IOVS Health Education Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2005;46:4235-4244.)
© 2005 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.05-0543

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (16)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blais, D. R.
Right arrow Articles by Altosaar, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blais, D. R.
Right arrow Articles by Altosaar, I.

LBP and CD14 Secreted in Tears by the Lacrimal Glands Modulate the LPS Response of Corneal Epithelial Cells

David R. Blais,1 Sandy G. Vascotto,2 May Griffith,2,3 and Illimar Altosaar1

1From the Department of Biochemistry, Microbiology and Immunology, the 2Eye Institute, and the 3Department of Cellular and Molecular Medicine, University of Ottawa, Ottawa, Ontario, Canada.


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
PURPOSE. Lipopolysaccharide (LPS) is one of the most powerful bacterial virulence factors in terms of proinflammatory properties and is likely to contribute to corneal bacterial keratitis. Better understanding of the spatial expression of the LPS receptor components at the tear–corneal interface might facilitate enhanced functions of the LPS receptor complex in ocular defense against Gram-negative infections.

METHODS. The expression of LPS-binding protein (LBP), CD14, toll-like receptor (TLR)-4, and MD-2 in human lacrimal glands, reflex tears, and corneal epithelia was examined by ELISA, RT-PCR, Western blot analysis, and immunofluorescence. The release of proinflammatory cytokines after the activation of primary and immortalized corneal epithelial cells with LPS and human tears was measured by ELISA.

RESULTS. LBP and CD14 proteins were detected in reflex human tears. Human lacrimal glands and corneal epithelia expressed LBP, CD14, TLR4, and MD-2 mRNAs and proteins. In the corneal epithelium, LBP was mainly expressed by superficial and basal epithelial cells, whereas CD14, TLR4, and MD-2 expression were limited to the wing and basal epithelial cells. In a dose-dependant manner, tear CD14 and LBP mediated the secretion of interleukin (IL)-6 and IL-8 by corneal epithelia cells when challenged with LPS.

CONCLUSIONS. Tear CD14 and LBP complemented the LPS receptor complex expressed by the corneal epithelia to trigger an immune response in the presence of LPS. The complementation of these tear and corneal immune proteins could play an important role in LPS recognition and signaling and, therefore, could modulate ocular innate immunity.


Eyelids, tears, epithelium, and stroma help protect the outer eye against the environment. One mechanism of particular importance is tear fluid, because its continuous flow protects the eye by bathing the ocular surface and flushing foreign particles from the epithelium. In addition to their hydrodynamics, tears contain several immune molecules with bactericidal properties. Of these molecules, secretory IgA opsonizes bacteria and prevents their adherence to the epithelium.1 Another tear component, lactoferrin, limits bacterial growth and biofilm formation by sequestering iron and destabilizing bacterial membranes.2 These defense molecules use tears as a medium to help protect the entire ocular surface.3

Another barrier contributing to ocular protection is the intact corneal epithelium. Several epithelial features are essential in mediating this protection: tight cell junctions, cell polarity, and continuous epithelial turnover.4 Structural integrity is essential in preventing bacterial adherence and infiltration into deeper epithelial layers and subsequent infections.4 Rather than merely being a passive barrier, corneal epithelial cells actively participate in the ocular immune defense as they express innate immune receptors, such as CD14,5 TLR4,6 and TLR5,7 targeted against pathogenic products.

Microbial keratitis is responsible for up to 30% of the blindness in developing countries and can represent as much as 90% of keratitis cases in temperate climates.8 Bacterial keratitis is mostly associated with predisposing factors such as extended contact lens wear and LASIK surgery in industrialized society9 10 or trauma in tropical and subtropical communities,11 where Pseudomonas aeruginosa remains the primary Gram-negative causative agent.10 In recent years, a constant increase in keratitis incidence and subsequent treatment costs,10 combined with long-standing occupational insults, has demanded better understanding of the innate immune defense mechanisms present in the ocular environment to prevent infections.

An important characteristic of innate immunity is the rapid recognition of a wide range of pathogens through highly conserved structural motifs present on many different microorganisms. The best-studied example of such an innate system is the recognition of lipopolysaccharide (LPS, or endotoxin), a highly conserved molecular pattern of Gram-negative bacteria. In the bloodstream, the sequential action of at least four extracellular and cell surface proteins—LPS-binding protein (LBP), CD14, TLR4, and MD-2, referred to as the LPS receptor complex—is required for maximum sensitivity of endotoxin signaling.12 LPS recognition is mainly initiated by LBP, a soluble serum lipid transfer protein synthesized by the liver, whose function is to extract LPS monomers from aggregated endotoxin structures for their subsequent delivery to membrane-bound or soluble (s)CD14.13 14 LPS is thereafter transferred from CD14 to the TLR4/MD-2 transmembrane coreceptor and triggers the expression of various inflammatory and immunoregulatory genes resulting in the recruitment and activation of immune cells to the site of infection.15 16 17 18 19 The potential relationship between the LPS receptor components of the tear film and those of the corneal epithelium remains to be delineated.

Therefore, the expression and the immune functions of the LPS receptor proteins CD14, LBP, TLR4, and MD-2 were characterized in human tears and corneal epithelia. To investigate the ocular immune response against LPS, human reflex tears were examined for sCD14 and LBP, and the lacrimal gland and the intact corneal epithelium were evaluated as the source. The ability of tears to complement the LPS receptor protein complex components within LPS-challenged corneal epithelial cells was evaluated in vitro for the induction of IL-6 and IL-8. We hypothesize that sCD14 and LBP from human tears can complement the corneal derived repertoire of the LPS receptor complex to induce an innate immune reaction in the epithelium.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Subjects
The study was performed in accordance with the tenets of the Declaration of Helsinki and was approved by the Ottawa Hospital Research Ethics Board. The purpose of the research and the procedure for the experiment were explained to all the participants, and their written informed consent was obtained before tear collection. Ninety-one healthy volunteers were recruited randomly at the University of Ottawa Eye Institute. Inclusion criteria were that volunteers were not taking any ocular medication, had no history of eye disease, and had not suffered from dry eye conditions.20 The study was made up of two groups. The first, consisting of 67 healthy non–contact lens wearers, included 34 women and 33 men; their median age was 48 years (range, 17–86 years). The second group, consisting of 24 healthy contact lens wearers, included 13 women and 11 men; their median age was 27 years (range, 16–54 years).

Tear Fluid Collection
Tear production was stimulated by briefly exposing the eye to vapors of freshly minced onions. Tear samples were then collected with 50-µL flamed-polished disposable microcapillaries (VWR, West Chester, PA), while avoiding ocular surface contact. For the continuous incremental tear flow experiment, onion vapor–stimulated tears from 11 volunteers were collected as 5 successive aliquots of 50 µL each and were transferred into 5 microfuge tubes. All tear samples were frozen at –80°C until analysis.

Human Corneal and Lacrimal Tissues
Ten postmortem human corneas, sepsis free and stored in solution (OptiSol; Chiron Vision, Irvine, CA), were obtained from the Eye Bank of Canada. Mean age of the donors was 44.4 years (range, 20–74 years). Epithelia from three human corneas were physically isolated for RNA and protein analysis. Briefly, the epithelium was scraped from the cornea with a corneal knife (Gill; Storz Instruments, Tuttlingen, Germany) under a dissecting microscope, ensuring that the scraping was confined to the corneal region to minimize any conjunctival or stromal contamination. Isolated epithelia were snap frozen in liquid nitrogen and stored at –80°C until analysis.

For RT-PCR analysis, sepsis free-human lacrimal gland biopsy specimens were obtained within 1 hour of surgery from four patients (two men, two women; median age, 37 years; range, 24–53 years) who had medical conditions (inflammation or tumor) requiring surgery. For protein extraction and immunohistologic analysis, healthy human lacrimal glands were obtained from the Department of Cellular and Molecular Medicine Anatomy Program (University of Ottawa) within 48 hours postmortem from four donors (three men, one woman; median age, 71 years; range, 51–89 years). Corneal and lacrimal biopsy specimens were obtained in accordance with the guidelines established by the Ottawa Hospital Research Ethics Board.

Human Corneal Epithelial Cells
The human corneal epithelial cell (HCEC) line, immortalized with a simian virus 40 (SV40) adenovirus recombinant vector,21 was maintained in keratinocyte serum-free medium (KSFM) (Invitrogen, Carlsbad, CA) supplemented with 0.05 mg/mL bovine pituitary extract and 5 ng/mL human recombinant epidermal growth factor (Invitrogen). Primary corneal epithelial cells derived from progenitors in the limbal-corneal region of human corneas were maintained in complete KSFM, supplemented with 100 U/mL penicillin, 100 µg/mL streptomycin, and 10 µg/mL gentamicin (Invitrogen). For differentiation, primary corneal epithelial cells or the HCEC line were grown to 100% confluence for 2 weeks in supplemented hormonal epithelial medium consisting of DMEM (low glucose)/F-12 (Invitrogen), 15% FBS, 10 ng/mL epidermal growth factor, 5 µg/mL insulin, 0.1 µg/mL cholera toxin alpha subunit, 5 mM L-glutamine, 0.5% dimethyl sulfoxide, and gentamicin. All cells were grown at 37°C in a humid environment containing 5% CO2; cell culture media were changed every 2 to 3 days. The stratification of primary corneal epithelial cells and the HCEC line on an air-liquid interface matrix was performed as previously described.22

CD14 and LBP Protein Quantification by ELISA
Collected tear samples were centrifuged for 5 minutes at 10,000g at 4°C to sediment any cellular and insoluble debris. The sCD14 and LBP concentrations in tears, cornea, lacrimal gland, primary cells, and HCEC extracts were measured by ELISA (HyCult Biotechnology, Uden, The Netherlands).

RNA Isolation and RT-PCR Analysis
Messenger RNA was isolated from lacrimal glands, scraped corneal epithelia, confluence-grown primary corneal epithelial cells, and the HCEC line (RNeasy Mini Kit; Qiagen, Chatsworth, CA). To ensure that all genomic DNA was completely removed from the samples, extracts were subjected to DNase digestion with the RNase-free DNase kit (Qiagen). Random primed cDNA synthesis was performed (Superscript First-Strand Synthesis for RT-PCR; Invitrogen) according to the manufacturer’s instructions. Oligonucleotide primers used to amplify CD14, LBP, TLR4, and MD-2 were designed based on the published sequences (GenBank accession numbers X06882, AF105067, U88880, and AB018549, respectively) and were as follows: CD14 sense, ACCACGCCAGAACCTTGTGAGCTGGA; CD14 antisense, TTAGGCAAAGCCCCGGGCCCCT; LBP sense, GCTGTTGAACCTCTTCCACAACCAG; LBP antisense, CTGAAGTTCAGGAGCGGAGCAGAG; TLR4, sense, ATGGCCTTCCTCTCCTGCGTGAGAC; TLR4 antisense, TCTGTGCAATAAATACTTTGAATCTTGTTGCTGG; and MD-2 sense, TTCCATATTTACTGAAGCTCAGAAGCAG; MD-2 antisense, GGGCTCCCAGAAATAGCTTCAAC. PCR was performed (REDExtract-N-Amp PCR Readymix; Sigma, St. Louis, MO) and was carried out with 35 cycles of denaturation at 94°C for 45 seconds, annealing at 59°C for 45 seconds, and extension at 72°C for 45 seconds. The resultant products were resolved by electrophoresis in ethidium bromide–stained 1% low-melt agarose gel. To further confirm the veracity of the RT-PCR products, the amplified sequences were purified with the QIAquick Gel Extraction Kit (Qiagen) and sequenced by the University of Ottawa Biotechnology Research Institute using the PCR primers.

Immunoblotting
Samples containing CD14 and LBP were resolved by SDS-PAGE under reducing conditions (12% resolving gel) and transferred onto nitrocellulose (Amersham Biosciences, Piscataway, NJ). The membrane was thereafter blocked for 1 hour in 5% dried skim milk in Tris-buffered saline (TBS) with 0.1% Tween-20. CD14 and LBP were probed with the biotinylated polyclonal anti–human CD14 (0.05 µg/mL in TBS-Tween; R&D Systems, Minneapolis, MN) or with the biotinylated polyclonal anti–human LBP (0.1 µg/mL in TBS-Tween; R&D Systems). After extensive washing, the membrane was incubated for 1 hour with the antibiotin horseradish peroxidase (HRP)–conjugated antibody (1:1000; Cell Signaling Technology, Beverly, MA). Antigens were detected using enhanced chemiluminescence (ECL Western Blotting Detection Reagents; Amersham Biosciences).

Immunofluorescence Staining
Human corneal epithelial cells were grown on a sterile microscope coverslip placed in a 6-well tissue culture plate. After reaching 70% to 80% confluence, cells were fixed with 3.7% paraformaldehyde for 20 minutes at room temperature (RT) and were permeabilized with 0.2% Triton X-100 for 20 minutes at RT. Human corneas and lacrimal glands were fixed overnight at 4°C in 4% paraformaldehyde. After overnight equilibration in 30% sucrose, they were incubated at RT for 2 hours in a 1:1 solution of 30% sucrose/optimum cutting temperature (OCT) embedding medium. Samples were flash frozen in sucrose/OCT embedding medium, cryosectioned to 10 µm on a Shandon cryostat (Thermo Electron Corporation, Waltham, MA), and mounted on Superfrost slides (Fisher Scientific, Nepean, ON, Canada). After they were air dried for 2 hours, slides were stored at –80°C until use.

For immunostaining, corneal and lacrimal cryosections were rehydrated in PBS for 10 minutes. All slides were blocked in 5% normal donkey serum (Jackson ImmunoResearch, West Grove, PA) for 1 hour at 37°C. For histologic localization of CD14 and LBP, the slides were incubated overnight at 4°C with 27.5 µg/mL mouse monoclonal anti-CD14 (MY4; Beckman Coulter, Miami, FL) in PBS containing 5% normal donkey serum and 0.3% Triton-X. Sections were thereafter overlaid with 0.7 µg/mL anti–LBP rabbit polyclonal antibody (HyCult Biotechnology) for 2 hours at 37°C. After extensive washing, the slides were incubated for 2 hours at 37°C with 30 µg/mL fluorescein isothiocyanate (FITC)–conjugated anti–mouse IgG and 30 µg/mL rhodamine red-X (RRX)–conjugated anti-rabbit IgG (Jackson ImmunoResearch). Corneal sections were further incubated with 2-minute fluorescence counterstaining (DAPI; Innogenex, San Ramon, CA) followed by mounting (Vectashield mounting medium; Vector Laboratories, Burlingame, CA) of the microscope slide. Sections were observed with a fluorescence microscope (Axioskop 2; Carl Zeiss, Thornwood, NY).

Immunohistologic localization of TLR4 and MD-2 was performed by blocking the rehydrated cryosections with 5% normal donkey serum (Jackson ImmunoResearch). TLR4 and MD-2 proteins were localized with 2 µg/mL biotinylated goat polyclonal anti-TLR4 (R&D Systems) and 8 µg/mL rabbit polyclonal anti–MD-2 (FL-160; Santa Cruz Biotechnology, Santa Cruz, CA) incubated for 2 hours at 37°C. After 3 washes in PBS, the sections were further incubated for 2 hours at 37°C with 32 µg/mL FITC-conjugated mouse monoclonal anti-biotin and 30 µg/mL RRX-conjugated anti–rabbit IgG (Jackson ImmunoResearch). Nuclei were visualized with DAPI staining, and the slides were mounted as described.

LPS Biologic Assays on Cultured Human Corneal Epithelial Cells
To quantify cytokine production, cultured primary corneal epithelial cells and the HCEC line were plated in 24-well flat-bottom tissue culture plates. After reaching approximately 70% to 80% confluence, the cells were left untreated or were preincubated with various doses of filter-sterilized pooled human tears, 500 ng/mL recombinant human sCD14 (R&D Systems), 150 ng/mL recombinant human LBP (R&D Systems), 10 µg/mL anti–human CD14 monoclonal antibody MY4 (mouse IgG2b; Beckman Coulter, Miami, FL), 10 µg/mL anti–human LBP monoclonal antibody 6G3 (mouse IgG1; HyCult Biotechnology), and 10 µg/mL of their isotype-matched controls MOPC-141 and MOPC-21, respectively (Sigma-Aldrich) for 2 hours at 37°C. To eliminate any potentially unwanted LPS contaminants affecting cytokine production, an assay of the gelatin of Limulus amebocyte lysate (Associates of Cape Cod, East Falmouth, MA) was performed to measure endotoxin levels in all reagents before they were added to the cells. Any reagent that tested positive for LPS was treated with END-X (Associates of Cape Cod) to remove residual endotoxin. With sCD14, LBP, tears, and antibodies still present in the medium, LPS derived from Pseudomonas aeruginosa serotype 10 (Sigma) was added at a concentration of 100 ng/mL to activate the cells. The medium was harvested after 24 hours, centrifuged to remove cellular debris, and stored at –70°C until analysis. Culture supernatants were analyzed by ELISA for IL-8 (Sanguin Reagents, Amsterdam, The Netherlands) and IL-6 (eBioscience, San Diego, CA).

Statistical Analysis
Experiments in this study were performed in triplicate to confirm the reproducibility of the results. Values are represented as mean ± SD. The statistical significance of differences between two or more means was evaluated using ANOVA; P < 0.01 (indicated by asterisks) was considered statistically significant.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Quantification of sCD14 and LBP in Human Tears
Both sCD14 and LBP proteins in onion vapor–stimulated tears from healthy donors were found to be present in all tear samples (n = 91), with a mean concentration of 561.1 ± 281.6 ng/mL for sCD14 (intra-assay variability, 2.3% CV and 135.8 ± 106.6 ng/mL for LBP (intra-assay variability, 4.8% CV). sCD14 and LBP levels varied from 35.4 to 1249.5 ng/mL and from 23.5 to 307.4 ng/mL, respectively. Linear regression and ANOVA revealed that age, sex, contact lens wear, and continuous tear stimulation had no influence on sCD14 and LBP values in reflex tears (Fig. 1 ; Table 1 ). Western blot analysis of representative tear samples showed that sCD14 exhibited an apparent molecular weight of 50 kDa (Fig. 2A , lane 4), characteristic of the secretory form of the protein.23 Immunoblotting also revealed the presence of the 60 kDa LBP protein in human tears, which corresponded to the same apparent molecular mass as serum LBP (Fig. 2A , lanes 4 and 2, respectively).



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 1. CD14 and LBP innate immune proteins are abundant in onion vapor–stimulated human tears. To investigate the effects of age on tear sCD14 (A) and LBP (B) concentration, both proteins were quantified by ELISA in tears of 67 non–contact lens wearers. (C) Five successive 50-µL aliquots from 11 donors were analyzed by ELISA to determine whether tear sCD14 and LBP levels vary with time after stimulation.

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Levels of sCD14 and LBP in Human Tears According to Sex and Contact Lens Wear

 


View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 2. The LPS receptor complex, CD14, LBP, TLR4, and MD-2 are expressed by the lacrimal gland and the corneal epithelium. (A) Lacrimal gland, tears, and corneal epithelium were analyzed by immunoblotting with anti–human CD14 and anti–human LBP polyclonal antibodies. (B) Detection of CD14, LBP, TLR4, and MD-2 mRNAs by RT-PCR from human lacrimal gland, isolated corneal epithelium, cultured corneal epithelial primary cells, and the immortalized human corneal epithelial HCEC cell line. Reactions were performed with and without the reverse transcriptase (RT) step to confirm the cDNA origin of the amplification.

 
CD14 and LBP Expression in Human Lacrimal Glands
Immunoblotting analysis was performed on human lacrimal gland extracts (n = 4) to determine the source of these tear immune proteins. Two polypeptides with molecular masses of 50 kDa and 55 kDa were detected with the anti–CD14 antibody, whereas a 60-kDa protein was identified as LBP with the anti-LBP antibody (Fig. 2A , lane 3). CD14 and LBP expression were further detected in human lacrimal glands by the amplification of both transcripts by RT-PCR (Fig. 2B) using human gene-specific primers. Partial sequencing of the RT-PCR products matched the CD14 and LBP published sequences (data not shown). Immunofluorescence detection of both proteins in human lacrimal glands (n = 4) showed CD14 and LBP to be localized in the cytoplasm of acinar cells constituting the alveoli of the serous gland (Figs. 3A 3B 3C) . Control sections omitting primary antibodies (Figs. 3I 3J 3K 3L) and cross-reactivity analysis of the secondary antibodies (Figs. 3M 3N 3O 3P) confirmed the specificity of labeling.



View larger version (94K):
[in this window]
[in a new window]
 
FIGURE 3. Immunolocalization of CD14, LBP, TLR4, and MD-2 in human lacrimal glands. (A, B) Double-immunofluorescence labeling using the monoclonal anti-CD14 (MY4) and the polyclonal anti-LBP antibodies. (C) CD14- and LBP-merged staining. Arrows: acinar cell nuclei: arrowhead: tear duct in the center of the alveoli. (D) Phase-contrast image of the tissue confirming the section integrity. (E, F) Double-labeling experiment using the biotinylated anti-TLR4 and the polyclonal anti–MD-2 antibodies. (G, H) TLR4- and MD-2–merged staining and phase-contrast image of the tissue. (IL) Secondary antibody controls were performed by omitting the primary antibodies. (MP) Cross-reactivity controls were performed by incubating the mouse primary antibody with the anti–rabbit secondary antibody and vice versa. Original magnification, x400.

 
Lacrimal Acinar Cells Express TLR4 and MD-2
Besides synthesizing and secreting sCD14 and LBP in tears, lacrimal acinar cells were found to express TLR4 and MD-2, as shown by RT-PCR (Fig. 2B) . For TLR4, however, three products were amplified using primers flanking the region between exons 1 and 4 of the gene. Sequencing of the amplified fragments confirmed the nature of the three splicing variants of human TLR4 (data not shown). The TLR4 transcript containing exons 1, 3, and 4, encoding the proper functional TLR4,24 was predominant in human lacrimal gland (Fig. 2B) . The two less abundant alternative splicing forms were unlikely to encode functional TLR4 because of premature translational termination of the protein.24 In lacrimal acinar cells, TLR4 and MD-2 proteins were found to be colocalized in situ by immunofluorescence (Figs. 3E 3F 3G) .

LPS-Receptor Complex Expression in the Human Corneal Epithelium
To examine whether LPS receptor proteins could complement tear contribution in the cornea, the expression of these proteins was investigated in this stratified tissue. Immunohistologic analysis of human corneas (n = 7) revealed that LBP is strongly expressed in the squamous superficial epithelium and in some columnar basal cells (Fig. 4B) . Negligible LBP staining was observed among wing cells composing the intermediate layer of the corneal epithelium. Corneal CD14 expression was sparse and mainly limited to the basal epithelial cells with an absence of staining in the superficial and wing cells (Fig. 4A) . In the basal epithelium, LBP and CD14 were not colocalized, suggesting they were expressed by different epithelial cells (Fig. 4C) . CD14 and LBP could also be detected by Western blotting in isolated corneal epithelia (Fig. 2A , lane 5), further confirming the immunofluorescence results. In contrast, TLR4 and MD-2 expression were polarized with ubiquitous staining along the basal and wing epithelial cells, with little or no expression in the superficial differentiated epithelium (Figs. 4E 4F) . Image overlay indicated that both proteins were expressed by the same cells (Fig. 4G) . To elucidate the origin of these proteins, the respective CD14, LBP, TLR4, and MD-2 mRNAs were detected by RT-PCR in the isolated human corneal epithelia (n = 3) (Fig. 2B) . Three splicing forms of human TLR4 were amplified from corneal epithelial cDNA, with the functional transcript composed of exons 1, 3, and 4 the most abundant.



View larger version (66K):
[in this window]
[in a new window]
 
FIGURE 4. Immunolocalization of CD14, LBP, TLR4, and MD-2 in human corneal epithelium. (A, B) Double-immunofluorescence labeling using the monoclonal anti–CD14 MY4 and the polyclonal anti-LBP antibodies. (C) CD14 and LBP staining were merged with the DAPI-stained nuclei. (D) Phase-contrast image of the tissue. Corneal organization is indicated as follows: S, superficial epithelial cells; W, wing epithelial cells; B, basal epithelial cells; BM, Bowman membrane; ST, stroma. (E, F) Double-labeling experiment using the biotinylated anti–TLR4 and the polyclonal anti–MD-2 antibodies. (G, H) Merged staining of TLR4 and MD-2 with DAPI, and phase-contrast image of the tissue. (IP) Secondary antibody controls and cross-reactivity controls were performed as previously described. Original magnification, x400.

 
Partial Expression of the LPS-Receptor Complex by Human Corneal Epithelial Cells and HCEC Line
To test the hypothesis that HCECs may express LPS receptor components to complement tear sCD14 and LBP, their expression was analyzed in vitro. CD14 mRNA was amplified by RT-PCR from freshly isolated primary corneal epithelial cells and from the HCEC line (Fig. 2B) . LBP mRNA was not detected in primary or HCEC cells (Fig. 2B) . These results were supported by immunofluorescence findings by which CD14, but not LBP, showed some reactivity in HCECs (Figs. 5A 5B 5C) and primary corneal epithelial cells (data not shown). ELISA on total cell lysate and culture supernatant indicated that CD14 was expressed by corneal epithelial cells but was not secreted (data not shown). LBP was not detected by ELISA in corneal epithelial cell lysate or culture supernatant, which suggested that it was not expressed by primary or HCEC cells in vitro. Cultures of primary corneal epithelial cells and HCECs differentiated in supplemented hormonal epithelial medium or stratified on an air–liquid interface matrix failed to induce LBP expression (data not shown). On the other hand, TLR4 and MD-2 were expressed in vitro, as confirmed by RT-PCR (Fig. 2B) and immunofluorescence (Figs. 5E 5F 5G) .



View larger version (66K):
[in this window]
[in a new window]
 
FIGURE 5. Immunolocalization of CD14, LBP, TLR4, and MD-2 in the HCEC line. (A, B) Double-immunofluorescence labeling using the monoclonal anti-CD14 (MY4) and the polyclonal anti-LBP antibodies. (C, D) CD14- and LBP-merged staining and phase-contrast image. (E, F) Double-labeling experiment using biotinylated anti–TLR4 and polyclonal anti–MD-2 antibodies. (G, H) TLR4- and MD-2–merged staining and phase-contrast image. (IP) Secondary antibody controls and cross-reactivity controls were performed as previously described. Similar expression pattern of the LPS receptor complex was observed with primary corneal epithelial cells (data not shown). Original magnification, x400.

 
Corneal Response to LPS in Presence of Tear CD14 and LBP
To assess the biologic relevance of tear sCD14 and LBP in the initiation of an endotoxin immune response, the secretion of proinflammatory molecules was analyzed in primary human corneal epithelial cells and the HCEC line challenged with Pseudomonas-derived LPS in the presence of sCD14, LBP, or human tears. In vitro cultures of primary corneal epithelial cells and the HCEC line expressed the LPS receptor components (Figs. 2B 5A 5B 5E 5F) similarly to basal and wing epithelial cells in vivo (Figs. 4A 4B 4E 4F) , suggesting that they may represent an adequate in vitro model system to study LPS responsiveness in amplifying cells. LPS alone had little effect on IL-6 and IL-8 secretion by primary corneal epithelial cells (Figs. 6A 6B) and the HCEC line (Figs. 6C 6D) , as previously observed,5 6 whereas the addition of recombinant sCD14 or LBP increased IL-6 and IL-8 production (Fig. 6) . However, no major difference was detected in IL-6 or IL-8 production whether sCD14 and LBP were added alone or were combined. This indicated that the two soluble proteins increased, individually or in concert, the efficiency of the LPS-induced response. Recombinant sCD14 and LBP-mediated activation was significantly abrogated by the neutralizing anti–CD14 MY4 and anti–LBP 6G3 antibodies, thus suggesting that both proteins contributed to this activity (Fig. 6) . Pooled human tears were also tested for enhancing LPS-mediated cytokine production. Tear sCD14 and LBP mediated the activation of primary and HCEC cells by endotoxin in a dose-dependant manner to produce IL-6 (Figs. 7A 7C) and IL-8 (Figs. 7B 7D) . The tear-induced production of IL-6 and IL-8 in primary corneal epithelial cells (Figs. 7A 7B) and the HCEC line (Figs. 7C 7D) was significantly inhibited by anti–CD14 MY4 and anti–LBP 6G3 antibodies, but not by their isotype-matched controls, therefore supporting the biologic activity of sCD14 and LBP in tears for mediating innate immunity.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 6. Enhanced LPS response of primary corneal epithelial cells and HCEC line in the presence of sCD14 and LBP. Primary corneal epithelial cells (A, B) and HCEC line (C, D) were pretreated with sCD14 and LBP (500 ng/mL and 150 ng/mL respectively, the average concentrations found in human tears), anti–CD14 monoclonal antibody MY4 (10 µg/mL), anti–LBP monoclonal antibody 6G3 (10 µg/mL), and their isotype-matched controls (IgG2b and IgG1, respectively, at 10 µg/mL each) before the addition of LPS from P. aeruginosa (100 ng/mL). The data shown correspond to three independent experiments. Statistically significant differences were determined using ANOVA (*P < 0.05; **P < 0.005).

 


View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 7. Enhanced LPS response of primary corneal epithelial cells and HCEC line in the presence of human tears. Primary corneal epithelial cells (A, B) and HCECs (C, D) were pretreated with various concentrations of pooled human tears, anti-CD14 monoclonal antibody MY4 (10 µg/mL), anti–LBP monoclonal antibody 6G3 (10 µg/mL), and their isotype-matched controls (IgG2b and IgG1, respectively, at 10 µg/mL each) before the addition of LPS from P. aeruginosa (100 ng/mL). The data shown correspond to three independent experiments. Statistically significant differences were determined using ANOVA (*P < 0.01).

 

    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
In this study, sCD14 and LBP—two LPS receptor proteins—were identified in tears and found to mediate an LPS-induced innate immune response within amplifying corneal epithelial cells. Although sCD14 has been identified in most human secretory fluids,25 26 27 28 the presence of LBP in tears is remarkable because it was undetectable25 26 28 or was present in trace amounts27 in other secretions. The dual presence of sCD14 and LBP in tears could be attributed to the extremely delicate structure of the cornea, requiring more sensitive detection of Gram-negative bacteria to eliminate any potential sight-threatening damages caused by infections. The broad concentration range of both proteins among different persons and the unchanged sCD14 and LBP levels between age groups, sex, and contact lens wear are consistent with those of other tear innate immune proteins, such as lactoferrin29 and lysozyme.30 In nonstimulated conditions, basal tears have been demonstrated to contain slightly higher levels of other immune proteins, such as lactoferrin, secretory IgA, and lysozyme, compared with reflex tears.31 Therefore, we suspect that sCD14 and LBP levels in basal tears may be slightly higher or equivalent to those measured in reflex tears, potentially making sCD14 and LBP constantly present on the surface of the eye, not only when reflex tears are induced.

The mRNA and protein detection of CD14 and LBP in the lacrimal gland suggests that acinar epithelial cells are a source of both proteins in human tears. Although LBP in reflex tears could also originate from additional sources, such as corneal superficial epithelial cells, the fact that reflex tears flow voluminously and quickly suggests that such a contribution would be minimal. In addition, the sole presence of the 50-kDa sCD14 isoform in human tears makes potential contributions from serum exudate unlikely because of the presence of two serum sCD14 isoforms, 50 kDa and 55 kDa.32 The 50-kDa sCD14 isoform in tears is likely to originate from the cleavage of a 55-kDa precursor32 that was present, in addition to the 50-kDa soluble isoform, in the lacrimal protein extract.

sCD14 and LBP within tears may serve a combination of roles. They may protect the lacrimal gland against Gram-negative infections. The abundance and variety of antimicrobial products synthesized and secreted by the lacrimal gland could help explain the infrequency of infections in this serous gland.33 Besides expressing sCD14 and LBP, lacrimal acinar cells express TLR4 and MD-2, enabling them to respond to Gram-negative insults threatening to compromise its function. In a similar manner, tear sCD14 and LBP may protect the downstream lacrimal sac and nasal epithelium against infection by tear drainage through the nasolacrimal duct. On the ocular surface, tear LBP and sCD14 may prevent the adherence of pathogens to the intact corneal epithelium. In keratitis, P. aeruginosa adheres to corneal epithelial cells through adhesins such as LPS, which is known to bind to specific corneal epithelial molecules such as asialo GM1 glycolipids,34 galectin-3,35 and CFTR.36 With their known opsonizing and neutralizing activities,37 38 tear LBP and sCD14 could bind and neutralize LPS on the surfaces of P. aeruginosa, thereby inhibiting its adhesion to the cornea. Furthermore, tear sCD14 and LBP could prevent shed LPS monomers from interacting with the intact corneal epithelium by transferring them to lactoferrin39 or lipoproteins,40 41 two proteins also found in human tears.2 42 The lactoferrin- and lipoprotein-bound LPS would no longer be available to interact with corneal epithelial cells and could be removed from the ocular surface by tears, eyelid blinking, and hydrodynamic flushing. In addition, LBP alone may mediate LPS detoxification by forming large LBP-LPS complexes that would subsequently be washed away with tears.43 Finally, as another mechanism, tear-derived LPS and sCD14 may function in combination with the epithelium to deliver LPS to the exposed inner epithelial layers of the breached corneal epithelium to mediate a stronger immune response, as described here.

The corneal epithelium expresses the LPS receptor complex in a manner that could minimize LPS responsiveness on its intact structure. Indeed, all the LPS receptor constituents required for an endotoxin response are expressed by basal and wing epithelial cells located in the inner corneal epithelial layers, with no CD14, TLR4, or MD-2 expression evident in the squamous apical layers. Such polarized expression has been noted for TLR57 and was proposed to prevent host detrimental inflammatory responses of the corneal epithelium against nonpathogenic ocular flora. The minute cytokine response mediated exclusively by LPS also correlated with previous findings.5 6 This observation could be attributed to the limited presence of CD14 or TLR4 on the surfaces of corneal epithelial cells5 or to their intracellular localization,6 minimizing their biologic response to LPS. In addition, superficial corneal epithelial cells expressing LBP may prevent P. aeruginosa adherence by releasing LBP in the outer corneal environment and saturating the LPS adhesins of the bacteria. LBP expressed by the apical epithelial layer of the cornea could also play an important role in LPS recognition in the injured corneal surface. As with IL-1{alpha},44 LBP stored in the cytoplasm of superficial epithelial cells may be passively released by the rupture of the cellular membrane caused by pathogens or trauma. LBP released by the damaged superficial cells could increase the LBP concentration in the wound microenvironment and improve LPS delivery to the exposed wing and basal epithelial cells to trigger an innate immune response. Alternatively, the receptor complex components, apparently strategically arranged within the corneal epithelium, may function in conjunction with those identified in tears for a more refined and regulated immune response.

Because of its anatomic localization, the corneal epithelium is constantly exposed to microorganisms and their virulence factors. A highly sensitive inflammatory response against pathogens, though beneficial in other organs, may affect corneal transparency. The infiltrating polymorphonuclear leukocytes (PMNs) and plasma proteins in the cornea can diffract and obstruct the visual axis, thus causing the focused image to be cast away from the retina.45 Persistent inflammation may also lead to permanent corneal destruction by scarring, perforation, and blindness.10 Thus, a system that minimizes hyperinflammation in response to minor infections yet is sufficiently sensitive to potentially dangerous infections would be advantageous for the corneal epithelium. The localization of LBP components within the layers of the corneal epithelium and the complementation of tears may mediate this response. Although the ocular surface is relatively resistant to microbial invasions, corneal surface injury disrupts the epithelial integrity, allowing the infiltration of pathogens into the epithelium.10 Proliferating primary corneal epithelial cells demonstrate some properties of amplifying basal epithelial cells in vivo.46 47 48 Within primary epithelial cells and HCECs, tear sCD14 and LBP were required for an efficient delivery of endotoxin to the LPS receptor molecules expressed by corneal epithelial cells and for the release of IL-6 and IL-8 cytokines. Extracellular LBP and sCD14 can complement and facilitate the transfer of LPS to CD14 and TLR4/MD-2.49 50 51 Previous studies performed in vivo on abraded mouse cornea showed that LPS induced cytokine expression, mediated neutrophil recruitment, and induced inflammation at the wound site.52 53 54 These studies support our data suggesting that LPS immune activation may occur when there is a breach in the squamous epithelial layer, allowing tear sCD14 and LBP to deliver LPS to TLR4/MD-2 located in the inner epithelial layers, thereby allowing them to generate an adequate immune response in conjunction with the innate properties of the stromal keratocytes.55

In summary, this study suggests that the combined roles of tear sCD14 and LBP, along with the polarized expression of the LPS receptor complex in the corneal epithelium, could explain ways in which corneal epithelial cells induce immune responses against infiltrating Gram-negative pathogens. Further understanding of the molecular interactions among tear sCD14 and LBP, Gram-negative pathogens, and corneal epithelial cells may lead to the development of efficient treatments to enhance ocular innate immune defenses and to prevent the sight-threatening consequences of severe Gram-negative infections.


    Acknowledgements
 
The authors thank all the volunteers who donated their tears; Amber R. Graystone for tear collection; George Mintsioulis for recruitment of tear donors; Steven M. Gilberg, Serge Bisson, and Max T. Hincke for assistance with lacrimal gland biopsies; and Julianne Staebler, Lionel G. Filion, and Ashok Kumar for helpful comments on the manuscript.


    Footnotes
 
Supported by the Natural Science and Engineering Research Council and The Rockefeller Foundation.

Submitted for publication May 1, 2005; revised June 9, 2005; accepted September 13, 2005.

Disclosure: D.R. Blais, None; S.G. Vascotto, None; M. Griffith, None; I. Altosaar, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Illimar Altosaar, Department of Biochemistry, Microbiology and Immunology, University of Ottawa, 451 Smyth Road, Ottawa, ON K1H 8M5, Canada; altosaar{at}uottawa.ca.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. Williams RC, Gibbons RJ. Inhibition of bacterial adherence by secretory immunoglobulin A: a mechanism of antigen disposal. Science. 1972;177:697–699.[Abstract/Free Full Text]
  2. Singh PK, Parsek MR, Greenberg EP, Welsh MJ. A component of innate immunity prevents bacterial biofilm development. Nature. 2002;417:552–555.[CrossRef][Medline][Order article via Infotrieve]
  3. Sack RA, Nunes I, Beaton A, Morris C. Host-defense mechanism of the ocular surfaces. Biosci Rep. 2001;21:463–480.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  4. Kurpakus-Wheater M, Kernacki KA, Hazlett LD. Maintaining corneal integrity how the "window" stays clear. Prog Histochem Cytochem. 2001;36:185–259.[Web of Science][Medline][Order article via Infotrieve]
  5. Song PI, Abraham TA, Park Y, et al. The expression of functional LPS receptor proteins CD14 and toll-like receptor 4 in human corneal cells. Invest Ophthalmol Vis Sci. 2001;42:2867–2877.[Abstract/Free Full Text]
  6. Ueta M, Nochi T, Jang MH, et al. Intracellularly expressed TLR2s and TLR4s contribution to an immunosilent environment at the ocular mucosal epithelium. J Immunol. 2004;173:3337–3347.[Abstract/Free Full Text]
  7. Zhang J, Xu K, Ambati B, Yu FS. Toll-like receptor 5-mediated corneal epithelial inflammatory responses to Pseudomonas aeruginosa flagellin. Invest Ophthalmol Vis Sci. 2003;44:4247–4254.[Abstract/Free Full Text]
  8. WHO. Data on blindness throughout the world. WHO Chronicle. 1979;33:275–283.[Web of Science][Medline][Order article via Infotrieve]
  9. Chang MA, Jain S, Azar DT. Infections following laser in situ keratomileusis: an integration of the published literature. Surv Ophthalmol. 2004;49:269–280.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  10. Hazlett LD. Corneal response to Pseudomonas aeruginosa infection. Prog Retin Eye Res. 2004;23:1–30.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  11. Bonnapasart S, Kasetsuwan N, Puangsricharem V, Pariyakanok L, Jittpoonkusol T. Infectious keratitis at King Chulalonghorn Memorial Hospital: a 12 year retrospective study of 391 cases. J Med Assoc Thai. 2002;85:S217–S230.
  12. Gioannini TL, Teghanemt A, Zhang D, et al. Isolation of an endotoxin-MD-2 complex that produces Toll-like receptor 4-dependent cell activation at picomolar concentrations. Proc Natl Acad Sci U S A. 2004;101:4186–4191.[Abstract/Free Full Text]
  13. Pugin J, Schurer-Maly CC, Leturcq D, et al. Lipopolysaccharide activation of human endothelial and epithelial cells is mediated by lipopolysaccharide-binding protein and soluble CD14. Proc Natl Acad Sci U S A. 1993;90:2744–2748.[Abstract/Free Full Text]
  14. Tobias PS, Soldau K, Gegner JA, Mintz D, Ulevitch RJ. Lipopolysaccharide binding protein-mediated complexation of lipopolysaccharide with soluble CD14. J Biol Chem. 1995;270:10482–10488.[Abstract/Free Full Text]
  15. Chow JC, Young DW, Golenbock DT, Christ WJ, Gusovsky F. Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction. J Biol Chem. 1999;274:10689–10692.[Abstract/Free Full Text]
  16. Nagai Y, Akashi S, Nagafuku M, et al. Essential role of MD-2 in LPS responsiveness and TLR4 distribution. Nat Immunol. 2002;3:667–672.[Web of Science][Medline][Order article via Infotrieve]
  17. Kennedy MN, Mullen GE, Leifer CA, et al. A complex of soluble MD-2 and lipopolysaccharide serves as an activating ligand for Toll-like receptor 4. J Biol Chem. 2004;279:34698–34704.[Abstract/Free Full Text]
  18. Pugin J, Stern-Voeffray S, Daubeuf B, et al. Soluble MD-2 activity in plasma from patients with severe sepsis and septic shock. Blood. 2004;104:4071–4079.[Abstract/Free Full Text]
  19. Jia HP, Kline JN, Penisten A, et al. Endotoxin responsiveness of human airway epithelia is limited by low expression of MD-2. Am J Physiol Lung Cell Mol Physiol. 2004;287:L428–L437.[Abstract/Free Full Text]
  20. McMonnies C, Ho A, Wakefield D. Optimum dry eye classification using questionnaire responses. Adv Exp Med Biol. 1998;438:835–838.[Web of Science][Medline][Order article via Infotrieve]
  21. Araki-Sasaki K, Ohashi Y, Sasabe T, et al. An SV40-immortalized human corneal epithelial cell line and its characterization. Invest Ophthalmol Vis Sci. 1995;36:614–621.[Abstract/Free Full Text]
  22. Suuronen EJ, Nakamura M, Watsky MA, et al. Innervated human corneal equivalents as in vitro models for nerve-target cell interactions. FASEB J. 2004;18:170–172.[Abstract/Free Full Text]
  23. Durieux JJ, Vita N, Popescu O, et al. The two soluble forms of the lipopolysaccharide receptor, CD14: characterization and release by normal human monocytes. Eur J Immunol. 1994;24:2006–2012.[Web of Science][Medline][Order article via Infotrieve]
  24. Rehli M, Poltorak A, Schwarzfischer L, et al. PU.1 and interferon consensus sequence-binding protein regulate the myeloid expression of the human Toll-like receptor 4 gene. J Biol Chem. 2000;275:9773–9781.[Abstract/Free Full Text]
  25. Bussolati B, David S, Cambi V, Tobias PS, Camussi G. Urinary soluble CD14 mediates human proximal tubular epithelial cell injury induced by LPS. Int J Mol Med. 2002;10:441–449.[Web of Science][Medline][Order article via Infotrieve]
  26. Harris CL, Vigar MA, Rey Nores JE, et al. The lipopolysaccharide co-receptor CD14 is present and functional in seminal plasma and expressed on spermatozoa. Immunology. 2001;104:317–323.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  27. Labeta MO, Vidal K, Nores JE, et al. Innate recognition of bacteria in human milk is mediated by a milk-derived highly expressed pattern recognition receptor, soluble CD14. J Exp Med. 2000;191:1807–1812.[Abstract/Free Full Text]
  28. Uehara A, Sugawara S, Watanabe K, et al. Constitutive expression of a bacterial pattern recognition receptor, CD14, in human salivary glands and secretion as a soluble form in saliva. Clin Diagn Lab Immunol. 2003;10:286–292.[Abstract/Free Full Text]
  29. Kijlstra A, Jeurissen SH, Koning KM. Lactoferrin levels in normal human tears. Br J Ophthalmol. 1983;67:199–202.[Abstract/Free Full Text]
  30. Seal DV. The effect of ageing and disease on tear constituents. Trans Ophthalmol Soc U K. 1985;104:355–362.
  31. Fullard RJ, Snyder C. Protein levels in nonstimulated and stimulated tears of normal human subjects. Invest Ophthalmol Vis Sci. 1990;31:1119–1126.[Abstract/Free Full Text]
  32. Labeta MO, Durieux JJ, Fernandez N, Herrmann R, Ferrara P. Release from a human monocyte-like cell line of two different soluble forms of the lipopolysaccharide receptor, CD14. Eur J Immunol. 1993;23:2144–2151.[Web of Science][Medline][Order article via Infotrieve]
  33. Patel N, Khalil HM, Amirfeyz R, Kaddour HS. Lacrimal gland abscess complicating acute sinusitis. Int J Pediatr Otorhinolaryngol. 2003;67:917–919.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  34. Gupta SK, Berk RS, Masinick S, Hazlett LD. Pili and lipopolysaccharide of Pseudomonas aeruginosa bind to the glycolipid asialo GM1. Infect Immun. 1994;62:4572–4579.[Abstract/Free Full Text]
  35. Gupta SK, Masinick S, Garrett M, Hazlett LD. Pseudomonas aeruginosa lipopolysaccharide binds galectin-3 and other human corneal epithelial proteins. Infect Immun. 1997;65:2747–2753.[Abstract]
  36. Zaidi TS, Lyczak J, Preston M, Pier GB. Cystic fibrosis transmembrane conductance regulator-mediated corneal epithelial cell ingestion of Pseudomonas aeruginosa is a key component in the pathogenesis of experimental murine keratitis. Infect Immun. 1999;67:1481–1492.[Abstract/Free Full Text]
  37. Gegner JA, Ulevitch RJ, Tobias PS. Lipopolysaccharide (LPS) signal transduction and clearance: dual roles for LPS binding protein and membrane CD14. J Biol Chem. 1995;270:5320–5325.[Abstract/Free Full Text]
  38. Wright SD, Tobias PS, Ulevitch RJ, Ramos RA. Lipopolysaccharide (LPS) binding protein opsonizes LPS-bearing particles for recognition by a novel receptor on macrophages. J Exp Med. 1989;170:1231–1241.[Abstract/Free Full Text]
  39. Baveye S, Elass E, Fernig DG, et al. Human lactoferrin interacts with soluble CD14 and inhibits expression of endothelial adhesion molecules, E-selectin and ICAM-1, induced by the CD14-lipopolysaccharide complex. Infect Immun. 2000;68:6519–6525.[Abstract/Free Full Text]
  40. Kitchens RL, Thompson PA, Viriyakosol S, O’Keefe GE, Munford RS. Plasma CD14 decreases monocyte responses to LPS by transferring cell-bound LPS to plasma lipoproteins. J Clin Invest. 2001;108:485–493.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  41. Vreugdenhil AC, Rousseau CH, Hartung T, et al. Lipopolysaccharide (LPS)-binding protein mediates LPS detoxification by chylomicrons. J Immunol. 2003;170:1399–1405.[Abstract/Free Full Text]
  42. Holzfeind P, Merschak P, Dieplinger H, Redl B. The human lacrimal gland synthesizes apolipoprotein D mRNA in addition to tear prealbumin mRNA, both species encoding members of the lipocalin superfamily. Exp Eye Res. 1995;61:495–500.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  43. Thompson PA, Tobias PS, Viriyakosol S, Kirkland TN, Kitchens RL. Lipopolysaccharide (LPS)-binding protein inhibits responses to cell-bound LPS. J Biol Chem. 2003;278:28367–28371.[Abstract/Free Full Text]
  44. Akpek EK, Gottsch JD. Immune defense at the ocular surface. Eye. 2003;17:949–956.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  45. Streilein JW. Ocular immune privilege: therapeutic opportunities from an experiment of nature. Nat Rev Immunol. 2003;3:879–889.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  46. Pellegrini G, Dellambra E, Golisano O, et al. p63 identifies keratinocyte stem cells. Proc Natl Acad Sci U S A. 2001;98:3156–3161.[Abstract/Free Full Text]
  47. Joseph A, Powell-Richards AO, Shanmuganathan VA, Dua HS. Epithelial cell characteristics of cultured human limbal explants. Br J Ophthalmol. 2004;88:393–398.[Abstract/Free Full Text]
  48. Kim HS, Jun Song X, de Paiva CS, et al. Phenotypic characterization of human corneal epithelial cells expanded ex vivo from limbal explant and single cell cultures. Exp Eye Res. 2004;79:41–49.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  49. Hailman E, Lichenstein HS, Wurfel MM, et al. Lipopolysaccharide (LPS)-binding protein accelerates the binding of LPS to CD14. J Exp Med. 1994;179:269–277.[Abstract/Free Full Text]
  50. Hailman E, Vasselon T, Kelley M, et al. Stimulation of macrophages and neutrophils by complexes of lipopolysaccharide and soluble CD14. J Immunol. 1996;156:4384–4390.[Abstract]
  51. Akashi S, Saitoh S, Wakabayashi Y, et al. Lipopolysaccharide interaction with cell surface Toll-like receptor 4-MD-2: higher affinity than that with MD-2 or CD14. J Exp Med. 2003;198:1035–1042.[Abstract/Free Full Text]
  52. Khatri S, Lass JH, Heinzel FP, et al. Regulation of endotoxin-induced keratitis by PECAM-1, MIP-2, and toll-like receptor 4. Invest Ophthalmol Vis Sci. 2002;43:2278–2284.[Abstract/Free Full Text]
  53. Johnson AC, Heinzel FP, Diaconu E, et al. Activation of toll-like receptor (TLR)2, TLR4, and TLR9 in the mammalian cornea induces MyD88-dependent corneal inflammation. Invest Ophthalmol Vis Sci. 2005;46:589–595.[Abstract/Free Full Text]
  54. Zhang J, Wu XY, Yu FSX. Inflammatory responses of corneal epithelial cells to Pseudomonas aeruginosa infection. Curr Eye Res. 2005;30:527–534.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  55. Kumagai N, Fukuda K, Fujitsu Y, et al. Lipopolysaccharide-induced expression of intercellular adhesion molecule-1 and chemokines in cultured human corneal fibroblasts. Invest Ophthalmol Vis Sci. 2005;46:114–120.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
IOVSHome page
Y. Sun and E. Pearlman
Inhibition of Corneal Inflammation by the TLR4 Antagonist Eritoran Tetrasodium (E5564)
Invest. Ophthalmol. Vis. Sci., March 1, 2009; 50(3): 1247 - 1254.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. R. Chinnery, E. C. Carlson, Y. Sun, M. Lin, S. H. Burnett, V. L. Perez, P. G. McMenamin, and E. Pearlman
Bone Marrow Chimeras and c-fms Conditional Ablation (Mafia) Mice Reveal an Essential Role for Resident Myeloid Cells in Lipopolysaccharide/TLR4-Induced Corneal Inflammation
J. Immunol., March 1, 2009; 182(5): 2738 - 2744.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. Yu, N. Sheung, E. M. Soliman, C. Spirli, and J. A. Dranoff
Transcriptional regulation of IL-6 in bile duct epithelia by extracellular ATP
Am J Physiol Gastrointest Liver Physiol, March 1, 2009; 296(3): G563 - G571.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Kumar, J. Yin, J. Zhang, and F.-S. X. Yu
Modulation of Corneal Epithelial Innate Immune Response to Pseudomonas Infection by Flagellin Pretreatment
Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4664 - 4670.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
Y. Sun, A. G. Hise, C. M. Kalsow, and E. Pearlman
Staphylococcus aureus-Induced Corneal Inflammation Is Dependent on Toll-Like Receptor 2 and Myeloid Differentiation Factor 88
Infect. Immun., September 1, 2006; 74(9): 5325 - 5332.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
F.-S. X. Yu and L. D. Hazlett
Toll-like Receptors and the Eye.
Invest. Ophthalmol. Vis. Sci., April 1, 2006; 47(4): 1255 - 1263.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (16)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blais, D. R.
Right arrow Articles by Altosaar, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blais, D. R.
Right arrow Articles by Altosaar, I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS