continuum of anterior segment phenotypes that includes iridogoniodysgenesis (IGD) and iris hypoplasia (IH).10 11 In approximately 50% of patients with AR, secondary high-tension glaucoma develops due to obstruction of the aqueous drainage pathway of the iridocorneal angle.1 Genetic causes of AR include mutations, deletions, or duplications of the forkhead-related transcription factor FOXC1, as well as mutations of the homeodomain (HD) protein PITX2.12 13 14 15 16 17 AR due to deletion of the paired-box transcription factor PAX6 has been reported in a single case.18

Pituitary homeobox 2 (PITX2) is a paired-bicoid HD protein that is expressed during ocular development.12 19 There are four differentially expressed isoforms of PITX2 that vary in their N-termini but share common HD and C-terminal sequences. Of these, PITX2a and/or PITX2b, as well as PITX2c, are expressed in the embryonic periocular mesenchyme in mouse.12 20 21 The periocular mesenchyme is a neural-crest-derived, migratory cell population that contributes widely to development of anterior segment structures including the iris, cornea and trabecular meshwork, any of which are potentially affected in AR.1 22 The variable systemic anomalies in AR are also found in a subset of PITX2-expressing tissues, as additional domains of PITX2 expression exist in the umbilicus, dental epithelium, heart, abdominal organs, and limb buds.12 21 23

Recent work has placed PITX2 in a signaling cascade that appears to modulate cell proliferation, differentiation, and morphogenesis. PITX2 induces cell proliferation in response to ß-catenin signals raised during Wnt signaling in C2C12 cells.24 In contrast, PITX2 expression has antiproliferative effects in HeLa cells, causing arrest at the G0/G1 checkpoint.25 Activation of the small guanosine triphosphatases (GTPases) RhoA and/or Rac appears necessary for PITX2 signaling accompanied by cytoskeletal changes in both cell lines.24 25 Transfection of a dominant negative RhoA mutant into perfused human anterior segment cultures increases aqueous outflow facility, suggesting that this PITX2 pathway may be essential for intraocular pressure homeostasis in the prevention of glaucoma.26

Twenty-nine mutations of PITX2 have been described to date, nearly all of which either encode a truncated product or produce point alterations of the HD10 11 12 27 28 29 30 31 32 33 (Richards JBB, et al. IOVS 2001;42:ARVO Abstract 3041). Mutations of PITX2 have been associated with various anterior segment dysgeneses (AR, IGD, and IH)10 11 12 28 29 30 31 32 (Idrees F, et al. IOVS 2002;43:ARVO E-Abstract 3402) and, rarely, with additional features resembling Peters’ anomaly.27 28 Chromosomal aberrations involving the PITX2 locus have also been described, both in the form of cytologically visible deletions and as a result of translocations involving 4q25.33 34 35 36 37 38 Such cases support haploinsufficiency as a mechanism for PITX2-related ocular maldevelopment. An increased PITX2 copy number may also be pathologic, as duplication of a distal region of 4q2 (including 4q25) has been noted in one patient with hypoplastic left heart.39 A single hypermorphic allele of PITX2 has been identified in AR, suggesting an upper limit for PITX2 activity in normal ocular development.29 To the best of our knowledge, no subcytologic deletions of this locus have yet been described.

We conducted a mutational screen and real-time quantitative PCR (qPCR) analysis of PITX2 in a panel of 64 unrelated clinical cases of AR, IGD, IH, or ASD, as well as a secondary panel of 27 cases of other anterior segment malformations and/or glaucoma. We identified three novel mutations of PITX2, as well as three gross deletions, in patients with AR. In our sample, deletions and mutations of PITX2 were equally prevalent, together comprising only 10% of cases of anterior segment dysgenesis. These findings agree with previous estimates supporting a limited involvement of PITX2 in AR26 and provide a second avenue for diagnostics at this locus.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Human Subjects
Written, informed consent was obtained from all studied subjects before enrollment in the study. The use of human subjects in this study was approved by the University of Alberta Health Research Ethics Board, in accordance with the tenets specified within the Declaration of Helsinki. DNA banking at The Hospital for Sick Children (HSC; cases 4 and 5) was performed in accordance with the HSC Research Ethics Board’s approved consent policies.

Sequence Analysis
Sequencing was performed by PCR followed by a combination of manual 33P-labeled terminator (Amersham Biosciences, Little Chalfont, UK) and labeled primer fluorescent sequencing, (Li-Cor, Lincoln, NE), using previously published amplimers.12

Realtime qPCR
We used a fluorogenic PCR assay (TaqMan; Applied Biosystems [ABI], Foster City, CA) to quantitate the relative abundance of an exon IV target sequence 3' of the PITX2 HD in each sample on our panel. All equipment and reagents indicated were obtained from ABI.

Each reaction contained 10 picomoles of forward and reverse primers (CAGTTCAATGGGCTCATGCA, CGGCCCAGTTGTTGTAGGAA) and 4 pmol of a dual-label PCR (TaqMan; ABI) probe (VIC-CCCTACGACGACATGGTACCCAGGC-TAMRA). A commercial assay (TaqMan; ABI) for quantitation of the human connexin (Cx)40 locus was also included for normalization. Each sample was amplified in triplicate, 15-µL reactions containing 25 ng of lymphocyte DNA. Reactions were cycled in a thermocycler (model 9700; ABI) with the 2x assay kit as per the manufacturer’s instructions (TaqMan; ABI). Each 384-well plate contained triplicate reactions of two unrelated normal samples and a DNA-free control. Output data were analyzed by a relative quantification method. Briefly, rate of change in fluorescence ({Delta}F) in each well, during each cycle, at each reporter wavelength was charted. Threshold values (T) of {Delta}F were selected for the PITX2 and Cx40 probes, so that a graph of {Delta}F was linear in all wells as {Delta}F approached T. The threshold cycle (Ct) at which {Delta}F reached T was determined for each reporter in each well. A Ct ratio (Ct[PITX2]/Ct[Cx40]) was generated for each reaction. A graph of Ct[PITX2] versus Ct[Cx40] yielded the expected linear correlation on a panel of 50 unrelated normal control samples. Deletions formed a distinct line in which the normalized Ct[PITX2] was one cycle greater than that of normal control samples. We compared the Ct ratios obtained from each sample with both PITX2-deleted and normal control samples by using a t-test statistic. A ratio of these values represents the relative likelihood that a patient’s sample has one rather than two copies of PITX2. The PITX2 target amplicon is contained within exon IV, hence sequence analysis ruled out the potential confound of an underlying probe or primer site mutation. The qPCR dataset and normal control data are provided online at http://www.iovs.org/cgi/content/full/45/3/828/DC1.

Microsatellite Markers
We examined eight microsatellite markers in the immediate genomic vicinity of PITX2 with the following amplimers: 320d3-1 (CAGAGGTAGGGTCCAGGTTG/TGCAGAGCAATTCCTGTACCT, TA = 60°C), 320d3-2 (TCAGTTGCATGAATGGAGGA/ACCCTGGGACTTTGATGGAT, TA = 60°C), 320d3-6 (TGTTTGGGTTCCCCAAGTAT/CGAGATTGCCCCACTAAACC, TA = 60°C), 320d3-7 (TGGGTGACAGAGCAAGACAA/GGCTTATCAGGAGGGTCCA, TA = 60°C), 320d3-14 (AAACACAAAGCCTCAACAGGA/AAACACAAAGCCTCAACAGGA, TA = 53°C), 320d3-15 (TGAATGGATAGCCTTCTCAG/AAAGCACCAAGGACAACCAG, TA = 52°C), 320d3-16 (GAAATGAATGGGTTCAGTGGA/TCTGCAACATAAGTGGAGTCTCA, TA = 50°C), and 320d3-17 (TCCAGAGAGTGGGTTTCTGA/GCCTGGGTGACAAGAACAAG, TA = 52°C). Each of the above reactions were performed in 2 mM MgCl2 with 35 cycles of 30 seconds 95°C, 30 seconds TA, and 30 seconds 72°C. Heterozygosity of each marker was estimated by genotyping six unrelated normal samples. We also genotyped affected individuals with the established markers GATA10G07, D4S2361, D4S1647, D4S2623, D4S2301, D4S2945, D4S193, D4S406, D4S1651, D4S2394, D4S1644, and D4S1625. Products were size separated on 6% denaturing polyacrylamide gel after PCR incorporation of {alpha}35S-dATP (Amersham Biosciences). Microsatellite gels were optically scanned, and the autoradiographs are available online at http://www.iovs.org/cgi/content/full/45/3/828/DC1.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
To estimate the contribution of PITX2 mutations and deletions in AR, we screened PITX2a coding regions and dosage in a cohort of 91 cases with mixed clinical phenotypes involving dysgenesis of the anterior segment and/or glaucoma. Our primary (anterior segment mesenchymal dysgenesis) panel contained 64 cases with various PITX2-associated anterior ocular phenotypes: AR (39 cases), IGD (19 cases), IH (2 cases), or an unspecified anterior segment dysgenesis (ASD; 4 cases). The remainder of our patient cohort contained cases of either ectodermal anterior eye malformations, or simple glaucoma, as follows: Peters’ anomaly (seven cases), juvenile open-angle glaucoma (two cases), congenital glaucoma (two cases), and primary open angle glaucoma (one case). We screened a further five patients who had a variety of other ocular findings: sclerocornea (one case), congenital cataract with glaucoma (one case), corneal endothelial dystrophy (one case), short stature, joint hyperextensibility, ocular depression, Rieger anomaly, and teething delay (SHORT syndrome, Mendelian Inheritance in Man [MIM] 269880, one case), or aniridia plus microdontia (one case).

We examined coding regions and splice junctions present in the PITX2a transcript. Comprehensive screening of the 91 individuals in our panel identified three novel mutations (Fig. 1) that are predicted to disrupt severely the primary structure of all four PITX2 isoforms. For clarity, nucleotide and codon positions given in this manuscript are relative to the initiation codon of PITX2a (GenBank: NM153427; http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD). The four exons screened are similarly numbered according to the PITX2a transcript.



View larger version (74K):
[in this window]
[in a new window]
 
FIGURE 1. Sequencing autoradiograph displaying novel AR-associated mutations in PITX2 exons III and IV. All nucleotide and exon positions refer to the PITX2a isoform.

 
Patient 1 displayed full ocular manifestations of AR (IH, prominent Schwalbe’s line, corectopia, and glaucoma). No systemic findings were evident in this individual, who was found to harbor a heterozygous deletion of nucleotide G114 in PITX2 exon III. This frameshift mutation is predicted to ablate most of PITX2 beginning at Q39, the first residue of the HD. A large nonsense peptide of 114 further amino acids is encoded. Complete loss of the HD, coupled with the likelihood of protein or transcript instability, together suggest that this allele may be a functional null.

Patient 2 had severe AR malformations (bilateral polycoria; displaced, pinpoint left pupil; and irregular left iris contour) in conjunction with underdeveloped maxilla and redundant umbilical skin. A G]->T transversion at the invariant -1 position of the PITX2 exon III splice acceptor site was identified in this patient, abolishing helices I and II of the HD, which are encoded by exon III. This mutation is also therefore likely to constitute a null allele. An adjacent splice-site mutation with a similar phenotype has been reported.28

Patient 3 was a member of a four-generation kindred whose ocular findings have been described (1, family of case 14). Findings in both patient 3 and an affected grandson included iridocorneal adhesions, corectopia, polycoria, IH, iris atrophy, prominent Schwalbe’s line, and glaucoma. Patient 3 also had endothelial lesions of the cornea (guttata). Gonioscopy demonstrated an abnormal angle (see clinical photos online at http://www.iovs.org/cgi/content/full/45/3/828/DC1). Sequencing identified a single-base deletion of nucleotide C416 within exon IV of PITX2. This mutation causes a frameshift from T139 onward, encoding 15 mutant residues followed by a premature stop codon.

Realtime qPCR and Microsatellite Studies of PITX2 Dosage
Realtime qPCR analysis of the same panel of 91 individuals identified three samples that met the statistical criteria consistent with hemizygosity of the PITX2 target amplicon (see the Methods section and supplementary data available online at http://www.iovs.org/cgi/content/full/45/3/828/DC1 for details of the analysis). To confirm and determine the approximate extent of each deletion, we developed eight microsatellite markers flanking the PITX2 locus. Genotyping of these markers, and of 12 established markers on the long arm of chromosome 4 markers (see the Methods section) produced a contig-level map of each deletion (Fig. 2 and supplementary data).



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 2. Microsatellite hemizygosity mapping of PITX2-containing deletions. A maximal deletion interval (boxed region) was defined between the most proximal centromeric and telomeric markers shown to be heterozygous in each affected individual. Haplotyping of the extended family of patient 6 (Fig. 3) was used to define further the deleted interval in this family. Nucleotide positions given are derived from the Ensembl chromosome 4 supercontig (http://www.ensembl.org). Estimated heterozygosity is provided for markers generated for this study. Diamonds: microsatellite markers; stars: position of the PITX2 qPCR probe. Individual marker genotypes are coded as follows. Open symbols: heterozygous; gray symbols: homo- or hemizygous; black symbols: null allele evident by qPCR or by haplotype analysis; N, haplotype analysis rules out deletion of this position.

 
Patient 4 had a variant AR phenotype in which corectopia, prominent line of Schwalbe, and iridocorneal adhesions are accompanied by the additional feature of bilateral anterior polar cataracts. An unaffected brother had normal PITX2 gene dosage, as measured by qPCR. The maximum deleted interval in patient 4 is bounded by the heterozygous markers 320d3-2 and D4S2394, which flank a region extending 19.3 Mb telomeric of PITX2. Because 320d3-2 is only 4.1 kb centromeric of PITX2, this individual may carry a partial deletion potentially sparing the extreme 3' end of the gene.

Patient 5 had a pronounced AR phenotype with ocular findings including bilateral iris atrophy, posterior embryotoxon, iridocorneal adhesions, miosis, corectopia, and left polycoria. Other features included pointed and maloccluded teeth and redundant periumbilical skin. This patient had markedly short stature, being, at age 6, only 3 inches taller than a 2-year-old sibling. Patient 5 had deep-set eyes and a prominent mandible, which are also feature of SHORT syndrome. His hearing and speech are normal. This patient’s deletion spans a region containing PITX2, with both breakpoints located in the 1.24-Mb interval between D4S2623 and D4S1651. This interval contains PITX2, human epidermal growth factor (EGF), long-chain fatty-acyl elongase (LCE), glutamyl aminopeptidase (ENPEP), and two predicted expressed sequence tag (EST) transcripts, denoted ENSG00000164092 and ENSG00000168999 in the Ensembl database (http://www.ensembl.org).40 An unrelated SHORT patient sample displayed normal PITX2 dosage. It is at present unclear whether patient 5’s phenotype constitutes a bona fide case of SHORT syndrome. Both pituitary anomalies and short stature due to pituitary growth hormone insufficiency have been described in patients with ocular and dental findings of AR, implying that short stature may be a rare feature of the AR phenotype that occurs at reduced penetrance in some pedigrees.1 5 41

Patient 6 was an affected member of a large pedigree in which AR cosegregates with a hemizygous deletion of PITX2. Familial haplotyping (Fig. 3 and supplementary data) delineated a maximal deleted region of 417 kb, bounded telomerically by 320d3-6 and centromerically by D4S2945. This interval includes PITX2, ENPEP, and ENSG00000164092 and does not include EGF or LCE.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 3. Haplotype analysis illustrating cosegregation of del(PITX2) and AR in the kindred of patient 6. Haplotype phases were inferred from microsatellite genotypes where possible. Individuals III-9 and III-13 have ambiguous haplotypes due to unavailable parental samples. Null alleles ({blacktriangleup}) were identified on the {Delta}PITX2 haplotype due to aberrant segregation of the indicated markers. () patient 6; N, ophthalmically examined normal individuals; ?, at-risk individuals not clinically ascertained.

 

    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
PITX2 Mutations
Our sequence analysis of 91 patients with anterior segment dysgeneses and/or glaucoma identified three novel, truncating PITX2 alleles that are likely to disrupt severely the DNA binding and/or regulation of the mutant protein. Each mutation and deletion presented herein is likely to affect all four known PITX2 transcripts, as exons III and IV are common to each. With the exception of patient 3, each patient mutation described is predicted to abolish DNA-binding functions of all isoforms of the affected allele. Although the mutant PITX2 allele of patient 3 encodes a normal HD, truncation of the C-terminus may lead to reduced stability of the product peptide. Alternatively, this allele could produce a stable protein with altered autoregulatory and/or protein-interaction functions. The C-terminal tail of PITX2 contains a conserved 14-amino-acid OAR (Otx, aristaless, rax) domain that is common to multiple HD proteins in several species.12 This region has been proposed to mediate synergistic protein-protein interactions with PIT-1, as well as self-inhibitory interactions with the PITX2 N-terminus.42 The C-terminus is essential for PITX2’s wild-type function and/or stability, as a small number of mutations sparing the HD but ablating the C-terminus have been described12 28 (Richards JBB, et al. IOVS 2001;42:ARVO Abstract 3041).

The pathologic mechanism of PITX2 haploinsufficiency in AR is currently unknown, as it remains to be determined which ocular genes are subject to regulation by PITX2. PITX2 target genes plausibly involved in human dental development include distal-less homeobox 2 (DLX2) and procollagen lysyl hydroxylase 1 (PLOD1) genes.43 44 45 46 As DLX genes are key regulators of jaw ontogeny in mice, this pathway may be relevant to the maxillary hypoplasia of patient 2.47 Delineation of the ocular pathogenesis of AR requires identification of relevant PITX2 target genes in the ocular anterior segment.

Estimates of Prevalence
Among the AR, IGD, IH, and ASD cases which composed our primary panel, 6 (9.4%) of 64 individuals carried an identifiable PITX2 deletion or mutation. The incidence of microdeletions of PITX2 was equal to that of point mutations in our sample. The prevalence of PITX2 mutations in anterior segment dysgenesis has been placed at about 10%, although estimates in smaller cohorts have ranged to as much as 60%.12 28 Our findings support a limited prevalence of PITX2 mutations in AR. Moreover, these data point to the existence of a subset of PITX2-associated cases of AR not detectable through sequence analysis alone.

Altered balance of transcription factor activities appears to be a theme in the etiology of AR. Our findings suggest that PITX2 hemizygosity produces a phenotype similar to that of PITX2 mutations, providing further support for haploinsufficiency as a general pathologic mechanism in AR. Increased PITX2 dosage can also be pathologic, as both hyper- and hypomorphic alleles of PITX2 lead to AR malformations.29 Similarly, both deletions and duplications of the FOXC1 locus produce a similar AR phenotype.15 16 Studies of AR-causing alleles of FOXC1 also indicate that normal ocular development requires a strictly enforced threshold level of transactivity.48 Such findings imply that development of the anterior chamber involves finely tuned regulatory networks that are sensitive to even modest changes in activity.


    Acknowledgements
 
The authors thank patients and family members, without whose participation this work could not be attempted, and the University of Alberta Genetics Clinic for substantial help with pedigree construction and sample collection.


    Footnotes
 
Supported by Canadian Institutes of Health Research (CIHR) Grant MT12916. MAW is an Alberta Heritage Foundation for Medical Research (AHFMR) senior scholar and a CIHR investigator. MAL is supported by an AHFMR graduate studentship.

Submitted for publication March 25, 2003; revised September 17, 2003; accepted October 22, 2003.

Disclosure: M.A. Lines, None; K. Kozlowski, None; S.C. Kulak, None; R.R. Allingham, None; E. Héon, None; R. Ritch, None; A.V. Levin, None; M.B. Shields, None; K.F. Damji, None; A. Newlin, None; M.A. Walter, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Michael A. Walter, Ocular Genetics Laboratory, 8-32 MSB, University of Alberta, Edmonton, AB, Canada T6G 2H7; mwalter{at}ualberta.ca.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. Shields MB. Axenfeld-Rieger syndrome: a theory of mechanism and distinctions from the iridocorneal endothelial syndrome. Trans Am Ophthalmol Soc. 1983;81:736–784.[Medline][Order article via Infotrieve]
  2. Rieger H. Beitrage zur kenntnis seltener missbildungen der iris. II. Uber hypoplasie der irisvorderblattes mit verlagerung und entrundung der pupille. Graefes Arch Klin Exp Ophthalmol. 1935;133:602–635.
  3. Rieger H. Dysgenesis mesodermalis coreneal et iridis. Z Augenheilkd. 1935;86:333.
  4. Axenfeld TH. Embryotoxon cornea posterius. Klin Monastbl Augenheilkd. 1920;65:381–382.
  5. Feingold M, Shiere F, Fogels HR, Donaldson D. Rieger’s syndrome. Pediatrics. 1969;44:564–569.[Abstract/Free Full Text]
  6. Chisholm IA, Chudley AE. Autosomal dominant iridogoniodysgenesis with associated somatic anomalies: four-generation family with Rieger’s syndrome. Br J Ophthalmol. 1983;67:529–534.[Abstract/Free Full Text]
  7. Alward WL. Axenfeld-Rieger syndrome in the age of molecular genetics. Am J Ophthalmol. 2000;130:107–115.[CrossRef][ISI][Medline][Order article via Infotrieve]
  8. Cunningham ET, Jr, Eliott D, Miller NR, Maumenee IH, Green WR. Familial Axenfeld-Rieger anomaly, atrial septal defect, and sensorineural hearing loss: a possible new genetic syndrome. Arch Ophthalmol. 1998;116:78–82.[Abstract/Free Full Text]
  9. Mammi I, De Giorgio P, Clementi M, Tenconi R. Cardiovascular anomaly in Rieger Syndrome: heterogeneity or contiguity?. Acta Ophthalmol Scand. 1998;76:509–512.[CrossRef][ISI][Medline][Order article via Infotrieve]
  10. Alward WL, Semina EV, Kalenak JW, et al. Autosomal dominant iris hypoplasia is caused by a mutation in the Rieger syndrome (RIEG/PITX2) gene. Am J Ophthalmol. 1998;125:98–100.[CrossRef][ISI][Medline][Order article via Infotrieve]
  11. Kulak SC, Kozlowski K, Semina EV, Pearce WG, Walter MA. Mutation in the RIEG1 gene in patients with iridogoniodysgenesis syndrome. Hum Mol Genet. 1998;7:1113–1117.[Abstract/Free Full Text]
  12. Semina EV, Reiter R, Leysens NJ, et al. Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nat Genet. 1996;14:392–399.[CrossRef][ISI][Medline][Order article via Infotrieve]
  13. Nishimura DY, Swiderski RE, Alward WL, et al. The forkhead transcription factor gene FKHL7 is responsible for glaucoma phenotypes which map to 6p25. Nat Genet. 1998;19:140–147.[CrossRef][ISI][Medline][Order article via Infotrieve]
  14. Mears AJ, Jordan T, Mirzayans F, et al. Mutations of the forkhead/winged-helix gene, FKHL7, in patients with Axenfeld-Rieger anomaly. Am J Hum Genet. 1998;63:1316–1328.[CrossRef][ISI][Medline][Order article via Infotrieve]
  15. Nishimura DY, Searby CC, Alward WL, et al. A spectrum of FOXC1 mutations suggests gene dosage as a mechanism for developmental defects of the anterior chamber of the eye. Am J Hum Genet. 2001;68:364–372.[CrossRef][ISI][Medline][Order article via Infotrieve]
  16. Lehmann OJ, Ebenezer ND, Jordan T, et al. Chromosomal duplication involving the forkhead transcription factor gene FOXC1 causes iris hypoplasia and glaucoma. Am J Hum Genet. 2000;67:1129–1135.[ISI][Medline][Order article via Infotrieve]
  17. Lehmann OJ, Ebenezer ND, Ekong R, et al. Ocular developmental abnormalities and glaucoma associated with interstitial 6p25 duplications and deletions. Invest Ophthalmol Vis Sci. 2002;43:1843–1849.[Abstract/Free Full Text]
  18. Riise R, Storhaug K, Brondum-Nielsen K. Rieger syndrome is associated with PAX6 deletion. Acta Ophthalmol Scand. 2001;79:201–203.[CrossRef][ISI][Medline][Order article via Infotrieve]
  19. Gage PJ, Camper SA. Pituitary homeobox 2, a novel member of the bicoid-related family of homeobox genes, is a potential regulator of anterior structure formation. Hum Mol Genet. 1997;6:457–464.[Abstract/Free Full Text]
  20. Liu C, Liu W, Lu MF, Brown NA, Martin JF. Regulation of left-right asymmetry by thresholds of Pitx2c activity. Development. 2001;128:2039–2048.[Abstract/Free Full Text]
  21. Hjalt TA, Semina EV, Amendt BA, Murray JC. The Pitx2 protein in mouse development. Dev Dyn. 2000;218:195–200.[CrossRef][ISI][Medline][Order article via Infotrieve]
  22. Kaiser-Kupfer MI. Neural crest origin of trabecular meshwork cells and other structures of the anterior chamber. Am J Ophthalmol. 1989;107:671–672.[ISI][Medline][Order article via Infotrieve]
  23. Mucchielli ML, Mitsiadis TA, Raffo S, Brunet JF, Proust JP, Goridis C. Mouse Otlx2/RIEG expression in the odontogenic epithelium precedes tooth initiation and requires mesenchyme-derived signals for its maintenance. Dev Biol. 1997;189:275–284.[CrossRef][ISI][Medline][Order article via Infotrieve]
  24. Kioussi C, Briata P, Baek SH, et al. Identification of a Wnt/Dvl/beta-Catenin->Pitx2 pathway mediating cell-type-specific proliferation during development. Cell. 2002;111:673–685.[CrossRef][ISI][Medline][Order article via Infotrieve]
  25. Wei Q, Adelstein RS. Pitx2a expression alters actin-myosin cytoskeleton and migration of HeLa cells through Rho GTPase signaling. Mol Biol Cell. 2002;13:683–697.[Abstract/Free Full Text]
  26. Vittitow JL, Garg R, Rowlette LS, Epstein DL, O’Brien ET, Borras T. Gene transfer of dominant-negative RhoA increases outflow facility in perfused human anterior segment cultures. Mol Vis. 2002;8:32–44.[ISI][Medline][Order article via Infotrieve]
  27. Doward W, Perveen R, Lloyd IC, Ridgway AE, Wilson L, Black GC. A mutation in the RIEG1 gene associated with Peters’ anomaly. J Med Genet. 1999;36:152–155.[Abstract/Free Full Text]
  28. Perveen R, Lloyd IC, Clayton-Smith J, et al. Phenotypic variability and asymmetry of Rieger syndrome associated with PITX2 mutations. Invest Ophthalmol Vis Sci. 2000;41:2456–2460.[Abstract/Free Full Text]
  29. Priston M, Kozlowski K, Gill D, et al. Functional analyses of two newly identified PITX2 mutants reveal a novel molecular mechanism for Axenfeld-Rieger syndrome. Hum Mol Genet. 2001;10:1631–1638.[Abstract/Free Full Text]
  30. Saadi I, Semina EV, Amendt BA, et al. Identification of a dominant negative homeodomain mutation in Rieger syndrome. J Biol Chem. 2001;276:23034–23041.[Abstract/Free Full Text]
  31. Phillips JC. Four novel mutations in the PITX2 gene in patients with Axenfeld-Rieger syndrome. Ophthalmic Res. 2002;34:324–326.[CrossRef][ISI][Medline][Order article via Infotrieve]
  32. Borges AS, Susanna R, Jr, Carani JC, et al. Genetic analysis of PITX2 and FOXC1 in Rieger syndrome patients from Brazil. J Glaucoma. 2002;11:51–56.[CrossRef][ISI][Medline][Order article via Infotrieve]
  33. Kulharya AS, Maberry M, Kukolich MK, et al. Interstitial deletions 4q21.1q25 and 4q25q27: phenotypic variability and relation to Rieger anomaly. Am J Med Genet. 1995;55:165–170.[CrossRef][ISI][Medline][Order article via Infotrieve]
  34. Makita Y, Masuno M, Imaizumi K, et al. Rieger syndrome with de novo reciprocal translocation t(1;4) (q23.1;q25). Am J Med Genet. 1995;57:19–21.[CrossRef][ISI][Medline][Order article via Infotrieve]
  35. Vaux C, Sheffield L, Keith CG, Voullaire L. Evidence that Rieger syndrome maps to 4q25 or 4q27. J Med Genet. 1992;29:256–258.[Abstract]
  36. Flomen RH, Gorman PA, Vatcheva R, et al. Rieger syndrome locus: a new reciprocal translocation t(4;12)(q25;q15) and a deletion del(4)(q25q27) both break between markers D4S2945 and D4S193. J Med Genet. 1997;34:191–195.[Abstract]
  37. Schinzel A, Brecevic L, Dutly F, Baumer A, Binkert F, Largo RH. Multiple congenital anomalies including the Rieger eye malformation in a boy with interstitial deletion of (4) (q25->q27) secondary to a balanced insertion in his normal father: evidence for haplotype insufficiency causing the Rieger malformation. J Med Genet. 1997;34:1012–1014.[Abstract]
  38. Flomen RH, Vatcheva R, Gorman PA, et al. Construction and analysis of a sequence-ready map in 4q25: Rieger syndrome can be caused by haploinsufficiency of RIEG, but also by chromosome breaks approximately 90 kb upstream of this gene. Genomics. 1998;47:409–413.[CrossRef][ISI][Medline][Order article via Infotrieve]
  39. Velinov M, Gu H, Yeboa K, et al. Hypoplastic left heart in a female infant with partial trisomy 4q due to de novo 4;21 translocation. Am J Med Genet. 2002;107:330–333.[CrossRef][ISI][Medline][Order article via Infotrieve]
  40. Hubbard T, Barker D, Birney E, et al. The Ensembl genome database project. Nucleic Acids Res. 2002;30:38–41.[Abstract/Free Full Text]
  41. Sadeghi-Nejad A, Senior B. Autosomal dominant transmission of isolated growth hormone deficiency in iris-dental dysplasia (Rieger’s syndrome). J Pediatr. 1974;85:644–648.[CrossRef][ISI][Medline][Order article via Infotrieve]
  42. Amendt BA, Sutherland LB, Russo AF. Multifunctional role of the Pitx2 homeodomain protein C-terminal tail. Mol Cell Biol. 1999;19:7001–7010.[Abstract/Free Full Text]
  43. Green PD, Hjalt TA, Kirk DE, et al. Antagonistic regulation of Dlx2 expression by PITX2 and Msx2: implications for tooth development. Gene Expr. 2001;9:265–281.[ISI][Medline][Order article via Infotrieve]
  44. Espinoza HM, Cox CJ, Semina EV, Amendt BA. A molecular basis for differential developmental anomalies in Axenfeld-Rieger syndrome. Hum Mol Genet. 2002;11:743–753.[Abstract/Free Full Text]
  45. Hjalt TA, Amendt BA, Murray JC. PITX2 regulates procollagen lysyl hydroxylase (PLOD) gene expression: implications for the pathology of Rieger syndrome. J Cell Biol. 2001;152:545–552.[Abstract/Free Full Text]
  46. Cox CJ, Espinoza HM, McWilliams B, et al. Differential regulation of gene expression by PITX2 isoforms. J Biol Chem. 2002;277:25001–25010.[Abstract/Free Full Text]
  47. Depew MJ, Lufkin T, Rubenstein JL. Specification of jaw subdivisions by Dlx genes. Science. 2002;298:381–385.[Abstract/Free Full Text]
  48. Saleem RN, Banerjee-Basu S, Berry FB, Baxevanis AD, Walter MA. Analyses of the effects that disease-causing missense mutations have on the structure and function of the winged-helix protein FOXC1. Am J Hum Genet. 2001;68:627–641.[CrossRef][ISI][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
IOVSHome page
M. H. Strungaru, I. Dinu, and M. A. Walter
Genotype-Phenotype Correlations in Axenfeld-Rieger Malformation and Glaucoma Patients with FOXC1 and PITX2 Mutations
Invest. Ophthalmol. Vis. Sci., January 1, 2007; 48(1): 228 - 237.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. Asai-Coakwell, C. Backhouse, R. J. Casey, P. J. Gage, and O. J. Lehmann
Reduced Human and Murine Corneal Thickness in an Axenfeld-Rieger Syndrome Subtype
Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 4905 - 4909.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
N. Weisschuh, P. Dressler, F. Schuettauf, C. Wolf, B. Wissinger, and E. Gramer
Novel Mutations of FOXC1 and PITX2 in Patients with Axenfeld-Rieger Malformations.
Invest. Ophthalmol. Vis. Sci., September 1, 2006; 47(9): 3846 - 3852.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
D. Balasubramanian, P. L. Kaufman, and U.S.-Indo Collaborative Research Workshops Group
Research Opportunities in Vision: A Report of the U.S.-Indo Workshops on Collaborative Research
Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 1717 - 1735.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lines, M. A.
Right arrow Articles by Walter, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lines, M. A.
Right arrow Articles by Walter, M. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS