|
|
||||||||
1From St. Eriks Eye Hospital, Stockholm, Sweden; 3Cellular and Molecular Tumor Pathology, Department of Oncology and Pathology, Karolinska Hospital, Stockholm, Sweden; and the 4Ludwig Institute for Cancer Research, Uppsala, Sweden.
| Abstract |
|---|
|
|
|---|
METHODS. Based on immunohistochemical (IHC) study of paraffin-embedded specimens from 134 uveal melanomas and Western blot analysis on eight fresh-frozen samples the expression of c-kit in uveal melanoma was studied. Furthermore, the phosphorylation of c-kit and the impact of the tyrosine kinase inhibitor STI571 was examined in the three uveal melanoma cell lines OCM-1, OCM-3, and 921.
RESULTS. Eighty-four of 134 paraffin-embedded samples and six of eight fresh-frozen samples expressed c-kit. c-Kit was strongly expressed and tyrosine phosphorylated in cultured uveal melanoma cells compared with cutaneous melanoma cells. Moreover, in contrast to cutaneous melanoma cell lines c-kit maintained a high phosphorylation level in serum-depleted uveal melanoma cells. No activation-related mutations in exon 11 of the KIT gene were found. On the contrary, expression of the stem cell growth factor (c-kit ligand) was detected in all three uveal melanoma cell lines, suggesting the presence of autocrine (paracrine) stimulation pathways. Treatment of uveal melanoma cell lines with STI571, which blocks c-kit autophosphorylation, resulted in cell death. The IC50 of the inhibitory effects on c-kit phosphorylation and cell proliferation was of equal size and less than 2.5 µM.
CONCLUSIONS. The results confirm that c-kit is vastly expressed in uveal melanoma, suggest that the c-kit molecular pathway may be important in uveal melanoma growth, and point to its use as a target for therapy with STI571.
Very little is known about the role of the c-kit proto-oncogene in uveal melanoma. It encodes a receptor tyrosine kinase (kit) whose ligand is a stem cell factor (SCF, also known as steel factor, kit ligand, and mast cell growth factor).5 6 c-Kit is expressed by and is critical in the development of cutaneous melanocytes, mast cells, hematopoietic stem cells, germ cells, and the interstitial cells of Cajal.7 Studies have demonstrated that c-kit is expressed in normal melanocytes, but contradictory results have been published concerning the expression of c-kit in metastasizing cutaneous melanoma.8 9 10 Data from studies on gastrointestinal stromal tumors (GIST), in a substantial proportion of which there is a mutation in exon 11 leading to ligand-independent c-kit activation, have shown that treatment with STI571, an inhibitor of platelet-derived growth factor receptor (PDGFR), Bcr-Abl, and c-kit tyrosine phosphorylation,11 causes tumor regression.12 13
Recently, it has been shown in our laboratory that c-kit is commonly expressed in uveal melanoma.14 Independently, Mouriaux et al.15 have recently demonstrated that c-kit is expressed in as many as 75% of uveal melanoma, based on an investigation of 57 cases.15 The purpose of the present study was to evaluate the expression and possible functional impact of the proto-oncogene c-kit in uveal melanoma.
| Methods |
|---|
|
|
|---|
Tumor Material
Paraffin-embedded blocks from 134 cases (64 females and 70 males) derived from surgically removed primary uveal melanomas were used for immunohistochemistry (IHC). The ages of the patients varied between 24 and 92 years with a mean age of 64 years at diagnosis. Sixty-four patients died of tumor-related causes, 49 patients died of other causes, and 21 were alive at the time of follow-up. The follow-up time was 13 years or more.
Fresh-frozen uveal melanoma tissue samples from eight patients and six samples from cutaneous melanoma tumors were used for Western blot analysis. All parts of the study were conducted in compliance with the Declaration of Helsinki.
Cell Culture
The uveal melanoma cell lines OCM-1, OCM-3, and 921 (kindly provided by Martine Jager, Leiden University Medical Center, Leiden, The Netherlands), and the cutaneous melanoma cell lines DFB and BE16 (kindly given to us by Rolf Kiessling, CCK, Karolinska Hospital, Stockholm). All three cell lines were initially derived from primary uveal melanomas. The OCM-1 cells have a spindle cell morphology and were cultured in Dulbeccos modified Eagles medium (DMEM) supplemented with 10% fetal bovine serum (FBS). The OCM-3 has epithelioid cell morphology, whereas 92-1 cells have a mixed phenotype. OCM.3 and 92-1 cells were cultured in RPMI 1640 supplemented with10% FBS and 3 mM L-glutamine.17 18 19
Cells were grown in monolayers in tissue culture flasks, maintained in a 95% air/5% CO2 atmosphere at 37°C in a humidified incubator. For experimental purposes the cells were cultured in 35- or 60-mm plastic Petri dishes at a density of 200,000 cells/35-mm dish or 500,000 cells/60-mm dish. The experiments were initiated when cells had reached subconfluence. For the proliferation assay cells were seeded at a density of 5000 cells/well, and the experiments were started 24 hour later.
Immunoprecipitation and Western Blot Analysis
For immunoprecipitation, cell lysates were obtained using PBSTDS buffer (made up of 100 mL 10x PBS with 10 mL of 100% Triton X-100, 5 g sodium deoxycholate, and 1 g sodium dodecyl sulfate in 100 mL of deionized water) containing the aforementioned protease inhibitors. Samples corresponding to 400 µg total proteins were immunoprecipitated with 15 µL protein G Sepharose (Amersham, Arlington Heights, IL) and 1 µg c-kit antibody. After overnight incubation at 4°C on a rocker platform, the immunoprecipitates were collected by centrifugation in a microcentrifuge at 2500 rpm for 2 minutes. The supernatant was discarded, whereupon the pellet was washed four times with 1 mL PBSTDS. The material was then dissolved in sample buffer for SDS-PAGE. Protein samples (from total cell lysates) were dissolved in a sample buffer containing 0.0625 M Tris-HCl (pH 6.8), 20% glycerol, 2% sodium dodecyl sulfate (SDS), bromophenol blue, and dithiothreitol. Sample amounts of 100 µg total proteins/lane were analyzed by SDS-PAGE with a 4% stacking gel and a 10% separation gel, essentially according to the protocol of Laemmli.20 Molecular weight markers (Bio-Rad) were run simultaneously. For Western blot analysis, the proteins were transferred overnight to nitrocellulose membranes (Hybond; Amersham) and then blocked for 1 hour at room temperature in a solution of 5% (wt/vol) skimmed milk powder and 0.02% (wt/vol) Tween 20 or 2% (wt/vol) skimmed milk powder and 2% bovine serum albumin (for detection of phosphorylated proteins) in PBS (pH 7.5). Incubation with the primary antibody, directed to the human c-kit or the antibody specific for phosphorylated c-kit, was performed for 1 hour at room temperature. This was followed by three washes with PBS-Tween and incubation with a biotinylated secondary antibody (Amersham) for 1 hour. After a 45-minute incubation with streptavidin-labeled horseradish peroxidase (Amersham), detection was performed (Hyperfilm-ECL; Amersham). Protein content of cell lysates was determined by a dye-binding assay21 with a reagent purchased from Bio-Rad (Hercules, CA). Known concentrations of bovine serum albumin were used as a standard.
Cell Proliferation Assay
A cell proliferation kit was purchased from Roche Diagnostic GmbH (Mannheim, Germany). The test is based on a colorimetric change of the yellow tetrazolium salt XTT into orange formazan dye by the respiratory chain of viable cells.22 Cells seeded at a density of 5000/well in 100 µL medium in a 96-well plate for 24 hours were treated with different drugs in specified concentrations. After 48 hours, cells were incubated according to the manufacturers protocol, with an XTT labeling mixture. After 4 hours, the formazan dye was quantified with a scanning multiwell spectrophotometer with 495- and 690-nm filters as the reference. The absorbance correlates directly with the number of viable cells. To draw the standard absorbance curve, we used untreated cells seeded at concentrations from 1,000 to 10,000 cells/well with an increasing rate of 1,000 cells/well. All standards and experiments were performed in triplicate.
STI571 Treatment
STI571 was provided by Novartis Inc. Stock solutions of the drug were prepared at 10 mM in distilled sterile water and stored in working aliquots at 80°C. To study the effects of STI571 on the in vitro cell growth, cells were seeded with normal growth medium. After 24 hours, cells were changed to new fresh medium with and without increasing doses of the drug (0.110 µM). Cell growth was evaluated after 48 hours. The drug concentrations resulting in 50% inhibition of growth, compared with untreated control cells, were determined (IC50).
Immunohistochemistry
Immunostaining was performed using the standard avidin-biotin complex (ABC) technique (Elite Standard Kit, cat. PK-6100; Vector, Burlingame, CA). Deparaffinized, rehydrated sections were pretreated with microwaves for 10 minutes in 0.1 M citrate buffer at pH 6.0. Before immunostaining, the endogenous peroxidase activity was blocked by hydrogen peroxidase dissolved in methanol (3% hydrogen peroxide in methanol, 1:5 volume) for 30 minutes. Sections were then rinsed in and incubated with blocking serum (1% bovine serum albumin) for 20 minutes followed by incubation with the primary antibody overnight at 4°C. A biotinylated anti-mouse IgG was used as a secondary antibody and followed by the ABC complex. The peroxide reaction was developed using 3.3-diaminobenzidine tetrahydrochloride (DAB; 0.6 mg/mL with 0.03% hydrogen peroxide) for 6 minutes. Counterstaining was performed with Mayers hematoxylin. Tris-buffered saline (pH 7.6) was used for rinsing between the different steps. All the slides were coded and analyzed in a blinded fashion.
After tissue processing, all cells displaying distinct immunoreactivity were considered positive, irrespective of staining intensity. We assigned the results of c-kit staining as negative when no staining was present, low when less than 10%, medium when 10% to 50%, and high when more than 50% of melanoma cells were positive. These specimens were also assessed by an independent observer using the same grading system.
PCR Amplification and Sequencing Analysis
DNA was isolated from frozen uveal melanoma specimens by standard methods. We used a nested polymerase chain reaction (PCR) method to amplify genomic fragments of exon 11 using primers annealing the intronic regions that flank exon 11 of the c-kit gene. Shortly, 500 ng of genomic DNA was amplified using 5' (GTATGCCACATCCCAAGTGTT) and 3' (CCTGACAGACAATAAAAGGCAGC) primers in a 35-cycle reaction of 94°C for 30 seconds; 52°C for 45 seconds, and 68°C for 2 minutes.
For the nested PCR, the primers 5' (CGACTCGATCCCATCCTGCC) and 3' (CAAAGGAAGCCACTGGAGTTCC) were used in a 34-cycle PCR of 94°C for 30 seconds, 56°C for 45 seconds, and 70°C for 45 seconds. The PCR products were electrophoresed in a 1% agarose gel containing ethidium bromide, and visualized in a UV camera before sequencing in a DNA sequencer (Prism 310; Applied Biosystems [ABI], Foster City CA) using dye termination chemistry (Big Dye Terminator Kit; ABI).
Statistical Analysis
Survival data without loss to follow-up were obtained, in accordance with the tenets of the Declaration of Helsinki, for all patients with uveal melanoma from the Swedish National Causes of Death Registry. Time from the date of surgery to death or end of 1996 was considered censored if the patient was alive at the end of 1996 or had died of any cause that was not melanoma related. The log rank test was used to assess survival differences. Calculations were computer based (Statistica, 1999; StatSoft, Tulsa, OK; and MedCalc; MedCalc Software, Mariakerke, Belgium).
| Results |
|---|
|
|
|---|
|
|
The expression and tyrosine phosphorylation of c-kit was assessed in the three uveal melanoma cell lines OCM-1, OCM-3, and 92-1 as well as in the two cutaneous melanoma cell lines DFB and BE. Two different types of analyses were performed, one being a Western blot analysis using phosphotyrosine antibodies23 on c-kit purified by immunoprecipitation and the alternative method being direct Western blot using an antibody specific for phosphorylated c-kit. Both analyses showed phosphorylated c-kit in all uveal melanoma cell lines but hardly any signals for the cutaneous melanoma cells (Fig. 3A , top). Because both types of assays for c-kit phosphorylation worked well, Western blot analysis with antibodies to phosphorylated c-kit was used in the remaining experiments.
|
To search for a possible mechanism behind the c-kit activation of uveal melanoma, we have to consider the presence of point mutations in the KIT gene. A recent study by Pache et al.24 investigated the presence of known KIT point mutations (i.e., in exons 2, 8, 9, 11, 13, and 17) in 10 cases of uveal melanoma. However, all cases were found to be negative. Based on these results and the fact that point mutations in exon 11 represent the clearly most common (80%) mutations of the KIT gene,25 we decided to analyze only exon 11. Exon 11 is located in the cytoplasmic portion of the juxtamembrane domain, and has been shown to harbor a specific mutation implicated in ligand-independent activation of c-kit in gastrointestinal stromal tumors (GIST).26 To evaluate whether this mutation also could be involved in uveal melanoma, we analyzed exon 11 on 15 fresh frozen uveal melanoma samples as well as samples from the uveal melanoma cell lines. We used PCR to amplify genomic fragments of exon 11 of the KIT gene followed by direct sequencing. However, none of the 15 tumors, or the cell lines, exhibited point mutations in exon 11 of the KIT gene (data not shown). These results indicate that serum depletion-resistant c-kit activity in uveal melanoma involves other mechanisms.
One possible mechanism of c-kit activation in uveal melanoma might be autocrine or paracrine stimulation of the receptor. To investigate this possibility, we analyzed the expression of SCF in the three uveal melanoma cell lines compared with cutaneous melanoma cells. Figure 3B shows that all three uveal melanoma cell lines expressed the 31-kDa variant of SCF. The expression level was independent of the absence of serum in culture medium. In contrast, SCF was not detectable in the cutaneous melanoma cells (Fig. 3B) .
Fig. 3C , top, shows the Western blot of different doses of STI571 on c-kit phosphorylation of OCM-1. These experiments were made under basal conditions (i.e., the cells were growing in complete medium containing 10% serum). This procedure was used, because it will allow comparison of IC50 for c-kit phosphorylation and cell proliferation. The densitometry data for all three cell lines are illustrated in Figure 3C , bottom. IC50 ranged from 0.8 to 2.5 µM.
To examine the anti-proliferative effects of STI571 on the uveal melanoma cells lines, OCM-1, OCM-3, and 92-1, were incubated with different concentrations of the drug for 48 hours, after which the level of cell proliferation was assayed. Figure 4 shows the doseresponse of OCM1, OCM-3, and 92-1. There was a drastic cell loss even at low concentrations. The IC50 values were calculated to 0.15, 0.5, and 1.25 µM for the OCM3, OCM1, and 92-1 cells, respectively, and to more than 10 µM for BE and DFB. We can conclude that STI571 doses of 2.5 µM or less reduce both c-kit phosphorylation and cell proliferation of uveal melanoma cells 50% or more. In other words, both effects correlate well with each other.
|
| Discussion |
|---|
|
|
|---|
c-Kit expression has been documented in a wide variety of human malignancies, and the kinase activity has been implicated in the pathophysiology of a number of these tumors, including GISTs, neuroblastoma, and cutaneous melanoma.
In cutaneous melanoma c-kit has been shown to be expressed in epidermal melanocytes but is lost in cells infiltrating the dermis.28 Even if c-kit seems to be downregulated during the development of normal melanocytes to melanoma with metastasizing potential, there is no evidence that c-kitnegative cells feature mutations in the KIT gene or in its promoter.29 30 In contrast, among tumors expressing c-kit, gain-of-function mutations have been found in mastocytosis,31 seminomas,32 the catalytic tyrosine kinase domain, and in GISTs33 34 in the regulatory juxtamembrane domain. Because all these neoplasms arise in tissues with development that is dependent on the activity of the SCF/c-kit axis, aberrant activation of this axis may be of pathogenic impact.
We demonstrated in this study by both IHC and Western blot analysis that c-kit is expressed in a large amount of uveal melanomas. When the results from the 134 IHC cases were correlated to clinical follow-up data there was no significance between c-kit expression and survival. The study of Mouriaux et al.15 did not find any significant correlation, either.
When sequencing 15 uveal melanoma samples, however, we could not find any mutations in them. These data are in concordance with recently published data by Pache et al.24 In contrast, we could detect expression of SCF in all three analyzed uveal melanoma cell lines, but not in cutaneous melanoma cells. These results indicate that c-kit expression and activity in uveal melanoma may involve autocrine and/or paracrine stimulation of the receptor by SCF. Such a mechanism of c-kit activation has been thought to play a role in small cell lung cancer.35 Further analysis to evaluate the potential role of autocrine stimulation of c-kit in uveal melanoma is currently under way.
STI571 is a phenylamino-pyrimidine that selectively inhibits proto-oncogenic and oncogenic forms of ABL, PDGFR, and c-kit tyrosine kinases.11 In the case of chronic myelogenous leukemia, the drug inhibits kinase activity of the BCR-ABL fusion gene product, and in GISTs it inhibits the Kit tyrosine kinase. STI571 is conveniently administered as a once-daily oral medication and is well tolerated.36 37
We found that growth of uveal melanoma cells was relatively sensitive (IC50 < 1.25 µM) to STI571. Of particular interest was the fact that the sensitivity of the c-kit kinase was of similar size (IC50 < 2.5 µM). This situation was also found in chronic myelogenous leukemia and GIST cell lines38 39 and suggests that growth and survival of uveal melanoma is dependent on c-kit activation and consequently highlights a possible therapeutic benefit of STI571 in patients with uveal melanoma. Because the maximum tolerated dose (close to 1000 mg/d) of imatinib mesylate (STI571) in phase I trials corresponded to a blood level of 6 to 10 µM our IC50 of 0.15 to 1.25 µM regarding antiproliferative effects on uveal melanoma cells may be relevant for obtaining antitumor effects in patients.40
It is interesting to note that Fiorentini et al.41 reported some tumor-reducing effects of STI571 on uveal melanoma metastases expressing immunohistochemical c-kit in two patients at the terminal stage of disease.
Because STI571 also inhibits the tyrosine kinase of PDGFR
and -ß,42 the possibility is raised that it could also interfere with PDGFR and other kinases (e.g., Abl) in uveal melanoma. Actually, a preliminary study in our laboratory has shown expression of PDGFRs in some uveal melanoma cell lines and samples (Müller-Brunotte et al., manuscript in preparation). However, our present observations that the IC50 of STI571 for c-kit phosphorylation and proliferation of uveal melanoma cells are in the same range of magnitude (<2.5 µM) suggest that c-kit inhibition is the main cause of the antiproliferative effects on this cell type.
| Footnotes |
|---|
Supported by grants from the Gustaf V Jubilee Fund, the Swedish Cancer Society, and the Karolinska Institute.
Submitted for publication November 2, 2003; revised February 4, 2004; accepted March 12, 2004.
Disclosure: C. All-Ericsson, Novartis Inc. (F); L. Girnita, None; A. Müller-Brunotte, None; B. Brodin, None; S. Seregard, None; A. Östman, None; O. Larsson, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Olle Larsson, CCK R8:04, Karolinska Hospital, S-171 76 Stockholm, Sweden; olle.larsson{at}onkpat.ki.se.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
N. Babchia, A. Calipel, F. Mouriaux, A.-M. Faussat, and F. Mascarelli The PI3K/Akt and mTOR/P70S6K Signaling Pathways in Human Uveal Melanoma Cells: Interaction with B-Raf/ERK Invest. Ophthalmol. Vis. Sci., January 1, 2010; 51(1): 421 - 429. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. SVIATOHA, R. KLEINA, E. TANI, and L. SKOOG Expression of the CD117, COX-2 and HSP90 Antigens and Cell Proliferation in Fine-needle-aspirated Cells from Metastatic Melanomas Anticancer Res, November 1, 2009; 29(11): 4345 - 4352. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Daniels and D. H. Abramson c-KIT in Uveal Melanoma: Big Fish or Red Herring? Arch Ophthalmol, May 1, 2009; 127(5): 695 - 697. [Full Text] [PDF] |
||||
![]() |
G. Lefevre, N. Babchia, A. Calipel, F. Mouriaux, A.-M. Faussat, S. Mrzyk, and F. Mascarelli Activation of the FGF2/FGFR1 Autocrine Loop for Cell Proliferation and Survival in Uveal Melanoma Cells Invest. Ophthalmol. Vis. Sci., March 1, 2009; 50(3): 1047 - 1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. B. Hofmann, C. S. Kauczok-Vetter, R. Houben, and J. C. Becker Overexpression of the KIT/SCF in Uveal Melanoma Does Not Translate into Clinical Efficacy of Imatinib Mesylate Clin. Cancer Res., January 1, 2009; 15(1): 324 - 329. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Economou, S. Andersson, D. Vasilcanu, C. All-Ericsson, E. Menu, A. Girnita, L. Girnita, M. Axelson, S. Seregard, and O. Larsson Oral Picropodophyllin (PPP) Is Well Tolerated In Vivo and Inhibits IGF-1R Expression and Growth of Uveal Melanoma Invest. Ophthalmol. Vis. Sci., June 1, 2008; 49(6): 2337 - 2342. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J Barry, L. R de Moura, J.-C. Marshall, B. F Fernandes, M. E. Orellana, E. Antecka, C. Martins, and M. N Burnier Expression of C-kit in retinoblastoma: a potential therapeutic target Br J Ophthalmol, November 1, 2007; 91(11): 1532 - 1536. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Strumberg, J. W. Clark, A. Awada, M. J. Moore, H. Richly, A. Hendlisz, H. W. Hirte, J. P. Eder, H.-J. Lenz, and B. Schwartz Safety, Pharmacokinetics, and Preliminary Antitumor Activity of Sorafenib: A Review of Four Phase I Trials in Patients with Advanced Refractory Solid Tumors Oncologist, April 1, 2007; 12(4): 426 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Economou, C. All-Ericsson, V. Bykov, L. Girnita, A. Bartolazzi, O. Larsson, and S. Seregard Receptors for the Liver Synthesized Growth Factors IGF-1 and HGF/SF in Uveal Melanoma: Intercorrelation and Prognostic Implications Invest. Ophthalmol. Vis. Sci., December 1, 2005; 46(12): 4372 - 4375. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |