IOVS Molecular Human Reproduction
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2005;46:88-95.)
© 2005 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.04-0833

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vij, N.
Right arrow Articles by Chakravarti, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vij, N.
Right arrow Articles by Chakravarti, S.

Lumican Regulates Corneal Inflammatory Responses by Modulating Fas-Fas Ligand Signaling

Neeraj Vij,1,2 Luke Roberts,1 Sarah Joyce,1 and Shukti Chakravarti1,3,4

1From the Departments of Medicine, 3Cell Biology, and 4Ophthalmology, Johns Hopkins University, Baltimore, Maryland.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. The authors have previously shown that apoptosis of stromal cells is downregulated in the lumican-null mouse and that this may be due to disruption of Fas-Fas ligand (FasL) signaling. The present study was undertaken to investigate the role of lumican in regulating Fas and its impact on inflammation and healing of corneal injuries.

METHODS. Apoptosis was determined by measuring caspase-3/7 activity in corneal extracts. Protein and RNA levels of Fas were estimated by immunoblot analysis and RT-PCR, respectively. Circular and incisional stromal wounds were exposed to Pseudomonas aeruginosa LPS, and healing was assessed by (1) observing wound closure with fluorescence and bright-field microscopy, (2) histology to quantify inflammatory infiltrates by immunostaining for macrophages (F4/80) and neutrophils (NIMP-R14), (3) measuring myeloperoxidase (MPO) levels by ELISA to quantify neutrophils, and (4) measuring proinflammatory cytokines by ELISA.

RESULTS. Lum–/–-injured corneas showed significantly lower caspase-3/7 activity (apoptosis). Lum–/–-wounded corneas showed delayed healing, reduced recruitment of macrophages and neutrophils, lower MPO levels, and no induction of the proinflammatory cytokines TNF{alpha} and IL1ß. The Fas protein level, before and after wounding, was dramatically lower in Lum–/–- compared with Lum+/+-injured cornea. However, Fas mRNA levels were comparable in both genotypes, suggesting regulation of Fas at the protein level. Moreover, a solid-state binding assay and coimmunoprecipitation of FasL and lumican suggested binding of FasL to lumican.

CONCLUSIONS. The data suggest that lumican binds FasL and facilitates induction of Fas. Poor signaling through Fas-FasL in lumican deficiency leads to impaired induction of inflammatory cytokines and corneal healing.


The cornea is a specialized, avascular, transparent, barrier connective tissue that provides 75% of the refractive power of the eye.1 The bulk of the cornea is its stroma, comprising an extracellular matrix of intricately balanced amounts of hydrated fibrillar collagens and proteoglycans. Lumican, a member of the small leucine-rich proteoglycan (SLRP) gene family, is the most abundant keratan sulfate proteoglycan in the corneal stroma. Keratocan and mimecan/osteoglycin are two other keratan sulfates, and decorin is the major dermatan sulfate proteoglycan in the cornea.2 3 Studies of the structure of the corneal stroma over the past several decades indicate a role for these proteoglycans in regulating the collagen fibril structure and interfibrillar spacing that are conducive to optimal vision. Studies focusing on the core proteins have demonstrated their binding to fibrillar collagen, limiting lateral growth of fibrils in vitro.4 Consistent with the in vitro studies, a major functional consequence of a gene-targeted null mutation in lumican is the presence of thick and disorganized collagen fibrils and corneal opacity.5 6 To maintain the cornea as an optically transparent barrier, a sophisticated process is in place to balance inflammation and immune privilege.7 Our recent studies are beginning to support a key role for the lumican core protein in this process. It is conceivable that the other SLRP core proteins may have similar functions in the cornea.

Approximately 40 kDa in size, the SLRP core proteins contain 6 to 10 leucine-rich repeat (LRR) motifs that interact with collagens. These LRR motifs are biologically very active and are the likely site of interactions with a vast number of other proteins with currently unknown biological implications. There are several forms of under-glycosaminoglycanated lumican that gain prominence in newly synthesized corneal extra cellular matrix (ECM) and other noncorneal tissues where these novel core-protein interactions are likely to have additional functions.8 9 Beyond regulating collagen architecture, lumican influences such cellular functions as injury-related epithelial-mesenchymal transition,10 cell proliferation, and apoptosis.11 In our earlier study, we detected a marked decrease in apoptosis in cultured cells and the corneal stroma of lumican-null mice. There was also a significant downregulation in the Fas receptor. Because Fas-Fas ligand (FasL) signaling is a major regulator of programmed cell death, we hypothesized that Fas-FasL–mediated apoptosis is downregulated in lumican deficiency, primarily due to disruption of the Fas signal-transduction pathway in which lumican serves a critical function.11 The Fas-FasL pathway has a special significance in corneal immune privilege. Interaction between Fas+ lymphoid cells invading the stroma and FasL is believed to trigger their apoptosis and limit inflammation.7 Recent studies have unraveled implications of Fas signaling beyond apoptosis: in inducing proinflammatory cytokines and in initiating and amplifying inflammatory responses.12 13 14 15 16

In light of these current findings on Fas, we hypothesize that lumican modulates inflammatory responses in corneal wound healing by regulating Fas-FasL signaling. In the current study, the healing of bacterial LPS-mediated corneal injury was remarkably delayed in the lumican-null mouse. This phenomenon is associated with scant recruitment of neutrophils and macrophages at the wound site and poor induction of inflammatory cytokines.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animal
The mice were housed in a pathogen-free facility according to policies approved by the Animal Care Committee, Johns Hopkins University, and were treated in accordance with the tenets of the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

Stromal Wounding and In Vivo Microscopy of Cornea
Mice were anesthetized by intramuscular injection of ketamine hydrochloride (30 mg/kg) and xylazine hydrochloride (5 mg/kg). In addition, topical proparacaine hydrochloride 0.5% (Bausch & Lomb Pharmaceuticals, Inc., Tampa, FL) was applied to each eye just before surgery. To examine inflammatory infiltrates in injured corneas by immunostaining, incisional wounds were made in the stroma with a 26-gauge needle. To measure apoptosis and induction of cytokines in injured corneas, circular stromal wounds were made using an Algerbrush II (0.5 mm; Alber Equipment Co., Lago Vista, TX). Wounded corneas (incisional and circular) were inoculated with 1 µL (10 µg/µL) Pseudomonas aeruginosa LPS with a syringe (Hamilton, Reno, NV). Fluorescein sodium benoxinate hydrochloride ophthalmic solution (Bausch & Lomb Pharmaceuticals, Inc.) was used to detect healing with a 4',6'-diamino-2-phenylindole (DAPI) filter on a dissection microscope. In addition, wound size was observed by bright-field microscopy using an external light source on a dissection microscope at 0, 8, 24, 48, and 72 hours after wounding. Images were captured by a microscope equipped with a digital camper (Axiovert 135-N from Carl Zeiss Meditec, Dublin, CA; Quantix 1401 charge-coupled device camera from Photometrix, Tucson, AZ; IP Laboratory software ver. 3.9.1; Scanalytics, Inc.).

Assay for Caspase-3/7 Activity
Apoptosis in the cornea was measured with a homogeneous caspase-3/7 assay (Apo-ONE; Promega, Madison, WI). Lum+/+ and Lum–/– corneal protein extracts (n = 3) were prepared in tissue protein extraction reagent (T-PER; Pierce, Rockford, IL), 24 hours after circular stromal wounding. Caspase-3/7 activity was measured after incubating corneal extracts on a 96-well plate with caspase-3/7 substrate at room temperature (300 rpm) for 18 hours. Fluorescence recorded at an excitation wavelength of 480 nm and an emission wavelength of 530 nm (Spectra Max Plus reader and SoftMaxPro ver.4.0 software, Molecular Devices, Sunnyvale, CA) x1000, relative fluorescence units (RFLU), was expressed as caspase-3/7 activity.

Immunofluorescence Staining
Six-week-old Lum+/+ and Lum–/– mice (n = 3 per genotype) were euthanatized with CO2, followed by cervical dislocation. Whole eyes were fixed in 1 mL 10% neutral buffered formalin for 4 to 6 hours (Fisher Scientific, Pittsburgh, PA), embedded in paraffin, sectioned, and prepared for immunostaining, as described previously.5 17 Macrophages and neutrophils were immunostained with the rat monoclonal F/480 (2 µg/mL) or NIMP-R14 (8 µg/mL) primary antibody (Abcam, Inc., Cambridge, UK), respectively, followed by a secondary goat anti-rat Alexa Fluor 568, 5 µg/mL (Molecular Probes, Eugene, OR) antibody. Negative controls consisted of identical treatments with the omission of the primary antibody. Hoechst dye, 1 µg/mL (Molecular Probes) was used for nuclear staining. The slides were then mounted (Vectashield; Vector Laboratories Inc., Burlingame, CA), and images were captured with the equipment described earlier, with appropriate filter settings for Texas red and DAPI. F/480- and NIMP-R14-positive cells were counted in 10 uniform fields (n = 3), and the average number of positive cells at each time point was calculated.

Cell Culture and Transfection
Primary cultures of corneal fibroblasts (CFs) were derived from Lum+/+ and Lum–/– corneas and maintained as described previously.11 Human lumican cDNA clone pSecTag2/rhlum was used for transfections.11 Lum+/+ and Lum–/– CFs were transfected in 100-mm dishes with 40 µg of the vector pSecTag2/rhlum or the mock vector (pSecTag2), using 2 M CaCl2 (Invitrogen, Carlsbad, CA). After 48 hours of transfection, total protein extracts were prepared from transfected cells using M-PER, mammalian protein extraction reagent (Pierce).

RNA Isolation and RT-PCR
Total RNA was isolated from the CFs (TRIzol reagent; Invitrogen). ß-Actin and Fas were amplified with the following primers: forward (F)-ß-actin, gtgaaaagatgacccagatcat; reverse (R)-ß-actin, gcttctctttgatgtcacgcacga; F-Fas, atgcacactctgcgatgaag and R-Fas, ttcagggtcatcctgtctcc.

Immunoblot Analysis and Immunoprecipitation
Total protein extracts were prepared from corneal fibroblasts and cornea (M-PER and T-PER; Pierce, respectively). Protein extracts were resolved by SDS-PAGE followed by immunoblot analysis with antibodies against actin, Fas, or FasL (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). To examine the binding of lumican to FasL, we incubated two aliquots of 800 µg/mL total corneal protein extract with 50 µL of protein A/G agarose beads (Santa Cruz Biotechnology, Inc.) for 3 hour at 4°C. After preclearing, 5 µL of 1 mg/mL mouse lumican antibody6 was added to one tube, and 5 µL of preimmune serum was added to the other tube (negative control). Protein A/G agarose beads (50 µL) were added to each tube after 1 hour, followed by overnight incubation at 4°C. Beads were washed once with lysis buffer (20 mM Tris-HCl [pH 7.6], 150 mM NaCl, 0.5% Triton X-100 and 10 µM phenylmethylsulfonyl fluoride [PMSF]) followed with two washes with PBS. The samples were suspended in Laemmli’s sample buffer (30 µL), vortexed for 1 minute, centrifuged for 5 minutes at 10,000g, and boiled for 5 minutes. The supernatants and total corneal protein extracts (as a positive control) were then resolved by SDS-PAGE and transferred to a 0.2-µm pore size polyvinylidene difluoride (PVDF) membrane. FasL protein was detected with a FasL antibody recognizing the C-terminal region of FasL.

Solid State Binding Assay
Flat-bottomed microtiter plates were precoated with increasing concentrations of recombinant FasL (R&D Systems, Minneapolis, MN) or BSA (0, 0.2, 0.4, 0.8, 1.6, 3.2, 6.4, 12.8 µg/mL), and the remaining binding sites were blocked with 0.1% BSA. Recombinant FasL contains the extracellular region of human FasL (amino acid residues 132–279) fused to the signal peptide of human CD33 and six histidine residues. Recombinant human lumican (10 µg/mL), prepared as described earlier,11 was incubated on immobilized Fas-L/BSA for 1 hour at 37°C in 5% CO2 and then washed gently. The binding of lumican to FasL or BSA was detected with an anti-human lumican antibody and peroxidase-conjugated goat anti-rabbit IgG. The plates were washed and incubated in the dark with tetra-methylbenzidine substrate for 15 minutes. The reaction was stopped with 2.5 N sulfuric acid, and the plates read at 450 nm (Spectra Max Plus reader; Molecular Devices; and SoftMaxPro ver. 4.0 software). Mean blank absorbance was subtracted from each reading.

Myeloperoxidase Assay
To obtain a quantitative estimate of neutrophils in the cornea, a myeloperoxidase (MPO) sandwich ELISA assay18 was performed (OxisResearch; Oxis Health Products, Inc., Portland, OR) on wounded and unwounded corneal extracts. Lum+/+ and Lum–/– corneas (n = 5) were wounded and exposed to LPS; and, 24 hours after injury, corneas were dissected, weighed, and homogenized as described earlier. For the ELISA, antigen captured by a solid-phase monoclonal antibody was detected with a biotin-labeled goat polyclonal anti-MPO antibody and avidin-conjugated alkaline phosphatase followed by its substrate p-nitrophenyl phosphate (pNPP). The product (p-nitrophenol) was detected at 405 nm (Spectra Max Plus reader; Molecular Devices; SoftMaxPro ver. 4.0 software). Purified MPO (standard) was included as a positive control.

Cytokine Profiling
Corneas, unwounded or 24 hours after wounding, were collected from 6-week-old Lum+/+ and Lum–/– mice and homogenized in 20 µL of extraction solution (T-PER; Pierce) per milligram of cornea. These corneal extracts were used for cytokine quantification in TNF{alpha}, IL-1ß, and IL-6 solid-phase sandwich ELISAs, as specified by the manufacturer (BioSource International, Inc., Camarillo, CA). Standards and high and low cytokine controls were included. The mean blank reading was subtracted from each sample and control reading.

Statistical Analysis
Student’s t-test (probabilities) was run for comparison of Lum+/+ and Lum–/– samples, using one-tailed distribution between two samples with equal variance. A P value ≤0.05 was considered to have statistical significance.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Apoptosis in Wild-Type and Lumican-Null Corneas
Stromal incisional wounds were generated in 6-week-old Lum+/+ and Lum–/– mice to induce apoptosis, and caspase-3/7 activity was measured to assess it (n = 5 animals per genotype). Caspase-3/7 activity was significantly lower (P < 0.001) in the lumican-null corneas than in their wild-type counterparts 24 hours after wounding (Fig. 1) . These results clearly indicate a downregulation of programmed cell death in the lumican-deficient injured cornea. The finding is consistent with our prior observation that lumican-null fibroblasts and corneal keratocytes have reduced apoptosis when compared with the wild-type.11



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 1. Lower caspase-3/7 activity indicating reduced apoptosis in Lum–/– corneal extracts. Caspase-3/7 activity was measured in Lum+/+ and Lum–/– (n = 3) corneal extracts (CE), 24 hours after circular stromal wounds were generated. Caspase-3/7 activity was significantly lower (P < 0.001) in the Lum–/– mouse corneal extracts compared with wild type.

 
Wound Healing in Wild-Type and Lumican-Null Cornea
Apoptosis of stromal cells is a major early event in wound healing. Furthermore, during infection and injury, apoptosis of invading inflammatory cells is important in the inflammation and healing cascade. Therefore, to determine how reduced apoptosis affects corneal healing in the lumican-null mouse, we generated circular stromal wounds injected with P. aeruginosa LPS in five Lum+/+ and Lum–/– mice, and observed the wound healing from 0 to 72 hours. One representative animal of each genotype is shown in Figure 2 . Wild-type corneas healed faster and recovered completely by 72 hours. In contrast, the healing of lumican null corneas was delayed significantly. Starting with circular wounds of similar size, by 24 hours, the size of wounds in wild-type corneas was reduced to half their original diameters, whereas those in Lum–/– corneas remained unchanged (Fig. 2) .



View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 2. Corneal wound healing in wild-type and Lum–/– cornea. Wounded Lum+/+ and Lum–/– corneas were exposed to LPS. The unwounded contralateral eye treated with saline served as a control. Fluorescein dye (green; top) was used to detect wound healing using a DAPI filter on a dissection microscope. Corneas were also checked by bright-field microscopy, using an external light source on a dissecting microscope (bottom). Wild-type corneas healed faster and recovered completely by 72 hours, whereas lumican-null corneas showed a significant delay in healing.

 
Macrophage and Neutrophil Infiltration in Wild-Type and Lumican-Null Corneas
To test the possibility that delayed wound healing in lumican-nulls is due to altered inflammatory responses, we examined the infiltration of macrophages and neutrophils in Lum+/+ and Lum–/– corneas (n = 3), at 4, 8, and 24 hours after producing stromal incision wounds. Unwounded corneas were used as the control. Wounded and unwounded Lum+/+ and Lum–/– corneal sections were immunostained for macrophages (F4/80) and neutrophils (NIMP-R14). We observed no significant difference in the number of macrophages and neutrophils in Lum+/+ and Lum–/– corneas at 4 and 8 hours after injury (Figs. 3 4) . However, by 24 hours after injury, there was a significant (P = 0.05) increase in the number of macrophages in wild-type (43.67 ± 4.05) versus lumican-null (33.00 ± 3.21) corneas (Fig. 3) . At this time point, the number of neutrophils in Lum+/+ corneas (35.34 ± 2.85) was also significantly (P < 0.05) higher than that in injured lumican-null (23.67 ± 3.48) corneas (Fig. 4) .



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 3. Macrophage infiltration of the corneal stroma after injury. Lum+/+ and Lum–/– corneas were wounded by stromal incision and exposed to LPS. Unwounded corneas treated with saline were used as controls. Eyes were removed at 4, 8, and 24 hours after injury, sectioned, and immunostained with F/480 antibody. The number of macrophages in each section was determined by counting F/480 positive cells in 10 independent fields under 40x magnification. Lumican-null corneas showed significant reduction in macrophage infiltration compared with wild type, 24 hours after LPS wounding. Data are the mean ± SEM of measurements in three mice per group (*P = 0.05).

 


View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. Neutrophil infiltration of the corneal stroma after injury. Wounded Lum+/+ and Lum–/– corneas were exposed to LPS. The unwounded contralateral eye treated with saline served as a control. Eyes were removed, sectioned, and immunostained for neutrophils with NIMP-R14 antibody at 4, 8, and 24 hours after wounding. Neutrophils were counted in ten independent fields at 40x magnification. In the LPS-wounded series, at the 24-hour time point, the number of neutrophils in the Lum+/+ corneas was significantly higher than in the Lum–/– corneas. Data are the mean ± SEM of measurements in three mice per group (*P < 0.05).

 
We next measured MPO levels in unwounded and wounded corneas to obtain a quantitative estimate of activated neutrophils. We found a significant (P < 0.01) quantitative increase in activated neutrophils in Lum+/+ wounded (0.37 ± 0.06) corneas compared with unwounded (0.16 ± 0.02) corneas. In contrast, there was no significant difference in MPO levels between Lum–/– wounded and unwounded corneas (Fig. 5) .



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 5. MPO assay. Wounded and unwounded Lum+/+ and Lum–/– corneas (n = 5) were exposed to LPS and saline, respectively. After 24 hours, corneal protein extracts were used in an MPO assay. Wounded lumican-null corneas had significantly lower levels of MPO than did wild-type corneas. Moreover, wild-type corneas showed significant induction of MPO after stromal wounding, whereas lumican-null corneas showed no induction (*P < 0.01).

 
Proinflammatory Cytokine Levels in Wild-Type and Lumican-Null Corneas
To determine whether the observed difference in wound healing and inflammation in the Lum+/+ and Lum–/– cornea is due to a difference in the induction of proinflammatory cytokines, we evaluated TNF{alpha}, IL-1ß, and IL-6 levels by ELISAs in wounded corneas exposed to 10µg/mL of LPS. Unwounded corneas were used as the control. By 24 hours after wounding, there was a significant increase in the levels of TNF{alpha} (Fig. 6A) , IL-1ß (Fig. 6B) , and IL-6 (Fig. 6C) in the wild-type corneas. In the Lum–/– wounded corneas, induction of TNF{alpha} (Fig. 6A) or IL-1ß (Fig. 6B) was not significant, and increase in IL-6 was modest (Fig. 6C) . Induction of TNF{alpha} and IL-1ß are immune responses that seem to require lumican, and were disrupted in the Lum–/– mice.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 6. Cytokine levels in wild-type and lumican-null corneas. Wounded and unwounded Lum+/+ and Lum–/– corneas (n = 3) were exposed to LPS and saline, respectively. After 24 hours, corneal proteins were extracted for cytokine ELISA. Wounded lumican-null corneas showed significantly lower induction of TNF{alpha} (A), IL-1ß (B), and IL-6 (C) than did wild-type corneas (*P < 0.01).

 
Lumican Modulation of Fas-Mediated Signaling
Given that proinflammatory cytokines are not induced optimally in the wounded lumican-null cornea, the obvious question is what signaling mechanisms are affected by lumican. Based on our earlier study, we know that Fas is downregulated in the cornea and in fibroblast cultures of Lum–/– mice.11 Moreover, Fas ligation on macrophages enhances an LPS-induced inflammatory response.19 This suggests a connection between disrupted Fas signaling in Lum–/– corneas and reduced induction of the proinflammatory cytokines, TNF{alpha} and IL-1ß. To test this connection, we assayed for Fas levels in Lum+/+ and Lum–/– corneal fibroblasts (CFs) after treating cells with increasing doses of LPS. Fas levels increased in wild-type CFs, whereas it remained at basal levels in Lum–/– CFs (Fig. 7A) . Similarly, in vivo, Fas remained at basal levels in wounded and LPS-exposed Lum–/– corneas but increased markedly on similar treatment of Lum+/+ corneas (Fig. 7B) . To confirm that the lack of Fas induction in lumican-nulls is indeed due to lumican deficiency and not an unforeseen change resulting from the targeting of the lumican gene, we determined the effect of the expression of recombinant lumican protein on Fas levels. Expression of recombinant lumican in Lum–/– CFs restored Fas to the basal level recorded in Lum+/+ CFs, confirming a requirement of the lumican core protein in maintaining Fas levels. In wild-type CFs, expression of recombinant lumican also resulted in an increase in Fas. The mock control vector affected an increase in Fas as well (Fig. 7C) . The latter may simply be a Fas-pathway–mediated cellular immune response to exogenous vector DNA in wild-type cells. With Fas signaling disrupted in Lum–/– cells, this response to the mock vector was not seen in the Lum–/– CFs.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 7. Lumican-modulated Fas-mediated signaling. (A) Treated with increasing concentrations of LPS (0–100 ng/mL) for 24 hours, CFs from Lum+/+ but not Lum–/– mice showed an increase in Fas protein levels. Immunoblot analysis of actin indicated the equivalent loading of lanes. (B) Corneal wounds were exposed to LPS (10 µg), and total protein was extracted 24 hours later. Unwounded saline-treated corneas were extracted and used as the control. Immunoblot analysis for Fas showed increased levels in Lum+/+ extracts after LPS wounding, with no change in the extremely low levels of Fas in Lum–/– extracts. Immunoblot analysis of actin indicates the equivalent loading of lanes. (C) Lum–/– CFs transfected with lumican expression vector (pSecTag2/rhlum) reactivated Fas expression. Immunoblot analysis of actin indicates the equivalent loading of lanes. (D) Lum+/+ and Lum–/– corneas showed similar levels of Fas transcripts by RT-PCR. ß-Actin was used as the internal control.

 
To determine whether the differential induction of Fas in wild-type and Lum–/– mice occurs due to transcriptional regulation, we evaluated Fas mRNA levels in Lum+/+ and Lum–/– corneas by RT-PCR. The results indicate comparable levels of Fas mRNA in both genotypes, ruling out its regulation at the RNA levels (Fig. 7D) .

Lumican-FasL Binding
We have recently shown that FasL can induce Fas in Lum+/+ mouse embryonic fibroblasts (MEFs). However, Fas was not induced in Lum–/– MEFs, indicating that a presence of lumican is obligatory for FasL-mediated induction of Fas.11 We hypothesize that lumican binds to FasL and helps in its concentration and presentation to Fas. Indeed, immunoprecipitation of lumican from corneal extracts, using an antibody against lumican, coimmunoprecipitated FasL (Fig. 8) . We further confirmed the binding of lumican to FasL by a solid-state binding assay. Incubation of an excess of lumican in 96-wells coated with increasing amounts of immobilized soluble (s)FasL (0–12.8 µg/mL) resulted in an sFasL dose-dependent increase in binding of lumican, with no difference in binding to increasing doses of BSA control (Fig. 9) .



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 8. Coimmunoprecipitation of FasL with lumican antibody. Preimmune serum and anti-lumican immunoprecipitates were loaded in lanes 2 and 3, respectively. Total corneal protein extract was loaded in lane 1 as a positive control. Immunoblot analysis was performed with FasL antibody. Lumican antibody coimmunoprecipitated FasL (lane 3) and lumican from corneal extracts (CEs), whereas serum did not (lane 2).

 


View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 9. A solid-state binding assay showed binding of FasL to lumican. Recombinant lumican (10 µg/mL) was incubated with increasing concentrations of immobilized FasL or BSA (0–12.8 µg/mL) at 37°C. Recombinant lumican bound to FasL was detected with an anti-lumican antibody. The results show increased binding of lumican to increasing amounts of immobilized FasL but not to the BSA control (*P < 0.01).

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In an earlier study, we detected increased cell proliferation and decreased apoptosis in lumican-null mouse corneas and cultured fibroblasts, establishing a direct role for lumican in suppressing proliferation and aiding apoptosis.11 Cellular apoptosis and proliferation are key events during corneal wound healing,20 which prompted us to investigate further the healing of stromal injury in lumican-null mice. Our present study indicates that whereas corneal wounds healed completely by 72 hours in wild-type animals, wounds failed to heal in lumican-null corneas during the same time frame. There was a marked difference in the recruitment of inflammatory cells, with the appearance of fewer macrophages and neutrophils in the stroma of injured Lum–/– corneas. Lower MPO levels in the lumican-null corneas further confirmed a lack of neutrophil activation in the absence of lumican. Furthermore, when measuring proinflammatory cytokines in corneal extracts before and after injury, we saw very little induction of TNF{alpha} and IL-1ß in Lum–/– corneas after stromal injury. A low proinflammatory cytokine milieu in lumican-nulls may explain poor recruitment of inflammatory infiltrates at wound sites and a consequent delay in healing.

Our results clearly underscore a role for lumican in the interstitial ECM in establishing inflammation and healing of stromal injuries. The question, of course, is how lumican from the ECM communicates with cells to regulate inflammatory responses. An earlier finding that macrophages express a cell-surface receptor for lumican is certainly a piece of the puzzle and is consistent with our findings that lumican-null corneas fail to recruit wild-type levels of macrophages and neutrophils on injury.21 However, little else is known about the nature of this interaction between lumican and macrophages/monocytes. Beyond poor recruitment of inflammatory cells, there is a broad proinflammatory cytokine deficiency. This suggests that additional steps have gone awry in establishing inflammation and repair in the injured Lum–/– cornea. From our earlier study we know that Fas is downregulated in lumican-null fibroblasts and in the cornea. This suggests cross talk between lumican and Fas-FasL signaling.11 We speculate that this connection between Fas and lumican has a hand in the regulation of inflammatory responses.

Although Fas is best known for its involvement in regulation of apoptosis,22 Fas ligation may contribute to nonapoptotic signaling, including NF{kappa}B activation,23 24 25 early T-cell development,26 and proliferation.27 FasL, a death-inducing molecule and a natural ligand of Fas, is involved in homeostasis, self-tolerance, and immune privilege.28 FasL also has proinflammatory functions,29 and the ligation of Fas to circulating monocytes and tissue macrophages may induce proinflammatory cytokine responses that can induce and initiate inflammatory responses.12 The Fas-induced monocyte/macrophage response may be a key event in innate immune responses contributing to the pathogenesis of a variety of clinically important inflammatory diseases. Fas-FasL interactions may contribute to disease pathogenesis and progression of chronic inflammation by a unique mechanism (FADD-MyD88 interaction), whereby Fas ligation promotes activation through IL-1R1 and TLR4 pathways.19 Our findings showed that treatment of Lum+/+ CFs with P. aeruginosa LPS resulted in the induction of Fas in wild-type but not in Lum–/– mice. In addition, LPS injected stromal wounds in wild-type, but not in lumican-null, corneas express Fas. These results suggest that lumican plays a key role in the Fas-FasL signaling involved in corneal injury and inflammatory intermediates required in the initial counteraction of injury and infection. Another study indicated transient expression of lumican in the wounded corneal epithelium, where it was considered to aid epithelial migration.30 In fact, in the injured epithelium, lumican expression may primarily affect induction of proinflammatory cytokines rather than cellular migration.

To get a mechanistic insight in the regulation of Fas levels by lumican, we tested the possibility that Fas is regulated at the mRNA level. The RT-PCR results indicating equivalent mRNA levels eliminate the possibility that Fas mRNA is downregulated in the Lum–/– mouse cornea. Consequently, the increase in Fas levels must be due to its regulation at the protein level. In the Lum–/– mouse, FasL fails to elicit an increase in the receptor level, implying a lack of communication between the ligand and its receptor. We reasoned that lumican may be involved in concentrating and presenting FasL to its receptor Fas for appropriate induction, and we further investigated the binding of lumican to FasL.11 Coimmunoprecipitation of lumican and FasL and solid state binding assay provide evidence for lumican-FasL interactions. Released from the membrane bound form of FasL (mFasL) by a putative metalloproteinase, the capacity of sFasL to induce apoptosis is much lower than that of mFasL, which is believed to be the functional form.31 32 sFasL, in contrast, reportedly induces tumor cell33 and hepatocyte apoptosis.34 This discrepancy could arise from disparate effects of sFasL in tissues, where it may reside bound to different ECM components retaining much of the functions attributed to mFasL.35 Thus, fibronectin was reported to bind soluble FasL (sFasL), which retained effector T cells at sites of inflammation and later induced T-cell apoptosis, healing, and return of tissue homeostasis.35 36 Binding of FasL to fibronectin was proposed to result essentially in the oligomerization of FasL, further enhancing its biological activity.36 In the eye, FasL is expressed by the corneal epithelium and endothelium.37 The sFasL released in stroma may be similarly bound by the lumican present in abundance in the corneal stroma. It is likely, in the corneal stroma, that lumican is largely instrumental in retaining sFasL and increasing its biological efficacy.

The functional implications of interactions between FasL and lumican and further induction of Fas in the cornea are not clear, given the complexity of the role played by FasL and Fas in promoting inflammation as well as counteracting it in the context of ocular immune privilege.7 The eye is equipped with a distinct ability to restrain inflammatory activity, presumably by engaging FasL and Fas on inflammatory cells for their prompt apoptosis to preclude systemic response.22 37 38 In recent studies, investigators of mFasL versus sFasL in inflammation and ocular immune privilege observed that only tumor cells expressing high levels of mFasL could override immune privilege and induce potent neutrophil-mediated inflammation, whereas, in non–immune-privileged sites, lower levels of mFasL could initiate inflammation.28 29 The tissue environment in the corneal stroma, additional cytokines and growth factors that modify Fas-signal–mediated inflammatory processes, ECM components that modify localized concentration of FasL, and the availability of cytokines and growth factors may tip the balance toward inflammation or immune privilege.

In summary, the present study shows a major discord in cytokine induction and recruitment of inflammatory cells leading to impaired healing of corneal wounds in the lumican-null mouse. The underlying early defect in the lumican-null mouse may reside in inefficient signaling via Fas and its ligand, FasL, with further impact on other inflammatory cytokines. This mandates a close look at lumican as a potentially exciting therapeutic tool for tweaking these cell-signaling components. This study has unraveled a novel significant role for lumican in the presentation of immune/inflammatory signal to cells and facilitating inflammatory and healing responses in the cornea.


    Footnotes
 
2 Present affiliation: Department of Pediatrics, Johns Hopkins University, Baltimore, Maryland. Back

Supported by National Eye Institute Grant R01 EY11654 (SC).

Submitted for publication July 15, 2004; revised September 9, 2004; accepted September 16, 2004.

Disclosure: N. Vij, None; L. Roberts, None; S. Joyce, None; S. Chakravarti, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Shukti Chakravarti, Department of Medicine, Johns Hopkins University School of Medicine, Ross 935, 720 Rutland Avenue, Baltimore, MD 21205; schakra1{at}jhmi.edu.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Chakravarti S. The cornea through the eyes of knockout mice. Exp Eye Res. 2001;73:411–419.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  2. Funderburgh JL. Keratan sulfate: structure, biosynthesis, and function. Glycobiology. 2000;10:951–958.[Abstract/Free Full Text]
  3. Iozzo RV. Proteoglycans: structure, function, and role in neoplasia. Lab Invest. 1985;53:373–396.[Web of Science][Medline][Order article via Infotrieve]
  4. Rada JA, Cornuet PK, Hassell JH. Regulation of corneal collagen fibrillogenesis in vitro by corneal keratan sulfate proteoglycan (lumican) and decorin core proteins. Exp Eye Res. 1993;56:635–648.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  5. Chakravarti S, Petroll W, Hassell J, et al. Corneal opacity in lumican-null mice: defects in collagen fibril structure and packing in the posterior stroma. Invest Ophthalmol Vis Sci. 2000;41:3365–3373.[Abstract/Free Full Text]
  6. Chakravarti S, Magnuson T, Lass J, Jepsen K, LaMantia C, Carroll H. Lumican regulates collagen fibril assembly: skin fragility and corneal opacity in the absence of lumican. J Cell Biol. 1998;141:1277–1286.[Abstract/Free Full Text]
  7. Streilein JW. Ocular immune privilege: the eye takes a dim but practical view of immunity and inflammation. J Leukoc Biol. 2003;74:179–185.[Abstract/Free Full Text]
  8. Funderburgh JL, Funderburgh ML, Mann MM, Conrad GW. Unique glycosylation of three keratan sulfate proteoglycan isoforms. J Biol Chem. 1991;266:14226–14231.[Abstract/Free Full Text]
  9. Cornuet P, Blochberger T, Hassell J. Molecular polymorphisms of lumican during corneal development. Invest Ophthalmol Visual Sci. 1994;35:870–876.[Abstract/Free Full Text]
  10. Saika S, Miyamoto T, Tanaka S, et al. Response of lens epithelial cells to injury: role of lumican in epithelial-mesenchymal transition. Invest Ophthalmol Vis Sci. 2003;44:2094–2102.[Abstract/Free Full Text]
  11. Vij N, Roberts L, Joyce S, Chakravarti S. Lumican suppresses cell proliferation and aids Fas-Fas ligand mediated apoptosis: implications in the cornea. Exp Eye Res. 2004;78:957–971.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  12. Park DR, Thomsen AR, Frevert CW, et al. Fas (CD95) induces proinflammatory cytokine responses by human monocytes and monocyte-derived macrophages. J Immunol. 2003;170:6209–6216.[Abstract/Free Full Text]
  13. Hohlbaum AM, Gregory MS, Ju ST, Marshak-Rothstein A. Fas ligand engagement of resident peritoneal macrophages in vivo induces apoptosis and the production of neutrophil chemotactic factors. J Immunol. 2001;167:6217–6224.[Abstract/Free Full Text]
  14. Wajant H, Pfizenmaier K, Scheurich P. Non-apoptotic Fas signaling. Cytokine Growth Factor Rev. 2003;14:53–66.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  15. Saas P, Boucraut J, Quiquerez AL, et al. CD95 (Fas/Apo-1) as a receptor governing astrocyte apoptotic or inflammatory responses: a key role in brain inflammation?. J Immunol. 1999;162:2326–2333.[Abstract/Free Full Text]
  16. Schaub FJ, Han DK, Liles WC, et al. Fas/FADD-mediated activation of a specific program of inflammatory gene expression in vascular smooth muscle cells. Nat Med. 2000;6:790–796.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  17. Chakravarti S, Paul J, Roberts L, Chervoneva I, Oldberg A, Birk DE. Ocular and scleral alterations in gene-targeted lumican-fibromodulin double-null mice. Invest Ophthalmol Vis Sci. 2003;44:2422–2432.[Abstract/Free Full Text]
  18. Armstrong D, Ueda T, Aljada A, et al. Lipid hydroperoxide stimulates retinal neovascularization in rabbit retina through expression of tumor necrosis factor-alpha, vascular endothelial growth factor and platelet-derived growth factor. Angiogenesis. 1998;2:93–104.[CrossRef][Medline][Order article via Infotrieve]
  19. Ma Y, Liu H, Tu-Rapp H, et al. Fas ligation on macrophages enhances IL-1R1-Toll-like receptor 4 signaling and promotes chronic inflammation. Nat Immunol. 2004;5:380–387.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  20. Zieske JD, Guimaraes SR, Hutcheon AE. Kinetics of keratocyte proliferation in response to epithelial debridement. Exp Eye Res. 2001;72:33–39.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  21. Funderburgh JL, Mitschler RR, Funderburgh ML, Roth MR, Chapes SK, Conrad GW. Macrophage receptors for lumican: a corneal keratan sulfate proteoglycan. Invest Ophthalmol Vis Sci. 1997;38:1159–1167.[Abstract/Free Full Text]
  22. Mohan RR, Liang Q, Kim WJ, Helena MC, Baerveldt F, Wilson SE. Apoptosis in the cornea: further characterization of Fas/Fas ligand system. Exp Eye Res. 1997;65:575–589.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  23. Ahn JH, Park SM, Cho HS, et al. Non-apoptotic signaling pathways activated by soluble Fas ligand in serum-starved human fibroblasts: mitogen-activated protein kinases and NF-kappaB-dependent gene expression. J Biol Chem. 2001;276:47100–47106.[Abstract/Free Full Text]
  24. Hu WH, Johnson H, Shu HB. Activation of NF-kappaB by FADD, Casper, and caspase-8. J Biol Chem. 2000;275:10838–10844.[Abstract/Free Full Text]
  25. Kataoka T, Budd RC, Holler N, et al. The caspase-8 inhibitor FLIP promotes activation of NF-kappaB and Erk signaling pathways. Curr Biol. 2000;10:640–648.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  26. Kabra NH, Kang C, Hsing LC, Zhang J, Winoto A. T cell-specific FADD-deficient mice: FADD is required for early T cell development. Proc Natl Acad Sci USA. 2001;98:6307–6312.[Abstract/Free Full Text]
  27. Zhang J, Cado D, Chen A, Kabra NH, Winoto A. Fas-mediated apoptosis and activation-induced T-cell proliferation are defective in mice lacking FADD/Mort1. Nature. 1998;392:296–300.[CrossRef][Medline][Order article via Infotrieve]
  28. Gregory MS, Repp AC, Holhbaum AM, et al. Membrane Fas ligand activates innate immunity and terminates ocular immune privilege. J Immunol. 2002;169:2727–2735.[Abstract/Free Full Text]
  29. Chen JJ, Sun Y, Nabel GJ. Regulation of the proinflammatory effects of Fas ligand (CD95L). Science. 1998;282:1714–1717.[Abstract/Free Full Text]
  30. Saika S, Shiraishi A, Liu CY, et al. Role of lumican in the corneal epithelium during wound healing. J Biol Chem. 2000;275:2607–2612.[Abstract/Free Full Text]
  31. Tanaka M, Itai T, Adachi M, Nagata S. Downregulation of Fas ligand by shedding. Nat Med. 1998;4:31–36.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  32. Schneider P, Holler N, Bodmer JL, et al. Conversion of membrane-bound Fas(CD95) ligand to its soluble form is associated with downregulation of its proapoptotic activity and loss of liver toxicity. J Exp Med. 1998;187:1205–1213.[Abstract/Free Full Text]
  33. Rensing-Ehl A, Frei K, Flury R, et al. Local Fas/APO-1 (CD95) ligand-mediated tumor cell killing in vivo. Eur J Immunol. 1995;25:2253–2258.[Web of Science][Medline][Order article via Infotrieve]
  34. Tanaka M, Suda T, Yatomi T, Nakamura N, Nagata S. Lethal effect of recombinant human Fas ligand in mice pretreated with Propionibacterium acnes. J Immunol. 1997;158:2303–2309.[Abstract]
  35. Aoki K, Kurooka M, Chen JJ, Petryniak J, Nabel EG, Nabel GJ. Extracellular matrix interacts with soluble CD95L: retention and enhancement of cytotoxicity. Nat Immunol. 2001;2:333–337.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  36. Zanin-Zhorov A, Hershkoviz R, Hecht I, Cahalon L, Lider O. Fibronectin-associated Fas ligand rapidly induces opposing and time-dependent effects on the activation and apoptosis of T cells. J Immunol. 2003;171:5882–5889.[Abstract/Free Full Text]
  37. Griffith TS, Brunner T, Fletcher SM, Green DR, Ferguson TA. Fas ligand-induced apoptosis as a mechanism of immune privilege. Science. 1995;270:1189–1192.[Abstract/Free Full Text]
  38. Griffith TS, Ferguson TA. The role of FasL-induced apoptosis in immune privilege. Immunol Today. 1997;18:240–244.[CrossRef][Web of Science][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
J. Immunol.Home page
H. R. Chinnery, E. C. Carlson, Y. Sun, M. Lin, S. H. Burnett, V. L. Perez, P. G. McMenamin, and E. Pearlman
Bone Marrow Chimeras and c-fms Conditional Ablation (Mafia) Mice Reveal an Essential Role for Resident Myeloid Cells in Lipopolysaccharide/TLR4-Induced Corneal Inflammation
J. Immunol., March 1, 2009; 182(5): 2738 - 2744.
[Abstract] [Full Text] [PDF]


Home page
Mol. Interv.Home page
K. Gronert
Lipid Autacoids in Inflammation and Injury Responses: A Matter of Privilege
Mol. Interv., February 1, 2008; 8(1): 28 - 35.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. C. Carlson, M. Lin, C.-Y. Liu, W. W-Y. Kao, V. L. Perez, and E. Pearlman
Keratocan and Lumican Regulate Neutrophil Infiltration and Corneal Clarity in Lipopolysaccharide-induced Keratitis by Direct Interaction with CXCL1
J. Biol. Chem., December 7, 2007; 282(49): 35502 - 35509.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Wu and S. Chakravarti
Differential Expression of Inflammatory and Fibrogenic Genes and Their Regulation by NF-{kappa}B Inhibition in a Mouse Model of Chronic Colitis
J. Immunol., November 15, 2007; 179(10): 6988 - 7000.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Wu, N. Vij, L. Roberts, S. Lopez-Briones, S. Joyce, and S. Chakravarti
A Novel Role of the Lumican Core Protein in Bacterial Lipopolysaccharide-induced Innate Immune Response
J. Biol. Chem., September 7, 2007; 282(36): 26409 - 26417.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
B. Biteman, I. R. Hassan, E. Walker, A. J. Leedom, M. Dunn, F. Seta, M. Laniado-Schwartzman, and K. Gronert
Interdependence of lipoxin A4 and heme-oxygenase in counter-regulating inflammation during corneal wound healing
FASEB J, July 1, 2007; 21(9): 2257 - 2266.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
P. Talusan, S. Bedri, S. Yang, T. Kattapuram, N. Silva, P. J. Roughley, and J. R. Stone
Analysis of Intimal Proteoglycans in Atherosclerosis-prone and Atherosclerosis-resistant Human Arteries by Mass Spectrometry
Mol. Cell. Proteomics, September 1, 2005; 4(9): 1350 - 1357.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vij, N.
Right arrow Articles by Chakravarti, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vij, N.
Right arrow Articles by Chakravarti, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS