IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2005;46:3777-3782.)
© 2005 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.05-0724

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xiao, J.
Right arrow Articles by Chodosh, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xiao, J.
Right arrow Articles by Chodosh, J.

JNK Regulates MCP-1 Expression in Adenovirus Type 19–Infected Human Corneal Fibroblasts

Jingnan Xiao1 and James Chodosh1,2,3

1From the Departments of Ophthalmology, 2Cell Biology, and 3Microbiology and Immunology, the Molecular Pathogenesis of Eye Infection Research Center, Dean A. McGee Eye Institute, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma.


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
PURPOSE. Previous studies indicate that adenovirus type 19 (Ad19) infection of human corneal fibroblasts (HCFs) induces the expression of several proinflammatory mediators, including IL-8 and monocyte chemoattractant protein-1 (MCP-1), and that the tyrosine kinase c-Src and its downstream target, the mitogen-activated protein kinase ERK1/2, mediate IL-8 expression. In this context, the authors sought to investigate the potential role of another mitogen-activated protein kinase, c-Jun N-terminal kinase (JNK), in adenoviral ocular pathogenesis.

METHODS. Ad19- and mock-infected HCFs were solubilized at various time points after infection, and cell lysates were subjected to SDS-PAGE followed by immunoblot analysis with a panel of antibodies against components of the MKK7/JNK/c-Jun pathway or immunoprecipitated for JNK assay. The induction of chemokine mRNA and protein was determined by real-time PCR and ELISA, respectively.

RESULTS. Ad19 induced the phosphorylation of MKK7, JNK, and the downstream transcription factor c-Jun in HCFs at 15 and 30 minutes after infection. JNK activity was demonstrated at 30 minutes after infection using the GST–c-Jun fusion protein as a target substrate. SP600125, a specific pharmacologic inhibitor of JNK, blocked MCP-1 but not IL-8 mRNA and protein expression. Finally, PP2, a specific inhibitor of c-Src previously shown to inhibit the expression of both IL-8 and MCP-1 in Ad19-infected HCFs, also blocked JNK phosphorylation after infection.

CONCLUSIONS. The MKK7/JNK/c-Jun cascade is rapidly activated and mediates MCP-1 expression in Ad19-infected HCFs. Furthermore, the activation of c-Src on Ad19 infection appears to regulate both the ERK and the JNK pathways.


Human adenoviruses (Ad) have been identified as major pathogens in eye, gastrointestinal, and respiratory infections.1 They are classified into six subgroups or species (A-F), comprising 51 serotypes. Epidemic keratoconjunctivitis (EKC), the only ocular adenoviral infection with significant corneal involvement, is typically caused by infection with either Ad8, Ad19, or Ad37, all from subgroup D.2

Keratocytes, the resident cells of the corneal stroma, maintain the cornea in a precisely organized and transparent state.3 Moreover, keratocytes play an active role in host responses to injury by production of a variety of cytokines and chemokines, such as IL-1, IL-6, IL-8, monocyte chemoattractant protein (MCP)-1, TNF-{alpha}, RANTES, and granulocyte–colony-stimulating factor (G-CSF), and expression of adhesion molecules including intercellular adhesion molecule (ICAM)-1.4 5 6 We have previously suggested that proinflammatory mediator expression by Ad-infected keratocytes within the superficial corneal stroma may play a role in the chronic and recurrent subepithelial stromal inflammation associated with EKC.7

MCP-1, a member of the CC subfamily of chemokines, is chemotactic for monocytes, basophils, CD4+ and CD8+ lymphocytes, and T lymphocytes of the activated memory subset.8 MCP-1 has been implicated as an important mediator of monocyte and lymphocyte infiltration of tissues in a wide variety of inflammatory diseases, such as glomerulonephritis, rheumatoid arthritis, and bacterial meningitis (for a review, see Luster9 ). It has been shown that inhibiting MCP-1 expression results in reduced transmigration of monocytes through blood vessels10 and in diminished recruitment of T lymphocytes,8 suggesting a critical role in acute inflammation. Human keratocytes produce MCP-1 in response to a variety of cytokines, including IL-1{alpha} and TNF-{alpha}, and to lipopolysaccharide.6 We previously demonstrated, by DNA microarray studies, increased MCP-1 mRNA expression in Ad19-infected keratocytes in vitro.11 12 However, the mechanism(s) that mediate MCP-1 production in keratocytes remain largely unknown.

One means by which signals from extracellular stimuli are transmitted to the nucleus to impact proinflammatory gene expression is the activation of the mitogen-activated protein kinase (MAPK) superfamily (for a review, see Johnson and Lapadat13 ). In mammalian cells, there are three well-characterized MAPK subfamilies, including the ERK1/2, p38, and c-Jun N-terminal stress-activated protein kinases (JNKs). The ERK1/2 pathway preferentially regulates cell growth and differentiation. The p38 and JNK pathways are activated in response to a variety of stress inducers, including heat shock and UV irradiation.14 15 MAPK has been shown to be activated by Ad infection in several distinct in vitro models. For example, Ad5 infection of immortalized epithelial cell lines activated ERK, p38 MAPK, and JNK pathways.16 17 Ad7 infection of A549 human lung carcinoma cells activated ERK1/2, leading to IL-8 expression.18 We showed that Ad19 infection of cultured keratocytes activated ERK1/2, and this activation mediated the expression of IL-8 by these cells.11

In the present study, we focused on the activation of the JNK signaling cascade and its potential role in MCP-1 activation in Ad19-infected keratocytes. We demonstrate that Ad19 induces MKK7/JNK/c-Jun activation in these cells in vitro, which results in increased MCP-1 expression at the mRNA and protein levels.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Antibodies and Reagents
Antibodies to MKK4, MKK7, JNK, phospho-MKK4, and phospho-MKK7 were obtained from Cell Signaling Technology (Beverly, MA), and those to c-Jun, phospho-c-Jun, and phospho-JNK were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The anti–human MCP-1 antibody and the biotin-conjugated anti–human MCP-1 antibody were from BD PharMingen (San Diego, CA). The Src inhibitor PP2, JNK inhibitor SP600125, and MEK inhibitor PD098059 were purchased from Calbiochem (La Jolla, CA). Actinomycin D was purchased from Invitrogen (Carlsbad, CA).

Cell Culture and Viruses
Primary keratocytes were derived from donor corneas, as previously described.19 Briefly, after mechanical debridement of the corneal epithelium and endothelium, corneas were cut into 2-mm diameter sections, and each section was placed in individual wells of six-well Falcon tissue culture plates with Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), penicillin G sodium, and streptomycin sulfate at 37°C in 5% CO2. Corneal stromal fragments were removed before confluence of each cell culture. Cells from multiple donors were pooled, and the cell monolayers were used at passage three. In the presence of 10% FBS, keratocytes maintain a fibroblast phenotype and are referred to as human corneal fibroblasts (HCFs). The fibroblast phenotype was confirmed by immunofluorescence staining with polyclonal anti–vimentin (positive reactivity) and anti–cytokeratin (no reactivity) antibodies, as previously described.7 For inhibitor analysis, HCFs were pretreated with PP2 (10 µM), SP600125 (10 µM), or PD098059 (50 µM) for 3 hours at 37°C before infection. The cells were exposed to the inhibitors at the same concentrations throughout the infection process. Cell toxicity caused by the inhibitors was ruled out after trypan blue exclusion on cells treated with inhibitors for the same amount of time and at the same concentrations. The protocol for use of corneas from deceased human donors was approved by the University of Oklahoma Institutional Review Board and conformed to the tenets of the Declaration of Helsinki.

Ad19 was cultured directly from the cornea of a patient, as previously described,7 and was grown in lung carcinoma cells (A549 cells, CCL 185; American Type Culture Collection, Manassas, VA) in MEM with 2% FBS, penicillin G sodium, and streptomycin sulfate. The Oklahoma State Department of Health confirmed the viral serotype. Virus was purified from A549 cells by CsCl gradient, dialyzed against a 10 mM Tris (pH 8.0) buffer that contained 80 mM NaCl, 2 mM MgCl2, and 10% glycerol, titered in triplicate, and stored at –80°C.

Viral Infection
Monolayer HCFs grown to 95% confluence in six-well plates were washed in MEM with 2% FBS and were infected with purified Ad19 at a multiplicity of infection (MOI) of 50 or mock infected with virus-free dialysis buffer as a control. Virus was adsorbed at 37°C for 1 hour and then incubated for 1 additional hour before RNA isolation. For protein analyses, HCFs grown to 95% confluence in six-well plates were serum-starved for 18 to 24 hours before infection and were lysed after infection at the indicated time points.

Immunoblot Analysis
Ad19- and mock-infected HCFs were lysed with chilled cell lysis buffer (20 mM Tris, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM ß-glycerol phosphate, 1 mM Na3VO4, 1 µg/mL leupeptin, and 1 mM phenylmethylsulfonyl fluoride [PMSF]) and were incubated at 4°C for 5 minutes. Cell lysates were cleared by centrifugation at 21,000g for 15 minutes. The protein concentration of each supernatant was measured by BCA analysis (Pierce, Rockford, IL) and equalized. Cell lysates were subsequently separated by 10% SDS-PAGE and transferred onto nitrocellulose membranes (BioRad, Hercules, CA). The membranes were blocked for 1 hour with 4% BSA in TTBS (0.05% Tween-20) and incubated with primary antibody at 4°C overnight. After three washes for 10 minutes each in TTBS, the membranes were incubated with peroxidase-conjugated secondary antibodies for 1 hour at room temperature, washed again, and visualized with an enhanced chemiluminescence (ECL) kit (Amersham, Piscataway, NJ). Densitometric analysis of immunoblots where indicated was performed (ImageQuant 5.2; Amersham, Piscataway, NJ) in the linear range of detection, and absolute values were then normalized.

JNK Assay
JNK activity was determined (JNK Assay Kit; Cell Signaling Technology). Briefly, endogenous JNK was immunoprecipitated from 250 µg cell lysate with an N-terminal c-Jun (1–89) fusion protein bound to glutathione Sepharose beads overnight at 4°C. Precipitates were washed twice with lysis buffer and twice with kinase buffer (25 mM Tris, pH 7.5, 5 mM ß-glycerophosphate, 2 mM dithiothreitol (DTT), 0.1 mM Na3VO4, and 10 mM MgCl2). The kinase reaction was initiated by the addition of cold adenosine triphosphate (ATP; 100 µM). After the cells were incubated for 30 minutes at 30°C, the reactions were stopped with 3x sample buffer. Proteins were resolved by 10% SDS-PAGE followed by Western blot analysis. Membranes were probed with antibodies against phospho-c-Jun (Ser 63).

Real-Time PCR
Total RNA was isolated using a reagent (TRIzol; Invitrogen) according to the manufacturer’s protocol. RNA concentrations were measured spectrophotometrically, and the quality of each RNA sample was confirmed by calculating the ratio of optical density at 260:280 nm. A ratio of 1.8 or higher indicated that samples contained only nondegraded RNA. Reverse transcription of 1 µg RNA for cDNA synthesis was performed, and quantitative real-time PCR was carried out (ABI Prism 7000 Sequence Detection System; PE Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. Primers included the following: MCP-1 (GenBank accession no. BC009716) forward, 5' GCAATCAATGCCCCAGTCA 3'; reverse, 5' TGCTGCTGGTGATTCTTCTATAGCT 3'; IL-8 (GenBank accession no. BT007067) forward, 5' AGCTGGCCGTGGCTCTCT 3; reverse, 5' CTGACATCTAAGTTCTTTAGCACTCCTT 3'; and GAPDH (GenBank accession no. X01677) forward, 5' ATTCCACCCATGGCAAATTC 3'; reverse, 5' CGCTCCTGGAAGATGGTGAT 3'. Amplification curves were generated by monitoring the fluorescence of SYBR Green as a measure of its incorporation into the amplified product. GAPDH mRNA levels were used as an internal control. The fold change in mRNA levels for MCP-1 and IL-8 was calculated using the 2-{Delta}{Delta}CT method, as previously described.20

ELISA
HCFs were infected in 48-well plates with purified Ad19 or were mock infected with virus-free dialysis buffer as a control. Culture media were collected 4 hours after infection, and the levels of MCP-1 were quantified by sandwich ELISA using capture and detection antibodies. The detection limit was 10 pg/mL. Plates were read on a microplate reader (SpectraMax M2; Molecular Devices, Sunnyvale, CA) and were analyzed with analysis software (SOFTmax; Molecular Devices). Means of triplicate ELISA values for each of the virus- and mock-infected wells were compared by ANOVA with Scheffé’s multiple comparison test. Statistical significance was set at alpha = 0.01.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
JNK Is Activated in Ad19-Infected Human Corneal Fibroblasts
We have previously shown that infection of HCFs by Ad19 activates the tyrosine kinases c-Src and ERK1/2 and that ERK1/2 acts downstream of c-Src.11 Because JNK has also been shown to be activated by Src kinases,21 we first examined whether JNK was activated in HCFs in response to Ad19 infection. HCFs were Ad19 or mock infected for 15 and 30 minutes before cell lysis. Cell lysates were prepared for Western blot analysis and JNK assay using appropriate antibodies. The phospho-JNK antibodies used recognize JNK only when phosphorylated on threonine 183 and tyrosine 185 residues. As shown in Figure 1A , infection of HCFs with Ad19 resulted in an increase in both phosphorylated forms of JNK (46 and 54 kDa) at 15 and 30 minutes after infection, whereas total JNK levels remained unchanged.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 1. Effect of Ad19 infection on JNK activation in HCF. (A) Cells were infected with Ad19 or mock infected with virus-free dialysis buffer for 15 or 30 minutes. Cells were then lysed, and cell lysates were subjected to Western blot analysis with antibodies against JNK and phospho-JNK. Reactivity against the 46- and 54-kDa forms of phospho-JNK was seen at both time points in the Ad19-infected cells. (B) In vitro JNK assay performed at 30 minutes after infection shows increased phosphorylation of the c-Jun substrate signifying JNK activity on Ad19 infection of HCFs.

 
JNK activity was further examined by kinase assay. The activity of immunoprecipitated JNK from Ad19- or mock-infected HCFs was assayed using an exogenous GST–c-Jun fusion protein as substrate. Ad19 induced an increase in the ability of JNK to phosphorylate GST–c-Jun substrate at 30 minutes after infection compared with mock treatment (Fig. 1B) .

Phosphorylation of c-Jun by Ad19
One of the main downstream substrates for activated JNK is the transcription factor c-Jun (for a review, see Davis14 ). JNK phosphorylates c-Jun at serine residues 63 and 73, and activated c-Jun in turn binds to 12-O-tetradecanoylphorbol-13-acetate (TPA) response elements.14 To determine whether Ad19 infection of HCF also results in c-Jun phosphorylation, lysates from Ad19- or mock-infected HCFs were subjected to Western blot analysis using antibodies against phosphorylated and total c-Jun. As shown in Figure 2 , infection of HCF by Ad19 resulted in increased c-Jun phosphorylation at 15 and 30 minutes after infection. Notably, total c-Jun also increased at 30 minutes after infection. However, densitometry performed on phosphorylated and total c-Jun bands still showed a relative increase in c-Jun phosphorylation at 30 minutes when normalized for total c-Jun. By densitometry, infection with Ad19 increased c-Jun phosphorylation by 5.8- and 2.3-fold at 15 and 30 minutes after infection, respectively (Fig. 2) .



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 2. Effect of Ad19 infection on c-Jun phosphorylation in HCFs. By Western blot analysis, Ad19 infection–induced phosphorylation of c-Jun was apparent at 15 and 30 minutes after infection. There was also an observed increase in total c-Jun protein at 30 minutes after infection, but densitometric analysis (relative fold difference shown above the blot) revealed an increase in phosphorylation of c-Jun even when the change in total c-Jun was taken into account.

 
Ad19 Infection Results in Phosphorylation of MKK7 but Not MKK4
MKK4 and MKK7 function as upstream activators of JNK by phosphorylation at JNK threonine 183 and tyrosine 185 residues.14 To demonstrate whether MKK4 or MKK7 is phosphorylated in Ad19 infection of HCFs, lysates from Ad19- or mock-infected HCFs were subjected to Western blot analysis using antibodies against phosphorylated and total MKK4 and MKK7. As shown in Figure 3 , MKK7 was phosphorylated by Ad19 infection of HCF at 15 and 30 minutes after infection, whereas MKK4 was not. These observations suggest that activation of JNK in Ad19-infected HCFs may be dependent on the activation of MKK7 but not of MKK4.



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 3. Phosphorylation of MKK4 and MKK7 in HCFs on Ad19 infection. Western blot analysis of phosphorylated and total MKK4 and MKK7 at 15 and 30 minutes after Ad19 infection reveals phosphorylation of MKK7 but not of MKK4 at both time points.

 
c-Src Regulates JNK Activation
As discussed, we have previously shown that the tyrosine kinase c-Src is rapidly activated in HCFs in response to Ad19 infection.11 Given that JNK has been shown to be an important downstream target for activated Src kinases,21 we sought to examine whether the activation of JNK is regulated by c-Src. HCFs were preincubated with PP2 (10 µM), a selective inhibitor of Src kinase family members,22 followed by Ad19 or mock infection. Cell lysates were prepared at 30 minutes after infection and were analyzed by Western blotting. As seen in Figure 4 , 10 µM PP2 dramatically reduced Ad19-induced JNK phosphorylation, suggesting that JNK acts downstream of c-Src in Ad19-infected HCFs.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 4. Analysis of relationship between c-Src and JNK in Ad19-infected HCFs. Cells were incubated with the Src inhibitor PP2 (10 µM) before Ad19 or mock infection. Thirty minutes after infection, Western blot analysis using antibodies against phospho-JNK and total JNK reveals a reduction in phospho-JNK reactivity when the cells were pretreated with PP2, consistent with JNK acting downstream of c-Src in the signaling cascade induced by infection.

 
Ad19-Induced MCP-1 mRNA Expression Is Reduced by the JNK-Specific Inhibitor SP600125
By DNA microarray analysis, we have previously shown that Ad19 upregulates MCP-1 mRNA expression in HCFs and that the c-Src inhibitor PP2 reduces MCP-1 mRNA levels, suggesting that c-Src regulates MCP-1 expression at the transcriptional level.11 Because MAPK may act downstream of c-Src, we investigated whether JNK or ERK1/2 is responsible for the expression of this proinflammatory mediator. Reverse-transcription PCR suggested that MCP-1 transcription was reduced in the presence of SP600125 (10 µM), a specific JNK inhibitor (Fig. 5) .23 Subsequent quantitative real-time PCR was performed to compare the levels of MCP-1 mRNA in Ad19-infected cells with those in mock-infected HCFs, in the presence or absence of SP600125 and PD098059, the latter a specific inhibitor of ERK1/2 activation.24 As shown in Table 1 , the level of MCP-1 mRNA was increased 5.1-fold by Ad19 compared with mock infection, whereas SP600125 reduced the MCP-1 mRNA level in Ad19-infected cells to 1.6-fold over mock-infected cells. SP600125 had no effect on IL-8 mRNA levels (data not shown). Interestingly, the ERK1/2 activation inhibitor PD098059 failed to reduce MCP-1 mRNA levels (data not shown), indicating that the activation of JNK, but not of ERK1/2, is required for Ad19-induced transcription of MCP-1.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 5. RT-PCR analysis of MCP-1 expression after Ad19 infection. HCFs were mock infected, infected with Ad19, or pretreated with the JNK inhibitor SP600125 (10 µM) before infection. One hour after infection, MCP-1 mRNA levels were increased in the Ad19-infected cells, and this increase was blocked by pretreatment with SP600125, suggesting that MCP-1 transcription in Ad19-infected HCFs occurs downstream of JNK activation. GAPDH mRNA levels are also shown as a control.

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Real-Time PCR Analysis of the Effect of the JNK Inhibitor SP600125 on Ad19-Induced MCP-1 mRNA Expression

 
To determine whether Ad19 infection directly upregulates MCP-1 transcription or merely increases the stability of MCP-1 mRNA, HCFs were also infected in the presence or absence of actinomycin D (10 µg/mL), an inhibitor of RNA polymerase. By real-time PCR, actinomycin D lowered MCP-1 mRNA levels in Ad19-infected HCF to levels similar to those of mock-infected control cells, suggesting a direct effect of Ad19 infection on MCP-1 transcription (data not shown).

Ad19-Induced MCP-1 Protein Expression Is Reduced by the JNK-Specific Inhibitor SP600125
We also tested MCP-1 expression at the protein level with ELISA. As shown in Figure 6 , Ad19 infection significantly increased MCP-1 levels in HCF compared with mock-infected control cells (1281.9 ± 69.6 vs. 292.5 ± 9.6 pg/mL), whereas SP600125 (10 µM) reduced MCP-1 expression by Ad-19–infected HCF (231.0 ± 16.0 vs. 1281.9 ± 69.6; P < 0.01, both comparisons). These observations suggest that the activation of JNK is required for MCP-1 gene transcription and subsequent protein synthesis in Ad19-infected HCFs.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 6. ELISA analysis of MCP-1 expression after Ad19 infection. HCFs were mock infected, infected with Ad19, or infected with Ad19 after pretreatment with the JNK inhibitor SP600125 (10 µM). At 4 hours after infection, MCP-1 protein levels were significantly increased, and this increase was blocked by pretreatment with SP600125 (P < 0.01, both comparisons), suggesting that MCP-1 transcription in Ad19-infected HCF occurs downstream of JNK activation. Error bars represent the SD of the mean. The ELISA shown is representative of three independent experiments with similar results.

 

    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Adenoviral internalization into target cells is an active cell-mediated process that uses intracellular signaling to direct clathrin-mediated endocytosis of the virus.25 The initial attachment of adenoviruses to the cell is mediated by interaction between the penton fiber knob, the viral capsid protein most distal from the viral surface, and on the cellular side either CAR (coxsackievirus and Ad receptor)26 or CD46 (membrane cofactor protein).27 28 29 This primary interaction facilitates an essential secondary interaction between the viral penton base protein on the proximal surface of the viral capsid and the cellular integrins {alpha}vß3 or {alpha}vß5 (for a review, see Chang and Karin30 ). This latter contact causes aggregation of the integrins and induces virus internalization through a phosphoinositide-3 kinase–dependent pathway.31 Coincident intracellular signaling events associated with integrin aggregation after adenoviral binding have evoked considerable interest with regard to adenoviral gene therapy. For example, a recombinant Ad5 vector was shown to activate ERK1/2, p38, and JNK2 in cultured rheumatoid synoviocytes,32 and similar signaling events in immortalized epithelial cells lines led to the upregulation of IL-816 and ICAM-1,17 events not thought beneficial to the success of gene therapy. In this light, we previously found that Ad19 binding to HCF activates the non–receptor tyrosine kinase c-Src and its downstream target, ERK1/2, and that the activity of both kinases is necessary for subsequent IL-8 expression.11 We show here that Ad19 infection of HCFs leads to activation of the JNK pathway, also downstream of c-Src, and that this activation leads to increased expression of MCP-1.

The stress-induced JNK cascade is activated in response to many environmental stimuli and acts on multiple cellular functions.14 In particular, the JNK pathway influences the expression of proinflammatory mediators, including IL-6, IL-8, ICAM-1, MCP-1,33 34 cyclooxygenase-2 (COX-2), and prostaglandin E2 (PGE2),32 consistent with its central role in inflammation. We show that the activation of JNK directly or indirectly induces MCP-1 because the JNK inhibitor SP600125 reduced MCP-1 mRNA and protein expression. In contrast, SP600125 at the same concentration (10 µM) had no effect on IL-8 mRNA and protein expression (data not shown), previously shown to be under the regulation of ERK1/2.11 Taken together, our findings suggest that the JNK pathway is important to MCP-1 but not IL-8 expression. The human MCP-1 promoter contains binding sites for AP-1 and NF-{kappa}B, whereas the IL-8 promoter contains binding sites for AP-1, NF-{kappa}B, and NF-IL6.35 One of the plausible explanations for our findings is that MCP-1 regulation by the JNK pathway is largely mediated by the AP-1 sites, whereas IL-8 regulation by the ERK1/2 cascade may be more dependent on NF-{kappa}B or NF-IL6. We also recently observed in Ad19-infected HCFs that p38 is activated and acts downstream of c-Src and that its activation increases the expression of IL-8 but not of MCP-1 (JX and JC, unpublished observation, 2005). Taken together, these studies suggest a prominent role for c-Src in the regulation of downstream MAPK activation and serve to focus our attention on the MAPKs as proteins that may determine the specificity of chemokine induction in infection. Interestingly, we also noted the increased expression of total c-Jun protein at 30 or more minutes after infection in repeated experiments, consistent with prior evidence that Ad19 infection induces the transcription of c-Jun.11 However, the increased phosphorylation of c-Jun resulting from Ad19 infection was seen as early as 15 minutes after infection, before any increase in total c-Jun protein.

The development of chronic multifocal subepithelial corneal infiltrates after acute infection is one of the hallmarks of EKC36 and is a major cause of long-term morbidity in the disorder.37 Cellular components of the infiltrates in human EKC remain unknown. Experimentally, infiltrating cells within the corneal stroma of scarified, Ad8-infected cotton rats were primarily polymorphonuclear neutrophils.38 Later in the course of infection in rabbits that received intracorneal injections of Ad5, CD4+ and CD8+ T lymphocytes and CD18+ cells predominated within corneal stromal infiltrates.39 Our previous demonstration that the infection of human corneal fibroblasts in vitro with Ad19 induces the upregulation of IL-8 protein,7 the paradigm chemoattractant for neutrophils, together with data presented herein that infected corneal fibroblasts also express increased MCP-1 protein, known to be chemotactic for lymphocytes and monocytes, suggest that increased expression of chemokines by infected keratocytes may be responsible for the formation of subepithelial infiltrates in human EKC. The characterization of MCP-1 as a target gene for the JNK signaling cascade on Ad19 infection of human corneal cells implicates JNK as an important mediator of inflammation in adenovirus keratitis. Along with c-Src and ERK1/2, JNK may provide a potential therapeutic target in the corneas of human patients with EKC.


    Acknowledgements
 
The authors thank Roger Astley for assisting with cell cultures and virus purification.


    Footnotes
 
Presented in part at the annual meeting of the Association for Research in Vision & Ophthalmology, Fort Lauderdale, Florida, May 2005.

Supported by United States Public Health Service Grants RO1 EY13124 and P30 EY12190 and by a Lew R. Wasserman Merit Award (JC) from Research to Prevent Blindness, Inc.

Submitted for publication June 8, 2005; accepted August 19, 2005.

Disclosure: J. Xiao, None; J. Chodosh, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: James Chodosh, DMEI-OUHSC, 608 Stanton L. Young Boulevard, Oklahoma City, OK 73104; james-chodosh{at}ouhsc.edu.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. Lukashok SA, Horwitz MS. New perspectives in adenoviruses. Curr Clin Top Infect Dis. 1998;18:286–305.[Medline][Order article via Infotrieve]
  2. Kemp MC, Hierholzer JC, Cabradilla CP, Obijeski JF. The changing etiology of epidemic keratoconjunctivitis: antigenic and restriction enzyme analyses of adenovirus types 19 and 37 isolated over a 10-year period. J Infect Dis. 1983;148:24–33.[Web of Science][Medline][Order article via Infotrieve]
  3. Muller LJ, Pels L, Vrensen GF. Novel aspects of the ultrastructural organization of human corneal keratocytes. Invest Ophthalmol Vis Sci. 1995;36:2557–2567.[Abstract/Free Full Text]
  4. Kennedy M, Kim KH, Harten B, et al. Ultraviolet irradiation induces the production of multiple cytokines by human corneal cells. Invest Ophthalmol Vis Sci. 1997;38:2483–2491.[Abstract/Free Full Text]
  5. Hong J-W, Liu JJ, Lee J-S, et al. Proinflammatory chemokine induction in keratocytes and inflammatory cell infiltration into the cornea. Invest Ophthalmol Vis Sci. 2001;42:2795–2803.[Abstract/Free Full Text]
  6. Kumagai N, Fukuda K, Fujitsu Y, Lu Y, Chikamoto N, Nishida T. Lipopolysaccharide-induced expression of intercellular adhesion molecule-1 and chemokines in cultured human corneal fibroblasts. Invest Ophthalmol Vis Sci. 2005;46:114–120.[Abstract/Free Full Text]
  7. Chodosh J, Astley RA, Butler MG, Kennedy RC. Adenovirus keratitis: a role for interleukin-8. Invest Ophthalmol Vis Sci. 2000;41:783–789.[Abstract/Free Full Text]
  8. Carr MW, Roth SJ, Luther E, Rose SS, Springer TA. Monocyte chemoattractant protein 1 acts as a T-lymphocyte chemoattractant. Proc Natl Acad Sci USA. 1994;91:3652–3656.[Abstract/Free Full Text]
  9. Luster AD. Mechanisms of disease: chemokines–chemotactic cytokines that mediate inflammation. N Engl J Med. 1998;338:436–445.[Free Full Text]
  10. Randolph GJ, Furie MB. A soluble gradient of endogenous monocyte chemoattractant protein-1 promotes the transendothelial migration of monocytes in vitro. J Immunol. 1995;155:3610–3618.[Abstract]
  11. Natarajan K, Rajala MS, Chodosh J. Corneal IL-8 expression following adenovirus infection is mediated by c-Src activation in human corneal fibroblasts. J Immunol. 2003;170:6234–6243.[Abstract/Free Full Text]
  12. Natarajan K, Shepard LA, Chodosh J. The use of DNA array technology in studies of ocular viral pathogenesis. DNA Cell Biol. 2002;21:483–490.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  13. Johnson GL, Lapadat R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science. 2002;298:1911–1912.[Abstract/Free Full Text]
  14. Davis RJ. Signal transduction by the JNK group of MAP kinases. Cell. 2000;103:239–252.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  15. Chang L, Karin M. Mammalian MAP kinase signaling cascades. Nature. 2001;410:37–40.[CrossRef][Medline][Order article via Infotrieve]
  16. Bruder JT, Kovesdi I. Adenovirus infection stimulates the Raf/MAPK signaling pathway and induces interleukin-8 expression. J Virol. 1997;71:398–404.[Abstract/Free Full Text]
  17. Tamanini A, Rolfini R, Nicolis E, Melotti P, Cabrini G. MAP kinases and NF-{kappa}B collaborate to induce ICAM-1 gene expression in the early phase of adenovirus infection. Virology. 2003;307:228–242.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  18. Alcorn MJ, Booth JL, Coggeshall KM, Metcalf JP. Adenovirus type 7 induces interleukin-8 production via activation of extracellular regulated kinase 1/2. J Virol. 2001;75:6450–6459.[Abstract/Free Full Text]
  19. Cubitt CL, Tang Q, Monteiro CA, Lausch RN, Oakes JE. IL-8 gene expression in cultures of human corneal epithelial cells and keratocytes. Invest Ophthalmol Vis Sci. 1993;34:3199–3206.[Abstract/Free Full Text]
  20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-{Delta}{Delta}CT method. Methods. 2001;25:402–408.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  21. Yoshizumi M, Abe J, Haendeler J, Huang Q, Berk BC. Src and Cas mediate JNK activation but not ERK1/2 and p38 kinases by reactive oxygen species. J Biol Chem. 2000;275:11706–11712.[Abstract/Free Full Text]
  22. Hanke JH, Gardner JP, Dow RL, et al. Discovery of a novel, potent, and Src family-selective tyrosine kinase inhibitor: study of Lck- and FynT-dependent T cell activation. J Biol Chem. 1996;271:695–701.[Abstract/Free Full Text]
  23. Bennett BL, Sasaki DT, Murray BW, et al. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci USA. 2001;98:13681–13686.[Abstract/Free Full Text]
  24. Dudley DT, Pang L, Decker SJ, Bridges AJ, Saltiel AR. A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc Natl Acad Sci USA. 1995;92:7686–7689.[Abstract/Free Full Text]
  25. Wang K, Huang S, Kapoor-Munshi A, Nemerow G. Adenovirus internalization and infection require dynamin. J Virol. 1998;72:3455–3458.[Abstract/Free Full Text]
  26. Bergelson JM, Cunningham JA, Droguett G, et al. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science. 1997;275:1320–1323.[Abstract/Free Full Text]
  27. Gaggar A, Shayakhmetov DM, Lieber A. CD46 is a cellular receptor for group B adenoviruses. Nat Med. 2003;9:1408–1412.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  28. Segerman A, Atkinson JP, Marttila M, Dennerquist V, Wadell G, Arnberg N. Adenovirus type 11 uses CD46 as a cellular receptor. J Virol. 2003;77:9183–9191.[Abstract/Free Full Text]
  29. Wu E, Trauger SA, Pache L, et al. Membrane cofactor protein is a receptor for adenoviruses associated with epidemic keratoconjunctivitis. J Virol. 2004;78:3897–3905.[Abstract/Free Full Text]
  30. Nemerow GR, Stewart PL. Role of {alpha}v integrins in adenovirus cell entry and gene delivery. Microbiol Mol Biol Rev. 1999;63:725–734.[Abstract/Free Full Text]
  31. Li E, Stupack D, Klemke R, Cheresh DA, Nemerow GR. Adenovirus endocytosis via {alpha}v integrins requires phosphoinositide-3-OH kinase. J Virol. 1998;72:2055–2061.[Abstract/Free Full Text]
  32. Crofford LJ, McDonagh KT, Guo S, et al. Adenovirus binding to cultured synoviocytes triggers signaling through MAPK pathways and induces expression of cyclooxygenase-2. J Gene Med. 2005;7:288–296.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  33. Arndt PG, Suzuki N, Avdi NJ, Malcolm KC, Worthen GS. Lipopolysaccharide-induced c-Jun NH2-terminal kinase activation in human neutrophils: role of phosphatidylinositol 3-Kinase and Syk-mediated pathways. J Biol Chem. 2004;279:10883–10891.[Abstract/Free Full Text]
  34. Lund S, Porzgen P, Mortensen AL, et al. Inhibition of microglial inflammation by the MLK inhibitor CEP-1347. J Neurochem. 2005;92:1439–1451.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  35. Roebuck KA, Carpenter LR, Lakshminarayanan V, Page SM, Moy JN, Thomas LL. Stimulus-specific regulation of chemokine expression involves differential activation of the redox-responsive transcription factors AP-1 and NF-{kappa}B. J Leukoc Biol. 1999;65:291–298.[Abstract]
  36. Gordon YJ, Aoki K, Kinchington PR. Adenovirus keratoconjunctivitis. Pepose JS Holland GN Wilhelmus KR eds. Ocular Infection and Immunity. 1996;877–894. CV Mosby St. Louis, MO.
  37. Butt AL, Chodosh J. Adenoviral keratoconjunctivitis in a tertiary care eye clinic. Cornea.. .In press
  38. Tsai JC, Garlinghouse G, McDonnell PJ, Trousdale MD. An experimental animal model of adenovirus-induced ocular disease: the cotton rat. Arch Ophthalmol. 1992;110:1167–1170.[Abstract/Free Full Text]
  39. Trousdale MD, Nobrega R, Wood RL, et al. Studies of adenovirus-induced eye disease in the rabbit model. Invest Ophthalmol Vis Sci. 1995;36:2740–2748.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
M.-P. Agbaga, R. S. Brush, M. N. A. Mandal, K. Henry, M. H. Elliott, and R. E. Anderson
Role of Stargardt-3 macular dystrophy protein (ELOVL4) in the biosynthesis of very long chain fatty acids
PNAS, September 2, 2008; 105(35): 12843 - 12848.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
P. M. Rogers, N. Mashtalir, M. A. Rathod, O. Dubuisson, Z. Wang, K. Dasuri, S. Babin, A. Gupta, N. Markward, W. T. Cefalu, et al.
Metabolically Favorable Remodeling of Human Adipose Tissue by Human Adenovirus Type 36
Diabetes, September 1, 2008; 57(9): 2321 - 2331.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. Liu, H. van Goor, R. Havinga, J. F. W. Baller, V. W. Bloks, F. R. van der Leij, P. J. J. Sauer, F. Kuipers, G. Navis, and M. H. de Borst
Neonatal dexamethasone administration causes progressive renal damage due to induction of an early inflammatory response
Am J Physiol Renal Physiol, April 1, 2008; 294(4): F768 - F776.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S.-F. Chou, S.-W. Chang, and J.-L. Chuang
Mitomycin C Upregulates IL-8 and MCP-1 Chemokine Expression via Mitogen-Activated Protein Kinases in Corneal Fibroblasts
Invest. Ophthalmol. Vis. Sci., May 1, 2007; 48(5): 2009 - 2016.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. V. Chintakuntlawar, R. Astley, and J. Chodosh
Adenovirus Type 37 Keratitis in the C57BL/6J Mouse
Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 781 - 788.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
M. A. Bogoyevitch and B. Kobe
Uses for JNK: the Many and Varied Substrates of the c-Jun N-Terminal Kinases
Microbiol. Mol. Biol. Rev., December 1, 2006; 70(4): 1061 - 1095.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xiao, J.
Right arrow Articles by Chodosh, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xiao, J.
Right arrow Articles by Chodosh, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS