(Investigative Ophthalmology and Visual Science. 2004;45:1427-1435.)
© 2004 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.03-1187
Regional Differences in Tyrosine Kinase Receptor Signaling Components Determine Differential Growth Patterns in the Human Lens
Jill M. Maidment,
George Duncan,
Shigeo Tamiya,
David J. Collison,
Lixin Wang, and
I. Michael Wormstone
From the School of Biological Sciences, University of East Anglia, Norwich, United Kingdom.
 |
Abstract
|
|---|
PURPOSE. The lens epithelium can be separated into two regions, the nondividing central zone and the equator, the site of all division in the normal lens. In the present study, the distribution of epithelial growth factor (EGF)/epithelial growth factor receptor (EGFR) signaling components was investigated and related to mitotic distribution in the lens.
METHODS. Anterior and equatorial regions of the native epithelium were prepared separately from donor lenses. In vitro capsular bags were prepared from donor eyes and cultured. Receptor distribution was determined by immunocytochemistry and RT-PCR. Western blot analysis of phospholipase C (PLC)-
and extracellular signal-regulated kinase (ERK; total and active) was performed on cell lysates. Function was determined by calcium imaging of Fura-2-AMloaded cells and also, in the case of capsular bags, by cell growth.
RESULTS. Immunocytochemistry and RT-PCR showed an even distribution of EGFR across the native epithelium. Whole lenses, however, exhibited only a calcium response to EGF (10 ng/mL) at the equatorial region. Western blot analysis demonstrated significantly greater expression of PLC
and ERK (total and active) in the equator than in the central region. Addition of EGF increased growth rates of cells in capsular bags and an EGFR inhibitor decreased rates. EGF also induced a calcium response in posterior capsule cells in the capsular bags.
CONCLUSIONS. EGFR is evenly distributed across the entire epithelium, whereas related calcium signaling and expression of PLC
and ERK have a marked bias to the equator. Therefore, levels of downstream enzyme components rather than changes in receptor expression dictate EGFR signaling output in the normal lens. In the wounded lens (capsular bag) EGFR signaling persists in cells growing on the posterior capsule.
Signal transduction mechanisms have been subject to intense investigation over the past two decades, and emerging evidence has made it increasingly clear that signaling pathways in eukaryotes are highly conserved.1 2 The epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases (TKs; also known as the ErbB/HER family) has been found to play a key role in the initiation of complex cellular signaling cascades, associated with the development, growth, differentiation, and/or survival of a variety of cell types. It has also been found that modification of EGFR (ErbB1) signaling is implicated in the pathogenesis of various human diseases.3
The lens is an unusual organ in which growth continues throughout life. It consists of several distinct parts: the capsule, the anterior and equatorial epithelial cells, and the fibers that make up the bulk of the lens (Fig. 1A) . In the normal lens, only the epithelial cells are able to proliferate and this occurs exclusively in the equatorial region, which is also the site of fiber differentiation. The cells of the central anterior epithelium are normally a static population, although disruption of this region can alter this behavior.4 In fact, the disruptive processes of cataract surgery leads to a massive increase in cell growth within the residual lens capsular bag, and this leads in many cases to a secondary decline in vision, termed posterior capsule opacification (PCO). There is little doubt therefore that the normal growth patterns of the lens are under tight control and that loss of this control can have critical clinical consequences.5

View larger version (66K):
[in this window]
[in a new window]
|
FIGURE 1. (A) A diagrammatic representation of a cross-section of the human lens. (B, C) Dissected lens capsule with adherent cells. The fibers have been removed from both preparations. (B) Equatorial capsule region (A, red region). (C) Anterior capsule containing solely anterior epithelial cells (A, blue region). (B) and (C) were captured using a x1 lens (NA 0.04). Magnification, x12.5.
|
|
EGF is one of a family of related small polypeptides including TGF
, HB-EGF, ampiregulin, and epiregulin, all of which can act as ligands for the EGFR.6 Traces of EGF have been found in the human lens7 8 and in the aqueous humor of patients undergoing intraocular surgery,9 although not all investigators have detected the ligand.10 The presence of EGFR mRNA and protein have been reported in human lens epithelial cells (HLECs)8 11 and the developing chick lens (Ireland M, et al. IOVS 2002;43:ARVO E-Abstract 2347), but the pattern of its distribution over the entire epithelium has not been elucidated.
Ligand binding to the EGFR brings about dimerization of receptors, facilitating their activation, autophosphorylation and the start of cytoplasmic signaling events. Phosphorylation of tyrosine residues allows interaction with target proteins that have an SH2 domain, such as adapter protein Grb2 or PLC
. Association with Grb2 can lead to activation of Ras and the mitogen-activated protein kinase (MAPK) cascade, and phospholipase C (PLC)-
may also signal to the MAPK cascade through intermediates such as DAG and Ca2+. MAPKs form part of a three-kinase sequence of regulatory enzymes in which MAPKs are phosphorylated on tyrosine and threonine by upstream MAPK kinases (MKKs). MKKs are themselves activated and phosphorylated by MAPKK kinases (MKKKs).12
There are multiple family members for each component of the MAPK cascade, but we have chosen to investigate the pathway containing the MAPK named extracellular signal-regulated kinase (ERK), as this is commonly stimulated by growth factors. After activation, ERKs may interact with cytoplasmic substrates or translocate to the nucleus to regulate transcription factor activity, leading to growth-factorinduced gene expression and cell cycle entry.13 It should also be noted that, in addition to the MAPK signaling pathway, Ca2+ mobilization is thought to play a major role in the control of lens cell growth.14 15 16 Vivekanandan and Lou16 were the first to show that EGF stimulates IP3 production in the lens, but they obtained an increase only when EGF was applied to the isolated cultured anterior epithelium. There was no detectable increase when applied to the whole lens. Recently, by applying calcium-imaging techniques to the intact lens, Collison and Duncan17 have found that EGF stimulates calcium release, but only in equatorial cells. This appears to conflict with EGFR localization studies in which its presence has been reported in anterior cells of the human lens.8 18 There is little doubt, however, that EGF can stimulate growth and differentiation of human lens cells at least in culture.19 The present study was therefore undertaken to elucidate the underlying differences in EGF signaling mechanisms in the anterior and equatorial regions of the human lens and also to attempt to explain the great increase in growth that follows disruption of the lens integrity.
 |
Materials and Methods
|
|---|
Anterior Lens Epithelium
The use of human tissue in the study was in accordance with the provisions of the Declaration of Helsinki. Human donor eye tissue was obtained from the East Anglian Eye Bank and the lens dissected from zonules and placed anterior side down onto a sterile 35-mm tissue culture dish. The center of the cell-free posterior capsule was punctured and an incision made across the diameter of the posterior capsule. Pins were inserted at the edge of the capsule to secure it at either end of the incision. Small cuts were then made in the capsule, near the pins so that most of the posterior capsule could be removed using two curvilinear tears. The remaining capsule (anterior and equatorial regions) was then further secured with six additional pins and the major fiber mass removed with forceps. Residual fibers were also carefully removed with forceps. The area of the central anterior epithelium and underlying capsule was then carefully dissected and transferred to a fresh 35-mm culture dish where it was secured with pins (Figs. 1B 1C) .
In Vitro Capsular Bag Model
The model previously described by Liu et al.20 was used. A sham cataract operation was performed on human donor eyes. The resultant capsular bag was then dissected from the zonules and secured on a sterile 35-mm PMMA Petri dish. Eight entomological pins (D1; Watkins and Doncaster Ltd., Kent, UK) were inserted through the edge of the capsule to retain its circular shape. Incubation was at 35°C in a 5% CO2 atmosphere. Ongoing observations were performed with a phase-contrast microscope and images captured with a digital camera (Coolpix 950; Nikon, Tokyo, Japan) with associated imaging software. In some cases preparations were fixed and used for immunofluorescence studies.
Immunofluorescence
Lens epithelia and capsular bags were dissected as described earlier. Preparations were fixed for 10 minutes with 4% paraformaldehyde in phosphate-buffered solution (PBS) then washed with PBS. Nonspecific sites were blocked with normal goat serum 1:50 in 1% bovine serum albumin (BSA) for 60 minutes. Monoclonal anti-EGFR (Upstate Biotechnology, Lake Placid, NY) was diluted 1:100 and incubated for 60 minutes. Preparations were then washed three times for 10 minutes each in PBS and incubated for a further 60 minutes with a secondary antibody conjugated to Alexa 488 (Molecular Probes, Leiden, The Netherlands). During the final 10 minutes of this incubation 4,6'diamidino-2-phenylinole-2HCI (DAPI) was added at 1 mg/mL to visualize cell nuclei. The preparations were finally washed three times for 10 minutes each in PBS, floated onto microscope slides, and mounted in aqueous mounting medium (Hydramount; National Diagnostics, Atlanta, GA). Preparations were viewed with a fluorescence microscope (Eclipse E800; Nikon) and images captured with a cooled CCD camera (Princeton Instruments, Ltd., Marlow, UK) and imaging software (Metamorph; Universal Imaging Corp., West Chester, PA). All images were captured at room temperature.
Growth Assay
Capsular bags were dissected and donor pairs checked for comparable cell coverage of the remaining anterior capsule by phase-contrast microscopy. The bags were maintained in Eagles minimum essential medium (EMEM) or EMEM supplemented with 10 ng/mL EGF, 1 µM AG1478, 10 µM U0126, or 0.1% dimethylsulfoxide (DMSO) as indicated and incubated at 35°C in a 5% CO2 atmosphere. The medium was replaced every 2 days, ongoing observations were performed daily using phase-contrast microscopy and images taken with a digital camera (Coolpix950; Nikon) and image analysis software used to determine coverage.
Western Blot Analysis
After dissection, epithelial preparations were washed in serum-free (SF) EMEM and then treated with fresh EMEM or EMEM containing 10 ng/mL EGF for 10 minutes. Cells were then lysed on ice in buffer: 50 mM HEPES [pH 7.5], 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 10% glycerol, 10 mM sodium pyrophosphate, 2 mM sodium orthovanadate, 10 mM sodium fluoride, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 10 µg/mL aprotinin.21 Lysates were precleared by centrifuging at 13,000 rpm at 4°C for 10 minutes, and the protein content of the soluble fraction was assayed by a bicinchoninic acid protein assay (Pierce, Rockford, IL). Equal amounts of protein per sample were loaded onto 10% SDS-PAGE gels for electrophoresis and transfer onto polyvinylidene difluoride (PVDF) membrane (NEN Life Science Products, Boston, MA) with a semidry transfer cell (Trans-Blot; Bio-Rad, Herts, UK). Proteins were detected using a chemiluminescent blot analysis system (ECL+; Amersham Biosciences, Amersham, UK) with anti-MAP kinase (ERK1 and ERK2; Zymed Laboratories Inc., South San Francisco, CA), anti-phospho MAPK (ERK 1/2; Cell Signaling Technology, Beverly, MA), and anti-PLC
(Cell Signaling Technology).
Reverse TranscriptionPolymerase Chain Reaction
After dissection, epithelial preparations were washed in SF EMEM, and RNA was collected from the cells by using a mini kit (RNeasy; Qiagen Ltd., Crawley, UK). RNA (250 ng) was reverse transcribed in a 20-µL reaction mixture (Superscript II RT; Invitrogen Ltd., Paisley, UK). cDNA (1 µL, diluted 1:5 in sterile double distilled water) was amplified by PCR in a20 µL reaction buffer in the following conditions: 0.5 µM each primer (Invitrogen Ltd.), 0.8 mM deoxy-nucleoside trisphosphate mixture (Bioline Ltd., London, UK), 10 mM Tris-HCl, 1.5 mM MgCl2, 50 mM KCl, and 2.5 U Taq DNA polymerase (Roche Diagnostics, Lewes, UK). The PCR was performed using the following program with a thermal controller (MJ Research Inc., Reno, NV): initial denaturation at 94°C for 4 minutes, denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute, and extension at 72°C for 1 minute. Steps 2 through 4 were cycled 27 times (GAPDH), 30 cycles (EGFR), or 33 cycles (ERK2) with a final extension at 72°C for 10 minutes. The oligonucleotide primer (5'3') sequence specific for the genes examined are as follows: GAPDH, ACCACAGTCCATGCCATCAC (forward) and TCCACCACCCTGTTGCTGTA (reverse); ERK2, TCTGTAGGCTGCATTCTGGC (forward) and GGCTGGAATCTAGCAGTC (reverse); and EGFR, GGTCTGCCGCAAATT (forward) and GCCGCGTATGATTTC (reverse). PCR products, together with the 100-bp DNA markers (Invitrogen-Life Technologies), were run on a 1% agarose gel, and images were captured and analyzed (1D system; Eastman Kodak, Rochester, NY).
Preparation of Whole Human Lenses and Capsular Bags for Ca2+ Imaging
Globes used for this research had the corneas removed for transplant and were immersed in EMEM at the eye bank to prevent dehydration. All lenses were dissected from donor globes by an anterior approach,17 and capsular bags were prepared as described earlier. A small study was made of regrowth of cells onto the anterior capsule after epithelial cell loss. To achieve this, the eye with cornea removed was stored for 48 to 72 hours so that the lens anterior was in direct apposition with the container base. This contact resulted in a loss of central cells (i.e., a denuded region). The eye was then maintained with the lens uppermost and imaged within 24 hours of doing so. In all cases, regrowth into the denuded region was observed. Both the whole lens and capsular bag preparations were then bathed in 35°C artificial aqueous humor (AAH), with the following composition (in mM): 130 NaCl, 5 KCl, 5 NaHCO3, 1 CaCl2, 0.5 MgCl2, 5 glucose, 20 HEPES, adjusted to pH 7.25 with NaOH. Directly after removal from the globes, lens preparations were placed in one of two plastic chambers used for Ca2+ imaging. The first chamber had a depth of 6 mm and accommodated the whole lens, anterior side down. The whole lens was secured in place by resting it against pins pushed into the plastic base of the chamber. This arrangement allowed imaging of both the central anterior cells and the equatorial region of the lens. The capsular bag preparation was placed in a chamber with a depth of 3 mm, and lens cells that had migrated onto the posterior capsule were imaged. Lens preparations used in the study of [Ca2+]i dynamics were obtained from a total of approximately nine donors aged between 25 and 80 years.
Measurement of [Ca2+]i
Both lens preparations (whole lens and capsular bag) were loaded with the acetoxymethylester (AM) form of 3 µM Fura-2 for 40 minutes at 25°C. The lens cells were then washed in AAH for 20 minutes to allow complete de-esterification of the dye. Ratio-metric imaging of [Ca2+]i took place on the stage of an epifluorescence microscope (model TE-200; Nikon) fitted with a x20 objective. In both lens preparations, the cells were too small for individual cell analysis, therefore data from regions of interest consisting of approximately 10 confluent cells were acquired as a running ratio average.17 No fluorescence signal was obtained from the whole lens posterior region or lens nucleus, but stable ratio signals were obtained from central anterior and equatorial cells. All preparations were continuously perifused with AAH (35°C). Solutions were administered through a two-way tap, and every effort was made to ensure that solution turnover time in each of the chambers was kept the same (
10 seconds). Cells were excited alternatively with light of 340- and 380-nm wavelengths. Resultant fluorescent emissions at both wavelengths were collected by a charge-coupled device (CCD) camera at 510 nm, and sampled every 2 seconds. The resultant fluorescence emissions from each lens preparation were taken as ratio values due to the difficulty in obtaining an accurate calibration of the whole lens.
 |
Results
|
|---|
Identification of EGFR in Native Lens Cells
The anterior epithelium readily spread flat when removed from the lens, and all cells remained attached to the collagen capsule. The cell nuclei could be seen clearly in dense array and the EGF receptor was located at each cell border (Figs. 2A 2B) . The equatorial region was more difficult to pin flat, but again the receptor could be seen clearly in the same relative position (Figs. 2C 2D) . Furthermore, cells grown on the previously cell-free posterior lens capsule after several days of culture in SF medium maintained receptor expression, which also remained located at the cell border (Figs. 2E 2F) . These data indicate that expression of EGFR protein was robust; and, in fact, mRNA levels of the receptor were also evenly distributed across the whole epithelium (Fig. 3) .

View larger version (106K):
[in this window]
[in a new window]
|
FIGURE 2. Epifluorescence micrographs showing EGFR localization (A, C, E) and nuclear distribution (B, D, F) within human lens epithelial cells from the central (A, B) and equatorial (C, D) zones. (E, F) EGFR localization and nuclear distribution within cells that have grown on the posterior capsule in culture. Note that the cells growing on the posterior capsule are much larger than the cells of the native epithelium. Control experiments were also performed, with IgG used as a substitute for primary antibody. In such cases, no staining pattern was observed. All images were captured with a x20 water-immersion objective lens (NA 0.75). Magnification, x200.
|
|

View larger version (39K):
[in this window]
[in a new window]
|
FIGURE 3. RT-PCR identification of mEGFR from anterior and equatorial regions of the epithelium. (A) Represents pooled data from three separate donor lenses. Expression of GAPDH was used as the control. Data are expressed as mean levels ± SEM. (B) A representative gel showing data from a single donor. No statistical difference in mEGFR expression was detected (Students t-test, P < 0.05).
|
|
Measurements of [Ca2+]i
Central anterior lens epithelia have a stable resting concentration [Ca2+]i of approximately 100 nM.22 EGF (10 ng/mL) failed to stimulate any appreciable increase in [Ca2+]i in this region of the whole human lens (Fig. 4A) . This is not due to a lack of intact endoplasmic reticulum, as G-protein receptor agonists such as acetylcholine and histamine induce a calcium response in this region.17 EGF, however, was able to induce a large, prolonged [Ca2+]i response in the equatorial epithelial region of the whole lens (Fig. 4B) . The response remained in an elevated state for some time after EGF was removed from the bathing medium. Cells residing on the posterior capsule of a capsular bag isolated from a donor eye that had undergone cataract surgery (ex vivo) also responded to EGF with an increase in [Ca2+]i of a magnitude similar to that of the equatorial region of the whole lens (Fig. 4C) . EGF also evoked a robust and sustained Ca2+ mobilization response in lens epithelial cells that had repopulated the anterior capsule after their removal during transport with the lens facing downward (Fig. 4D) . The cells that migrated onto the denuded region of the capsule had a morphology similar to that of tissue-cultured cells, whereas confluent cells in the surrounding area had a normal anterior epithelial morphology (Fig. 4E) .

View larger version (18K):
[in this window]
[in a new window]
|
FIGURE 4. Intracellular Ca2+ responses to EGF in HLECs. (A, B) Typical responses of an intact lens after stimulation with 10 ng/mL EGF in cells of (A) the central anterior epithelium and (B) the equatorial zone. (C) Representative response of cultured epithelial cells growing on the posterior capsule of an ex vivo capsular bag in response to 10 ng/mL EGF. (D) EGF transient obtained from a single cell near the center of the anterior capsule. This cell was in a region denuded during storage and is highlighted by a white box in the phase-contrast image. All cells in this region responded to EGF. (E) Cells surrounding the denuded area were in close-packed, confluent array and were found to have a morphology similar to that of normal anterior cells. These cells did not respond to EGF.
|
|
Distribution Patterns of Downstream Components of EGFR Signaling
To address the absence of Ca2+ signaling in response to EGF in the central epithelium, expression of PLC
was investigated. Western blot analysis for PLC
revealed some expression in the central region; however, the levels in the equatorial region were more than 20 times higher (Figs. 5A 5C) . We also examined the expression pattern of ERK 1/2. Again, by Western blot detection, some expression of protein was observed in the central zone, but there was a significantly higher level (t-test, P < 0.05) in the equatorial zone (Figs. 5B 5D) . In the case of ERK 2 expression, further analysis was performed with RT-PCR, and again this revealed asymmetric expression in the two regions (Fig. 6) .

View larger version (28K):
[in this window]
[in a new window]
|
FIGURE 6. Identification of mERK from an RT-PCR analysis of native human lens epithelial cells from the central anterior (A) and equatorial (E) regions of the epithelium. Expression of GAPDH was used as a control gene. The results shown are representative of data obtained from three separate donors.
|
|
EGF-Induced Activation of ERK 1/2
Isolated central and peripheral cells both responded to addition of 10 ng/mL EGF for 10 minutes by activation of ERK 1/2, the final members of the MAPK pathway before transcriptional activation (Fig. 7) . Statistical comparison using a t-test (P < 0.05) of the data did not reveal statistically significant differences between the relative control and stimulated groups. However, it should be noted that in all cases, increased levels of pERK were observed in the two regions after EGF stimulation and after a sign test; P = 0.062 was obtained (the lowest feasible for n = 4). The levels of phosphorylated ERK 1/2 remained less in the central region relative to the peripheral zone, and this expression correlated with the levels of total ERK 1/2 in the respective regions. It is interesting to note that the level of pERK was significantly higher in the equatorial region under SF nonstimulated conditions (Students t-test P < 0.05).

View larger version (21K):
[in this window]
[in a new window]
|
FIGURE 7. Regional levels of phosphorylated ERK 1/2 proteins in native HLECs with or without stimulation with 10 ng/mL EGF for 10 minutes. (A) Mean levels ± SEM of pERK 1/2 from image analysis of Western blots from three separate donors. (B) Result of a representative Western blot showing regional levels of pERK 1/2 with or without 10 ng/mL EGF for 10 minutes. Data in (B) were from the same blot. *Significant difference from nonstimulated central epithelial cells (Students t-test P < 0.05).
|
|
EGF Signaling and Growth
To examine the role of endogenous EGFR signaling, AG1478 a specific inhibitor of EGFR was added to the culture medium. Capsular bag cultures maintained in SF medium exhibited cell coverage of the entire posterior capsule in most cases. When EGFR signaling was inhibited using AG1478, no significant difference was observed between treated and control groups at specific time points, but analysis of all the data points for the two conditions over the entire culture duration, using a matched-pair t-test (P < 0.05), revealed significant retardation of growth by AG1478 (Fig. 8A 8B) . Addition of 10 ng/mL EGF to cultures significantly (Students t-test, P < 0.05) promoted cover of the posterior capsule relative to matched-pair controls (Figs. 8C 8D) . Blockade of MAPK signaling with the MEK inhibitor U0126 in the presence of 10 ng/mL EGF led to a significant retardation of coverage, so that by day 9, only 5% of the posterior capsule remained uncovered in EGF-stimulated bags, whereas in the presence of U0126 65% of the surface remained clear (Fig. 9) .

View larger version (27K):
[in this window]
[in a new window]
|
FIGURE 8. Influence of EGFR signaling on the growth of HLECs in cultured capsular bags. (A) Cell coverage of the previously cell-free posterior capsule cultured in SF medium alone, or in medium containing 1 µM AG1478. (B) Difference in cell coverage of matched-pair, previously cell-free posterior capsules cultured in SF medium alone or in medium containing 1 µM AG1478. (C) Cell coverage of the previously cell-free posterior capsule cultured in SF medium or SF medium containing 10 ng/mL EGF. (D) Difference in cell coverage of matched-pair, previously cell-free posterior capsules cultured in SF medium or SF containing 10 ng/mL EGF, in which 100% represents complete coverage of the central posterior capsule. Each data point represents the mean ± SEM of measurements from four lenses. *Significant difference between test and control (Students t-test, P < 0.05) at a given time point. Matched-pair comparisons (P < 0.05) of treated and control groups were also performed to compare groups over the entire culture period and showed significant inhibition of growth by AG1478 and promotion of growth by EGF.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIGURE 9. Influence of EGF and MAPK signaling on the growth of HLECs in cultured capsular bags. (A) Cell coverage of the previously cell-free posterior capsule cultured in 10 ng/mL EGF or 10 ng/mL EGF containing 10 µM U0126. (B) Difference in cell coverage of matched-pair, previously cell-free posterior capsules cultured in 10 ng/mL EGF or 10 ng/mL EGF containing 10 µM U0126, in which 100% represents complete coverage of the central posterior capsule. Data are expressed as the mean ± SEM (n = 4). *Significant difference between test and control (Students t-test, P < 0.05) at a given time point. In addition, matched-pair comparisons (P < 0.05) of treated and control groups were performed over the entire culture period and showed significant inhibition of growth by U0126.
|
|
 |
Discussion
|
|---|
TK receptors play a fundamental role in controlling growth, and EGFR has been strongly implicated as a central transducer in many tissues.2 23 The downstream events have also been well defined, and both ERK activation and an increase in intracellular calcium appear to drive cell division.15 23 24 The fundamental issue, which this article addresses, is how EGFR activation and key signaling pathways in general relate directly to growth control. A clue has been provided by previous work on human lens cells15 and indeed other cell systems24 that have provided a direct link between endoplasmic calcium release and growth. In general, it appears that if ER signaling is disabled, then cell division ultimately ceases. It now appears from the present work that not only is PLC
upregulated in the region of the lens where cell division is greatest, but also the downstream molecules of the MAPK pathway are found there in greatest abundance. The data imply that any growth factor using either PLC
to initiate calcium signaling or the MAPK pathway to implement the agonist command will instigate a much greater response in the equator than in the anterior, which helps explain, in the human lens at least, why growth is normally restricted to the equatorial cells. This conclusion is therefore, of course, not restricted to EGF, but would be true of any TK receptor coupled with PLC
or the MAPK pathway. Collison and Duncan17 have in fact previously reported that PDGF also initiates a calcium response selectively in the equatorial cells, but not in the anterior epithelium. EGF activation of ERK also plays a crucial role in the growth of corneal epithelial cells, and the blockade of the store-operated calcium channel significantly suppresses the proliferative effect of EGF.25
One question that remains unresolved, however, is why EGFR is expressed abundantly in the central epithelium (Fig. 2A) . In the normal physiological state, ligand availability appears to be low, because EGF and TGF
, both ligands of EGFR cannot be detected in the aqueous humor.26 After injury, however, levels of EGF and TGF
can be increased.27 28 We also know from the present study that growing cells possess receptors capable of inducing calcium transients and consequently functional responses. The constant presence of the receptor could be of benefit to the lens in response to trauma and injury in two ways. First, fewer elements would need to be upregulated in response to trauma; and, second, possessing the receptor with a limited, but nevertheless active, signaling pathway can inform the cell that extracellular ligand is present. This could upregulate expression of signaling proteins such as PLC
and ERK 1/2 and thereby render the system more efficient, in turn leading to the possibility of cell divisiona possibility that remains an interesting topic for future studies. In addition, the data presented in Figure 4C show that cells that have grown on the posterior capsule are also responsive to EGF sometime after cataract surgery. Moreover, cells close to a breach of the normally intact anterior epithelium are responsive to EGF (Figs. 4D 4E) . These data help explain why anterior cells in the lens capsular bag ultimately divide after surgery, although their response is delayed compared with the very rapid increase in cell division in the equatorial region.29 30
It has become increasingly clear in recent years that growth of lens cells, even in aged humans, is extremely robust and is under both autocrine and paracrine control.5 Cells maintained in the capsular bag continue to synthesize proteins in SF medium without added growth factors for more than 1 year, and Wormstone et al.31 have identified bFGF as one of the autocrine factors involved. However, it is also possible to elicit a paracrine response if sufficient stimulus is applied.30 32 The specific EGFR inhibitor AG147833 resulted in a retardation of growth in cells maintained in SF EMEM, indicating EGF/EGFR autocrine-driven growth occurs in the capsular bag in vitro. Moreover, EGF has a significant paracrine role to play in the growth of human lens cells, as addition of EGF not only induces a marked stimulation of cell cover of the posterior capsule in the in vitro model, but it also stimulates calcium release in cells growing on the posterior capsule in capsular bags. It is also important to note in this context that EGF has been detected in the aqueous humor of patients after cataract surgery.34 EGF stimulation of growth is comparable with other paracrine stimuli in the capsular bag system, such as basic FGF.31 Serum, which contains many growth factors, can promote growth to a greater extent.31 It is therefore likely that small contributions from a number of growth factors, such as EGF, FGF,31 and hepatocyte growth factor (HGF)35 lead to enhanced growth promotion. The overall importance of the MAPK in driving growth can be seen by the fact that the MEK inhibitor U0126 markedly reduces cell growth across the posterior capsule. U0126 has a general effect on MAPK signaling. The data presented have shown that ERK is abundant in sites of growth and mitosis. As active cell growth is a component of PCO, we believed MAPK would be important in the process. Application of U0126 has shown that this is the case and suggests that EGF is just one stimulus that channels its activity through the MAPK cascade, although there are undoubtedly others. A previous study by Gong et al.36 also emphasized the central role of the MAPK signaling pathway. They showed that transgenic expression of upregulated MEK1 causes macrophthalmia in mouse lenses, but were unable to explain why the disruptive effect driven by the
-crystallin promoter was greater at the equator. According to our findings, greater abundance of ERK proteins, the substrates for MEK1 could explain this. Walker et al.37 have emphasized the interaction of ERK and integrin-
6 in controlling differentiation of chick equatorial cells; and, again, we postulate that the major drive for this important process is initiated in the equatorial cells through the greater abundance of ERK. In addition to EGFR activation, one strong candidate for autocrine stimulation of the MAPK cascade in LECs is FGF. This has been found to be a major regulator of growth of HLECs in SF medium,31 and FGF also stimulates proliferation of rat LECs through ERK 1/2.38 In addition, there are several other potential factors that can influence MAPK signaling, including HGF, PDGF, and IGF.5
In summary, we provide evidence that, whereas the EGFR is evenly distributed across epithelial cells in the normal (noncataractous) human lens, PLC
and ERK 1/2 signaling molecules downstream of the receptor are considerably more abundant in the periphery than in the center of the epithelium, resulting in asymmetrical EGFR signaling at the basal level and when stimulated with exogenous EGF. The low abundance of ERK and PLC
in the central region, however, has a wider significance, as it provides a means of spatially directing cell growth in any system in which cell division is required in a specific region. Any growth factor, wherever produced, that is linked to TK activation leading to phosphorylation of ERK and PLC
induces only a functional effect, if these signaling molecules are present in a sufficient number in any given cell. In the case of the lens, levels are relatively high in the equatorial cells and significant signaling events can be observed in cells from this region. In a situation in which unscheduled growth is required after, for example, loss of epithelial cells, it appears that existing membrane receptors can be coupled to functional output. This is likely to result from increased production of downstream signaling molecules.
 |
Acknowledgements
|
|---|
The authors thank Peter Davies and Pamela Keeley of the East Anglian Eye Bank and staff of the Bristol Eye Bank for the supply of human tissue and Diane Alden for technical assistance.
 |
Footnotes
|
|---|
Supported by The Humane Research Trust, Medical Research Council, and The Royal Society.
Submitted for publication October 28, 2003; revised December 16, 2003 and January 9, 2004; accepted January 13, 2004.
Disclosure: J.M. Maidment, None; G. Duncan, None; S. Tamiya, None; D.J. Collison, None; L. Wang, None; I.M. Wormstone, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: I. Michael Wormstone, The Humane Research Trust Lecturer, School of Biological Sciences, University of East Anglia, Norwich NR4 7TJ, UK; i.m.wormstone{at}uea.ac.uk.
 |
References
|
|---|
- Aroian RV, Koga M, Mendel JE, Ohshima Y, Sternberg PW. The let-23 gene necessary for Caenorhabditis elegans vulval induction encodes a tyrosine kinase of the EGF receptor subfamily. Nature. 1990;348:693699.[CrossRef][Medline][Order article via Infotrieve]
- Yarden Y. The EGFR family and its ligands in human cancer. signalling mechanisms and therapeutic opportunities. Eur J Cancer. 2001;37(suppl 4)S3S8.
- Yarden Y. The EGFR family and its ligands in human cancer: signalling mechanisms and therapeutic opportunities. Eur J Cancer. 2001;37:S3S8.
- Saika S, Okada Y, Miyamoto T, Ohnishi Y, Ooshima A, McAvoy JW. Smad translocation and growth suppression in lens epithelial cells by endogenous TGF beta 2 during wound repair. Exp Eye Res. 2001;72:679686.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Wormstone IM. Posterior capsule opacification: a cell biological perspective. Exp Eye Res. 2002;74:337347.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Riese DJ, Stern DF. Specificity within the EGF family/ErbB receptor family signaling network. Bioessays. 1998;20:4148.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Tripathi RC, Borisuth NS, Tripoathi BJ, Fang VS. Analysis of human aqueous humor for epidermal growth factor. Exp Eye Res. 1991;53:407409.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Majima K. Human lens epithelial cells proliferate in response to exogenous EGF and have EGF and EGF receptor. Ophthalmic Res. 1995;27:356365.[Web of Science][Medline][Order article via Infotrieve]
- Parelman JJ, Nicolson M, Pepose JS. Epidermal growth-factor in human aqueous humor. Am J Ophthalmol. 1990;109:603604.[Web of Science][Medline][Order article via Infotrieve]
- van Setten GB, Fagerholm P, Philipson B, Schulz G. Growth factors and their receptors in the anterior chamber. Ophthalmic Res. 1996;28:361364.[Web of Science][Medline][Order article via Infotrieve]
- Bhuyan DK, Reddy PG, Bhuyan KC. Growth factor receptor gene and protein expressions in the human lens. Mech Ageing Dev. 2000;113:205218.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Cobb MH, Goldsmith EJ. How MAP kinases are regulated. J Biol Chem. 1995;270:1484314846.[Free Full Text]
- Brunet A, Roux D, Lenormand P, Dowd S, Keyse S, Pouyssegur J. Nuclear translocation of p42/p44 mitogen-activated protein kinase is required for growth factor-induced gene expression and cell cycle entry. EMBO J. 1999;18:664674.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Duncan G, Riach RA, Williams MR, Webb SF, Dawson AP, Reddan JR. Calcium mobilisation modulates growth of lens cells. Cell Calcium. 1996;19:8389.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Duncan G, Wormstone IM, Liu CS, Marcantonio JM, Davies PD. Thapsigargin-coated intraocular lenses inhibit human lens cell growth. Nat Med. 1997;3:10261028.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Vivekanandan S, Lou MF. Evidence for the presence of phosphoinositide cycle and its involvement in cellular signal transduction in the rabbit lens. Curr Eye Res. 1989;8:101111.[Web of Science][Medline][Order article via Infotrieve]
- Collison DJ, Duncan G. Regional differences in functional receptor distribution and calcium mobilization in the intact human lens. Invest Ophthalmol Vis Sci. 2001;42:23552363.[Abstract/Free Full Text]
- Weng J, Liang QW, Mohan RR, Li Q, Wilson SE. Hepatocyte growth factor, keratinocyte growth factor, and other growth factor-receptor systems in the lens. Invest Ophthalmol Vis Sci. 1997;38:15431554.[Abstract/Free Full Text]
- Ibaraki N, Lin LR, Reddy VN. Effects of growth factors on proliferation and differentiation in human lens epithelial cells in early subculture. Invest Ophthalmol Vis Sci. 1995;36:23042312.[Abstract/Free Full Text]
- Liu CSC, Wormstone IM, Duncan G, Marcantonio JM, Webb SF, Davies PD. A study of human lens cell growth in vitro: a model for posterior capsule opacification. Invest Ophthalmol Vis Sci. 1996;37:906914.[Abstract/Free Full Text]
- Daub H, Wallasch C, Lankenau A, Herrlich A, Ullrich A. Signal characteristics of G protein-transactivated EGF receptor. EMBO J. 1997;16:70327044.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Collison DJ, Coleman RA, James RS, Carey J, Duncan G. Characterization of muscarinic receptors in human lens cells by pharmacologic and molecular techniques. Invest Ophthalmol Vis Sci. 2000;41:26332641.[Abstract/Free Full Text]
- Zwick E, Hackel PO, Prenzel N, Ullrich A. The EGF receptor as central transducer of heterologous signalling systems. Trends Pharmacol Sci. 1999;20:408412.[CrossRef][Medline][Order article via Infotrieve]
- Ghosh TK, Bian JH, Short AD, Rybak SL, Gill DL. Persistent intracellular calcium pool depletion by thapsigargin and its influence on cell growth. J Biol Chem. 1991;266:2469024697.[Abstract/Free Full Text]
- Yang H, Sun X, Wang Z, et al. EGF stimulates growth by enhancing capacitative calcium entry in corneal epithelial cells. J Membr Biol. 2003;194:4758.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- van Setten GB, Fagerholm P, Philipson B, Schultz G. Growth factors and their receptors in the anterior chamber: absence of epidermal growth factor and transforming growth factor alpha in human aqueous humor. Ophthalmic Res. 1996;28:361364.
- Sheardown H, Cheng YL. Tear EGF concentration following corneal epithelial wound creation. J Ocul Pharmacol Ther. 1996;12:239243.[Web of Science][Medline][Order article via Infotrieve]
- Namiki M, Tagami Y, Yamamoto M, Yamanaka A, Itoh M, Kanoh M. Presence of human epidermal growth factor (hEGF), basic fibroblast growth factor (bFGF) in human aqueous (in Japanese). Nippon Ganka Gakkai Zasshi. 1992;96:652656.[Medline][Order article via Infotrieve]
- Rakic JM, Galand A, Vrensen GF. Separation of fibres from the capsule enhances mitotic activity of human lens epithelium. Exp Eye Res. 1997;64:6772.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Wormstone IM, Liu CS, Rakic JM, Marcantonio JM, Vrensen GF, Duncan G. Human lens epithelial cell proliferation in a protein-free medium. Invest Ophthalmol Vis Sci. 1997;38:396404.[Abstract/Free Full Text]
- Wormstone IM, Del Rio-Tsonis K, McMahon G, et al. FGF: an autocrine regulator of human lens cell growth independent of added stimuli. Invest Ophthalmol Vis Sci. 2001;42:13051311.[Abstract/Free Full Text]
- Liu CS, Wormstone IM, Duncan G, Marcantonio JM, Webb SF, Davies PD. A study of human lens cell growth in vitro: a model forposterior capsule opacification. Invest Ophthalmol Vis Sci. 1996;37:906914.
- Levitzki A, Gazit A. Tyrosine kinase inhibition: an approach to drug development. Science. 1995;267:17821788.[Abstract/Free Full Text]
- Parelman JJ, Nicolson M, Pepose JS. Epidermal growth factor in human aqueous humor. Am J Ophthalmol. 1990;109:603604.
- Wormstone IM, Tamiya S, Marcantonio JM, Reddan JR. Hepatocyte growth factor function and c-Met expression in human lens epithelial cells. Invest Ophthalmol Vis Sci. 2000;41:42164222.[Abstract/Free Full Text]
- Gong X, Wang X, Han J, Niesman I, Huang Q, Horwitz J. Development of cataractous macrophthalmia in mice expressing an active MEK1 in the lens. Invest Ophthalmol Vis Sci. 2001;42:539548.[Abstract/Free Full Text]
- Walker JL, Zhang L, Zhou J, Woolkalis MJ, Menko AS. Role for alpha 6 integrin during lens development: evidence for signaling through IGF-1R and ERK. Dev Dyn. 2002;223:273284.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Lovicu FJ, McAvoy JW. FGF-induced lens cell proliferation and differentiation is dependent on MAPK (ERK 1/2) signalling. Development. 2001;128:50755084.
This article has been cited by other articles:

|
 |

|
 |
 
S. Tamiya and N. A. Delamere
Studies of Tyrosine Phosphorylation and Src Family Tyrosine Kinases in the Lens Epithelium
Invest. Ophthalmol. Vis. Sci.,
June 1, 2005;
46(6):
2076 - 2081.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Wang, A. R. Prescott, B. A. Spruce, J. Sanderson, and G. Duncan
Sigma Receptor Antagonists Inhibit Human Lens Cell Growth and Induce Pigmentation
Invest. Ophthalmol. Vis. Sci.,
April 1, 2005;
46(4):
1403 - 1408.
[Abstract]
[Full Text]
[PDF]
|
 |
|