|
|
||||||||
1From The Schepens Eye Research Institute, Department of Ophthalmology, Harvard Medical School, Boston Massachusetts; the 2Department of Biochemistry, Department of Medicine, University of Washington, Seattle, Washington; and the 3Department of Pathology, Beth Israel Deaconess Medical Center, Research North, Boston, Massachusetts.
| Abstract |
|---|
|
|
|---|
METHODS. Expression of TSP-1 and -2 mRNA and protein was assayed in cornea and iris stroma by RT-PCR and Western blot. Corneas and irides of TSP-1-/-, TSP-2-/-, and TSP-1,2-/- mice aged 2, 3, and 6 months, and wild-type control mice, were analyzed for spontaneous angiogenesis biomicroscopically, histologically, and with CD31 immunohistochemistry. The mouse model of suture-induced, inflammatory corneal neovascularization was used to evaluate the lack of TSP-1,2 and both TSPs on induced-corneal angiogenesis. Seven days after intrastromal placement of three 11-0 sutures, vascularized areas were analyzed morphometrically on CD31-stained corneal flatmounts.
RESULTS. Corneas and irises from normal mouse eyes constitutively expressed TSP-1 and -2 mRNAs and proteins. Corneas of TSP-1-/-, -2-/-, and -1,2-/- mice displayed no evidence of spontaneous developmentalpostnatal angiogenesis, although irises of these mice contained significantly increased iris vessel density compared with wild-type animals (P < 0.01). One week after suturing, corneas of all TSP-/- mice had significantly greater corneal angiogenesis than those of control mice (P < 0.05). TSP-1-/- had a significantly greater effect on induced corneal neovascularization than did TSP-2-/-, with the opposite being the case in developmental iris angiogenesis (P < 0.01).
CONCLUSIONS. Corneal avascularity during development is redundantly regulated, shown by the fact that lack of the antiangiogenic factors TSP-1 and/or -2 resulted in no spontaneous corneal angiogenesis. By contrast, TSP-1, more than TSP-2, helps to suppress inflammation-induced corneal angiogenesis postnatally, implying that angiogenic privilege in the cornea is actively maintained.
The mechanisms underlying angiogenic privilege are poorly understood,4 although it is thought that antiangiogenic factors present in the cornea and in aqueous humor are important.1 5 Heparan sulfate proteoglycans in aqueous humor may contribute to corneal avascularity by binding and sequestering angiogenic growth factors such as vascular endothelial growth factor (VEGF) and fibroblast growth factor (FGF).5 The cornea itself is believed to produce and contain numerous antiangiogenic factors, including the thrombospondins (TSPs),6 pigment epithelialderived factor (PEDF),7 tissue inhibitor of matrix metalloproteinase (TIMP),8 endostatin (precursor:collagen type XVIII),9 angiostatin (precursor:plasminogen) (Hernandez-Quintela E, et al. IOVS 1999;40:ARVO Abstract 521), and angiopoietin-like factor CDT6.10 The plethora of factors capable of inhibiting angiogenesis in the cornea and aqueous humor suggests that physiologic control of angiogenesis in the cornea is redundantly regulated. The experimental results reported herein were designed to test this novel concept of redundant organization of corneal avascularity.
Thrombospondins are generated from a family of five genes encoding glycoproteins that regulate multiple extracellular matrix functions. Within this family, TSP-1 and -2 constitute a subfamily with strong antiangiogenic effects (Refs. 11 12 13 ). TSP-1, which can bind to latent transforming growth factor (TGF)-ß and promote its activation, is thought to inhibit angiogenesis through direct effects on endothelial cell migration and survival (e.g., by inducing vascular endothelial cell apoptosis through its binding to CD36)14 as well as through indirect effects on growth factor mobilization (e.g., by binding heparan sulfate proteoglycans).11 12 This has yet to be shown to be true for corneal and iris angiogenesis. TSP-2, which lacks a TGFß binding site, is also a multifunctional protein with antiangiogenic properties that binds to multiple receptors and is capable of inhibiting cell-cycle progression in endothelial cells in the absence of apoptosis (for review, see Ref. 13 ). Although the exact mechanisms by which TSP-1 and -2 achieve their antiangiogenic effects are not yet fully understood, both TSP-1 and -2 have been shown to inhibit bFGF-induced corneal neovascularization (CNV).15 16 Evidence suggests that TSP may be expressed in the normal cornea. Light-microscopic immunoreactivity for TSP-1 was observed in human and bovine corneal endothelium, epithelial basement membrane, and posterior Descemets membrane.6 Expression of TSP-1 and -2 in the mouse cornea and iris have yet to be studied.
To test the hypothesis that corneal avascularity is redundantly regulated, we examined the corneas of TSP-1-/-, -2-/-, and -1,2 double-deficient mice for evidence of spontaneous and induced CNV. To our knowledge, this is the first study to examine the effect of eliminating only one or two of the many antiangiogenic factors believed to regulate angiogenesis in the cornea in vivo, with respect to developmental and induced CNV. For comparison, the degree of vascularization in a normally vascularized ocular tissue, the iris, was also examined. Our results indicate that spontaneous corneal avascularity is redundantly regulated, and that, by contrast, induced corneal vascularity and developmental iris vascularity are primarily dependent on the actions of TSP-1 and -2.
| Methods |
|---|
|
|
|---|
Clinical and Histologic Evaluation of Cornea and Iris in TSP-/- Mice
At the ages of 2, 3, and 6 months, mice deficient in TSP-1, -2, or both TSP-1 and -2 were examined biomicroscopically while under anesthesia to detect corneal blood vessels. At least eight eyes (of four mice) were examined per time point. Subsequently, mice were killed and both eyes enucleated. The eyes were immediately fixed in 10% buffered formalin and later embedded in plastic. Five-micrometer pupil-optic disc sections, stained with hematoxylin and eosin, were then evaluated microscopically for corneal diseases and corneal blood vessels (at least 10 pupil-optic disc central sections per eye). In addition, corneal wholemounts of TSP-deficient mice (TSP-1, -2, or both TSP-1 and -2) at the age of 6 months were stained with antibodies to plateletendothelial cell adhesion molecule (PECAM 1/CD31; Santa Cruz Biotechnology, Santa Cruz, CA; 1:100), as described later, and analyzed for blood vessels extending beyond the limbus by immunofluorescence microscope (Axiophot light microscope; Carl Zeiss Meditec, Dublin, CA).
Quantification of Iris Vascular Density in TSP-/- and Wild-Type Mice
The number and density of iris stromal vessels was evaluated in TSP-deficient mice (TSP-1, -2, or both TSP-1 and -2) as follows: central, pupil-optic disc sections of eyes of mice (2, 3, or 6 months of age) were stained with hematoxylin and eosin, as described earlier, and analyzed by light microscopy (Axiophot light microscope; Carl Zeiss Meditec). Representative pupil-optic disc sections with similar iris diameter were analyzed, and all clearly identifiable vessel cross-sections were counted by a masked observer, who had no knowledge of the genotype of the tissues. At least eight eyes (of four mice) were examined per time point.
Induction and Quantification of Corneal Angiogenesis in CD31-Stained Corneal Flatmounts
To induce CNV, the established model of suture-induced inflammatory CNV was applied, as described previously with slight modifications, on TSP-1-/-, -2-/-, and -1,2-/- mice and their wild-type FVB background strain.20 Briefly, a 2-mm corneal trephine was gently placed on the central cornea of anesthetized mice solely to mark the central corneal area. Three 11-0 sutures were then placed intrastromally with two stromal incursions extending over 120° of corneal circumference each. The outer point of suture placement was chosen as halfway between the limbus and the line outlined by the 2-mm trephine, and the inner suture point was equidistant from the 2-mm trephine line to obtain standardized angiogenic responses. Sutures were left in place for 7 days. Mice were euthanized, the cornea with limbus was then excised, and modified flatmount double-immunohistochemistry was performed as previously described.21
Corneal flatmounts were rinsed in PBS, fixed in acetone, rinsed in PBS, blocked in 2% bovine serum albumin, stained with FITC-conjugated anti-CD31/PECAM-1 at 4°C overnight (1:100; Santa Cruz Biotechnology), washed, blocked, stained with LYVE-1 at 4°C overnight (1:100; a lymphatic endothelium-specific hyaluronic acid receptor; generous gift of David Jackson, Oxford, UK),22 washed, blocked, and stained with Cy3 for 1 hour at room temperature (1:100; Jackson ImmunoResearch Laboratories, West Grove, PA) and analyzed by microscope (Carl Zeiss Meditec; Axiophot). Digital pictures of the flatmounts were taken using an image-analysis system (Spot Image Analysis; Diagnostic Instruments, Sterling Heights, MI). Then, the area covered by CD312+/LYVE-1- vessels (i.e., blood vessels)3 22 was measured morphometrically on these flatmounts using NIH Image software (available by ftp at zippy.nimh.nih.gov/ or at http://rsb.info.nih.gov/nih-image; developed by Wayne Rasband, National Institutes of Health, Bethesda, MD). The total corneal area was outlined using the innermost vessel of the limbal arcade as the border. The total area of neovascularization was then normalized to the total corneal area, and the percentage of the cornea covered by vessels calculated. Isotype control mice were used as the negative control.
RT-PCR for TSP-1 and -2 in Cornea and Iris Tissue
RT-PCR was performed as previously described.23 Briefly, total RNA was extracted from 20 central corneas and iris tissues immediately after 10 mice were killed (RNAStat-60; Tel-Test Inc., Friendswood, TX). cDNA was synthesized from 5 µg RNA with M-MLV reverse transcriptase (Promega, Madison, WI) according to the manufacturers instructions. The following primers were used for PCR from 5' to 3': GAPDH sense, GGTGAAGGTCGGTGTGAACGGA; antisense, TGTTAGTGGGGTCTCGCTCCTG; TSP-1 sense, GTTCGTCGGAAGGATTGTTA; antisense, TCTATTCCAATGGCAACGAG; and TSP-2 sense, CAGAGTACTGGCGTCGGT CA; antisense, ATAAGATCGCAGCCCACATACAG. All primers were designed by Sigma Genosys (Woodlands, TX). PCR was performed under the following conditions: denaturation at 94°C; annealing at 52.7°C (TSP-1; TSP-2: 58.7°C) and extension at 72°C. After 40 cycles of amplification (AmpliTaq DNA Polymerase; Applied Biosystems, Foster City, CA), PCR products were electrophoresed in 2% agarose gel and visualized by ethidium bromide staining (0.5 µg/mL ethidium bromide) for 40 minutes. Photographs of the gel were taken with a high-resolution camera, and the density of the bands was analyzed on the gel using UV-illumination and image-analysis software (Image One; Bio-Rad, Hercules, CA). The expression level of mRNA was standardized by the expression of GAPDH as an internal control. The predicted sizes of PCR products are 733 bp for TSP-1, 649 bp for TSP-2, and 245 bp for GAPDH.
Western Blot for TSP-1 and -2 in Cornea and Iris
Cell lysates were prepared from 20 corneas and irises excised from 10 wild-type mice in each experiment using lysis buffer (Active Motif Inc., Carlsbad, CA) according to the manufacturers instructions. Protein content of lysates were determined using bicinchoninic acid (BCA) protein assay (Pierce, Rockford, IL). Recombinant TSP-2 and -1 protein, purified from thrombin-treated human blood platelets, were used as positive control mice (1 µg). Isotype controls were used as negative controls. Equal quantities of protein from lysates (10 µg) were subjected to SDS-PAGE in 3% to 8% Tris-acetate gradient gel (Invitrogen Inc., Carlsbad, CA) followed by electrophoretic transfer of separated proteins to nitrocellulose membranes (Pierce). Western blot analysis was performed using anti-TSP-1 or -2 antibodies (BD Biosciences, San Diego, CA). These antibodies were shown to be specific for their designated TSPs on Western blot. Antibodies bound to proteins on the membrane were detected using horseradish peroxidase conjugated secondary antibody (Santa Cruz Biotechnology) and chemiluminescent substrate (ECL detection reagents; Amersham Pharmacia Biotech, Piscataway, NJ) followed by signal detection on autoradiograph film (Biomax; Eastman Kodak, Rochester, NY).
Statistical Analysis
Statistical significance was analyzed by the Mann-Whitney test. Differences were considered significant at P < 0.05. Each experiment was performed at least three times with similar results. Graphs were composed on computer (Prism ver. 3.02; GraphPad, San Diego, CA).
| Results |
|---|
|
|
|---|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Previous reports on the effects on developmental and postnatal angiogenesis of a deficit of a single antiangiogenic factor did not reveal spontaneous CNV in mice (Fig. 5A) lacking angiostatin resulting from a knockout of its precursor plasminogen,25 (B) lacking endostatin secondary to a knockout of its precursor, collagen type XVIII,26 and (C) missing TIMP,27 although it is not clear whether this was specifically addressed in these studies.25 26 27 In none of these studies was the effect of the absence of antiangiogenic factors on induced CNV examined. Our results support the view that no single factor maintains corneal avascularity during development. We provide in vivo evidence that removal of one or even two important endogenous corneal antiangiogenic factors (i.e., TSP-1, -2, or both) does not result in spontaneous CNV. Together, the findings strongly support the hypothesis that corneal avascularity is regulated by multiple antiangiogenic proteins during development and postnatally.
By contrast, regulation of angiogenesis after trauma to the corneal surface with central sutures appears to be much less redundant. We demonstrate in this study that a significant increase in angiogenesis (i.e., active outgrowth of blood vessels into the normally avascular cornea) occurs in sutured corneas of TSP-1-/-, -2-/-, and -1,2-/- mice compared with their background strain. These findings establish TSP-1 and -2 as important inhibitors of inflammation-induced CNV in vivo. Because the angiogenic phenotype of the TSP-1 and -2 double-deficient mice equaled that of the TSP-1-/- mice and both had significantly greater angiogenic responses of induced corneal angiogenesis than the response of TSP-2-/- mice, we conclude that TSP-1 is more important than TSP-2 in inhibiting inflammatory (corneal) angiogenesis. However, the opposite is true for noninflammatory, developmental iris angiogenesis, because iris vessel counts in TSP-2-/- mice were significantly higher than in TSP-1-/- mice, suggesting that TSP-2 is more important in regulating developmental intraocular angiogenesis than TSP-1.
In this context, the molecular relationships of TSPs and TGFß must be considered. TSP-1 has a unique peptide sequence that binds latent TGFß, thereby converting it into active TGFß.30 31 This is pertinent because it has previously been shown that tight regulation of TGFß expression is necessary for maintaining corneal avascularity4 : TGFß1-overexpressing mice display a vascularized and disorganized corneal phenotype.4 Unlike TSP-1, TSP-2 lacks the capacity to activate latent TGFß1 (yet to be shown in the eye),12 and because TSP-2 has a strong effect on developmental iris angiogenesis and a weak effect on induced CNV, we conclude that this regulation is achieved by a TGFß-independent pathway.23
Our findings further indicate that TSPs have a more important effect on developmental and postnatal angiogenesis in the iris than in the cornea. Iris tissues from unmanipulated eyes of TSP-1-/-, -2-/- and -1,2-/- mice displayed significantly increased stromal vascular density in comparison to wild-type mice. This finding is the first evidence that TSP-1 and -2 are involved in regulating developmental-postnatal angiogenesis and in controlling the degree of vascularity of ocular tissues. In line with this role of TSP-1 and -2 in developmental ocular angiogenesis, TSP-1 and -2 mRNA expression was detected in the developing murine eye from postconception day 13 (TSP-1) and day 16 (TSP-2).30 The increase of iris vascular density in TSP-/- mice may be due to reduced Fas-FasLmediated apoptosis of new blood vessels in the iris, because it is known that this is one mechanism by which TSP-1 inhibits angiogenesis, and because Fas- and FasL-deficient mice display increased vascular density of certain tissues, such as the retina.31 A role for TSP in developmental angiogenesis is not limited to eye tissues. TSP-2 deficiency has previously been shown to be associated with increased vascular density in the skin, thymus, and adipose tissue, but not in the CNS.19 TSP-1 deficiency has also been linked to increased developmental angiogenesis in the skin29 and to elevated intraocular vessel counts, yet it remains unclear which vessels were actually counted in the latter study.32
TSP-1 and -2 are important inhibitors of angiogenesis (for review, see Refs. 11 12 13 ), but published reports of their roles in inflammatory CNV have been controversial. Whereas both TSP-116 33 and -215 have been shown to inhibit bFGF-induced CNV in the corneal micropocket assay (in mice or rabbit, respectively), BenEzra et al.34 found that TSP-1 enhanced the in vivo angiogenic process induced by bFGF or lipopolysaccharide (LPS) in the cornea. They attributed this enhancement to the known chemotactic effect of TSP-1 on polymorphonuclear cells and macrophages.34 Another explanation may be that binding of TSP-1 to CD47, at higher concentrations, also induces endothelial cell migration (for review, see Ref. 13 ).
We are intrigued that TSPs have a significant effect on inflammatory, but not on postnatal developmental CNV. We speculate that during development, other inhibitors compensate for the absence of TSP-1 and/or -2 in the knockout mice, and that these inhibitors are sufficient to maintain angiostasis in postnatal life, as long as trauma to the ocular surface is trivial. If, however, a postnatal angiogenic stimulus exceeds the threshold of protection provided by these other inhibitors, the absence of TSP-1, more so than TSP-2, permits induced CNV to proceed. This suggests a constitutive system of regulation that can control angiogenic stimuli up to a certain level of intensity, after which it fails. If corneal avascularity is to be maintained beyond this threshold, other factors or enhanced expression of endogenous inhibitors must intervene. We further speculate that upregulation of TSPs by inflammatory angiogenic stimuli helps to control CNV beyond this threshold. In favor of this view is the report that TSP-2-/- mice display prolonged and intensified inflammatory and angiogenic responses in the cutaneous delayed hypersensitivity model.35 Similarly, VEGF upregulates TSP-1 in the angiogenically stimulated retina.36 Because we have shown that the genes for TSP-1 and -2 are constitutively active in the normal cornea, it is reasonable to expect that inflammation in the cornea further upregulates their expression, thus enhancing the negative feedback loop for angiostasis. In fact, TSP-1 has been shown to be upregulated in response to corneal injury37 and it has recently been shown that keratocytes in the corneal stroma, in addition to TSP-1, can upregulate TSP-2 during a wound repair phenotype.38 The fact that mRNA expression of both antiangiogenic factors at rest was significantly higher in the cornea than in iris tissue suggests that the constitutive levels of antiangiogenic factors in the cornea far exceeds their levels in vascularized ocular tissues. The only other extraocular avascular tissue, cartilage, correspondingly shows a strong immunoreactivity for TSP-2 both during development and in the adult.39 The concept advanced here of a redundantly organized corneal angiogenic privilege with thresholds of response offers an explanation for the clinical observation that angiogenesis does not usually emerge after successful refractive surgery.1
| Acknowledgements |
|---|
| Footnotes |
|---|
Submitted for publication August 27, 2003; revised December 3, 2003, and January 8, 2004; accepted January 9, 2004.
Disclosure: C. Cursiefen, None; S. Masli, None; T.F. Ng, None; M.R. Dana, None; P. Bornstein, None; J. Lawler, None; J.W. Streilein, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: J. Wayne Streilein, The Schepens Eye Research Institute, Department of Ophthalmology, Harvard Medical School, 20 Staniford Street, Boston, MA 02114; waynes{at}vision.eri.harvard.edu.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. M. Krady, J. Zeng, J. Yu, S. MacLauchlan, E. A. Skokos, W. Tian, P. Bornstein, W. C. Sessa, and T. R. Kyriakides Thrombospondin-2 Modulates Extracellular Matrix Remodeling during Physiological Angiogenesis Am. J. Pathol., September 1, 2008; 173(3): 879 - 891. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Hos, F. Bock, T. Dietrich, J. Onderka, F. E. Kruse, K.-H. Thierauch, and C. Cursiefen Inflammatory Corneal (Lymph)angiogenesis Is Blocked by VEGFR-Tyrosine Kinase Inhibitor ZK 261991, Resulting in Improved Graft Survival after Corneal Transplantation Invest. Ophthalmol. Vis. Sci., May 1, 2008; 49(5): 1836 - 1842. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lu, L. Li, K. Kuno, Y. Wu, T. Baba, Y.-y. Li, X. Zhang, and N. Mukaida Protective Roles of the Fractalkine/CX3CL1-CX3CR1 Interactions in Alkali-Induced Corneal Neovascularization through Enhanced Antiangiogenic Factor Expression J. Immunol., March 15, 2008; 180(6): 4283 - 4291. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bock, J. Onderka, T. Dietrich, B. Bachmann, F. E. Kruse, M. Paschke, G. Zahn, and C. Cursiefen Bevacizumab as a Potent Inhibitor of Inflammatory Corneal Angiogenesis and Lymphangiogenesis Invest. Ophthalmol. Vis. Sci., June 1, 2007; 48(6): 2545 - 2552. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Futagami, S. Sugita, J. Vega, K. Ishida, H. Takase, K. Maruyama, H. Aburatani, and M. Mochizuki Role of Thrombospondin-1 in T Cell Response to Ocular Pigment Epithelial Cells J. Immunol., June 1, 2007; 178(11): 6994 - 7005. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Mwaikambo, F. Sennlaub, H. Ong, S. Chemtob, and P. Hardy Activation of CD36 Inhibits and Induces Regression of Inflammatory Corneal Neovascularization. Invest. Ophthalmol. Vis. Sci., October 1, 2006; 47(10): 4356 - 4364. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cursiefen, L. Chen, M. Saint-Geniez, P. Hamrah, Y. Jin, S. Rashid, B. Pytowski, K. Persaud, Y. Wu, J. W. Streilein, et al. Nonvascular VEGF receptor 3 expression by corneal epithelium maintains avascularity and vision PNAS, July 25, 2006; 103(30): 11405 - 11410. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Masli, B. Turpie, and J W. Streilein Thrombospondin orchestrates the tolerance-promoting properties of TGF{beta}-treated antigen-presenting cells Int. Immunol., May 1, 2006; 18(5): 689 - 699. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sekiyama, T. Nakamura, L. J. Cooper, S. Kawasaki, J. Hamuro, N. J. Fullwood, and S. Kinoshita Unique distribution of thrombospondin-1 in human ocular surface epithelium. Invest. Ophthalmol. Vis. Sci., April 1, 2006; 47(4): 1352 - 1358. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Y. Fears, J. R. Grammer, J. E. Stewart Jr., D. S. Annis, D. F. Mosher, P. Bornstein, and C. L. Gladson Low-Density Lipoprotein Receptor-Related Protein Contributes to the Antiangiogenic Activity of Thrombospondin-2 in a Murine Glioma Model Cancer Res., October 15, 2005; 65(20): 9338 - 9346. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cursiefen, S. Ikeda, P. M. Nishina, R. S. Smith, A. Ikeda, D. Jackson, J.-S. Mo, L. Chen, M. R. Dana, B. Pytowski, et al. Spontaneous Corneal Hem- and Lymphangiogenesis in Mice with Destrin-Mutation Depend on VEGFR3 Signaling Am. J. Pathol., May 1, 2005; 166(5): 1367 - 1377. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cursiefen, J. Cao, L. Chen, Y. Liu, K. Maruyama, D. Jackson, F. E. Kruse, S. J. Wiegand, M. R. Dana, and J. W. Streilein Inhibition of Hemangiogenesis and Lymphangiogenesis after Normal-Risk Corneal Transplantation by Neutralizing VEGF Promotes Graft Survival Invest. Ophthalmol. Vis. Sci., August 1, 2004; 45(8): 2666 - 2673. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |