IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

(Investigative Ophthalmology and Visual Science. 2005;46:4409-4416.)
© 2005 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.05-0632
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mechoulam, H.
Right arrow Articles by Pierce, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mechoulam, H.
Right arrow Articles by Pierce, E. A.

Expression and Activation of STAT3 in Ischemia-Induced Retinopathy

Hadas Mechoulam and Eric A. Pierce

From the F. M. Kirby Center for Molecular Ophthalmology, Scheie Eye Institute, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Signal transducer and activator of transcription protein-3 (STAT3) is a transcription factor that participates in many biological processes, including tumor angiogenesis. The expression and activation of Stat3 in the mouse model of ischemia-induced retinal neovascularization was investigated to evaluate the possible role of STAT3 in retinal vascular disease.

METHODS. Retinal neovascularization was induced in mice pups by exposure to hyperoxia. Gene microarrays were used to identify genes whose expression in the retina is altered at postnatal day (P)12 and P18. The relative levels of Stat3 mRNA were determined by semiquantitative RT-PCR. Stat3 protein levels and the levels of the activated form of Stat3 (pStat3) at P12, P15, P18, and P22 were determined by immunoblot analysis. Stat3 and pStat3 were demonstrated by immunofluorescence in retinal sections at P12, P15, and P18.

RESULTS. In a series of microarray experiments, increased Stat3 mRNA levels in the retina were detected at P18. This result was validated by RT-PCR and demonstrated that Stat3 and pStat3 protein levels also increase during the development of neovascularization. Stat3 partially colocalized with blood vessels at the peak of neovascularization. pStat3 colocalized completely with blood vessels in both experimental samples and age-matched controls. pStat3 staining increased notably in the neovascular vessels at P15 and P18 and was more strongly associated with the epiretinal vessels than with inner retinal vessels. It was not detected in larger blood vessels, such as those of the optic nerve.

CONCLUSIONS. The level of Stat3 expression increased, and pStat3 was observed in association with retinal neovascularization. Activated Stat3 was preferentially localized to neovascular retinal vessels. These data suggest that STAT3 may have a role in proliferative retinopathy.

Ischemia-induced retinal neovascularization is common to many ocular diseases, such as diabetic retinopathy, retinopathy of prematurity, and central retinal vein occlusion. Taken together, these diseases are a major cause of vision loss throughout the Western world.1 The development of retinal neovascularization is thought to be the result of a complex interplay among many factors.2 Vascular endothelial growth factor (VEGF) is a major oxygen-regulated mediator of angiogenesis.3 Many other growth factors, such as growth hormone and insulin-like growth factor (IGF)-1, transforming growth factor (TGF), basic fibroblast growth factor (bFGF), and hepatocyte growth factor (HGF) have been implicated in the neovascular process. Other compounds, such as adenosine, nitric-oxide, IL-8 and angiopoietin-2 also play a role in the angiogenic cascade (for reviews see Refs. 4 5 6 ). Integrins and their ligands, the matrix metalloproteinases, facilitate the degradation of basement membrane at the time of blood vessel growth and are also considered an important common pathway in the process of retinal neovascularization.7 These angiogenic factors depend on signal transduction mechanisms to exert their effects. For example, VEGF signaling is complex and occurs through a combination of phosphorylation and protein kinase activation.8 9 10 Further investigation is necessary to delineate the details of the signaling pathways involved in the process of abnormal retinal blood vessel growth in retinal vascular diseases.

Signal transducer and activator of transcription protein-3 (STAT3) is a transcription factor that participates in many biological processes, especially those of cell survival and proliferation. It was originally isolated from cytokine-induced cell culture and has since been found in many normal and pathologic tissues. Targeted disruption of Stat3 in mice results in early embryonic lethality, suggesting an important role in embryonic development.11 12 Tissue-specific Stat3 deletions demonstrate its importance in survival processes.13 14 STAT3 exerts positive regulation on cell growth and is constitutively activated in various types of tumors, including leukemia, breast, prostate, and head and neck (for review, see Ref. 15 ). Furthermore, constitutively activated STAT3 has been shown to induce cellular transformation and tumor formation.16

STAT3 is activated by phosphorylation at tyrosine 705. Phosphorylated STATs dimerize and translocate from the cytoplasm to the nucleus, where they activate transcription.17 18 Tyrosine phosphorylation of STATs, which is mediated mostly through Janus kinases (JAKs), was observed in response to epidermal growth factor and interleukin-6, as well as other cytokines, such as leukemia inhibitory factor, oncostatin M, and ciliary neurotrophic factor, whose receptors share the IL-6 receptor signal transducer gp130.19 Another phosphorylation site, serine 727, probably enhances transcription after DNA binding.20

STAT3 was implicated in mediating mitogenic, antiapoptotic, and angiogenic effects of leptin,21 hepatocyte growth factor,22 and IL-1123 in endothelial cells, and the cytoprotective effect of IL-6 and IL-11 on endothelial cells exposed to hyperoxia.24 In contrast, IL-6 was shown to inhibit endothelial cell proliferation and VEGF-induced angiogenesis in the rabbit cornea through STAT3,25 suggesting that activated STAT3 has a dual role in the regulation of angiogenesis.

STAT3 has been shown to participate in known pathways of tumor angiogenesis. Activated STAT3 was shown to upregulate directly the expression of VEGF, a key mediator of angiogenesis, in human cancer cell lines and in vivo, through a STAT3-binding site on the VEGF promoter.26 27 A recent publication demonstrates that hypoxia-inducible factor (HIF)-1{alpha} and activated STAT3 bind simultaneously to the VEGF promoter, and the binding of both may be necessary for maximum transcription of VEGF after hypoxia.28 Inhibition of STAT3 in cell cultures using a dominant-negative STAT3 mutant or antisense oligonucleotides caused a significant downregulation in VEGF expression.26 29 Constitutively active STAT3 enhances VEGF expression, angiogenesis, tumor growth, and metastasis in pancreatic tumors, whereas STAT3 blockade directly suppresses angiogenesis and hence tumor growth and metastasis.30 Because VEGF is induced by many tyrosine kinases, some of which are known to activate STAT3, it is possible that STAT3 is a common pathway to tyrosine kinase-mediated VEGF induction.

STAT3 is present in the eye and specifically in the retina, although its role there has not been determined. Stat3 was demonstrated in the developing lens vesicle of the mouse eye at E11, and in the retina and RPE at E14. With the progress of retinal development, the expression of both Stat3 and phosphorylated (p)Stat3 shifted almost entirely to the outer neuroblast layer at P1, a stage at which most of the cells will become rod photoreceptors or bipolar cells.31 Stat3 has recently been shown to regulate rod photoreceptor differentiation in the mouse.32 With further development of the photoreceptor layer, the amounts of Stat3 and pStat3 gradually declined, and at p7 it was demonstrated only in the ganglion cell layer, the outer plexiform layer, and the outer segment. In the adult retina, Stat3 is localized to the inner nuclear layer and to ganglion cells.31 STAT3 has been suggested to serve as a transducer of stress signals in neurons of the adult retina. It has been shown to be activated by ciliary neurotrophic factor (CNTF) in retinal neurons and glia and in response to subtoxic bright light, mechanical trauma, and systemic xylazine.33

Given the role of STAT3 in tumor angiogenesis and its expression in the retina, we evaluated the potential role of STAT3 in a model of ischemia-induced retinal neovascularization. Stat3 expression and activation were increased in the neovascular retina, and activated Stat3 was localized to retinal blood vessels—in particular to neovascular vessels.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Oxygen-Induced Retinopathy Model
All use of animals conformed to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the guidelines of the University of Pennsylvania in Animal Care and Use. Five-day-old C57BL/6 mice were obtained from Taconic Farms (Germantown, NY). Ischemic retinopathy was produced by a previously described method.34 Briefly, 7-day-old (p7) mice were exposed to 75% oxygen for 5 days and then returned to room air. Oxygen levels in the chamber were monitored continuously. Aged-matched mice that were not exposed to oxygen were used as control subjects. Retinas were removed after an overdose of pentobarbital immediately after removal from the oxygen chamber at P12; 6 hours after return to room air; and at P13, P15, P18, and P22. Retinas were immediately frozen in –80°C. At least one eye from each litter was used to demonstrate neovascularization histologically at P18. Each RNA sample contained six retinas from three mice. Protein samples contained four retinas each. Separate samples were used for microarrays, RT-PCR, and Western blot analyses.

RNA Isolation and Microarray Analysis
To isolate RNA, retinas were homogenized in extraction reagent (TRIzol; Invitrogen-Life Technologies, Carlsbad, CA), extracted with chloroform, and the aqueous phase was precipitated in isopropanol. The pellet was washed with 75% ethanol, dissolved in water, and frozen at –80°C. The concentration and quality of the RNA were assessed by spectroscopy and RNA integrity was assessed by electrophoresis.

For hybridization with microarrays, the Affymetrix (Santa Clara, CA) protocol was followed. Briefly, biotin-labeled fragmented cRNA was produced from 8 µg of each RNA sample. The samples were hybridized to Murine Genome U74 oligonucleotide arrays at 45°C for 16 hours and then washed and stained according to the manufacturer’s instructions (GeneChip Fluidics; Affymetrix). These arrays contain approximately 12,000 mouse genes and expressed sequence tags (ESTs) from the UniGene Database (http://www.ncbi.nlm.nih.gov/UniGene; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD). After washing and staining, the arrays were scanned with an epifluorescent confocal scanner (Genearray; Agilent, Palo Alto, CA).

Probe Profiler was used for normalization of the results and to determine microarray quality.35 Two nonparametric methods were used to analyze the normalized microarray data. Significance analysis of microarray (SAM) was used for two-sided comparisons, using 400 permutations and a varying delta.36 The Mann-Whitney comparison was also applied to the data, by using the smallest available probability according to the number of microarray replicates.

RT-PCR Analysis
First-strand cDNA synthesis was performed (Superscript II Reverse Transcriptase [RT]; Invitrogen-Life Technologies). A 24-µL reaction containing 1 µg RNA, 1 µg oligodT, or 0.5 µg random hexamers and 40 mM dNTP was incubated in 65°C for 5 minutes. Eight microliters of 5x RT buffer, 4 µL 0.1 M dithiothreitol (DTT), and 80 units RNase inhibitor were added and incubated in 42°C for 2 minutes. The reaction was then performed using 400 units of RT at 42°C for 50 minutes, followed by 10 minutes in 70°C. cDNA was used immediately for PCR, or stored at –20°C.

Real-time PCR was performed with a sequence-detection system (model 7000; Applied Biosystems, Inc. [ABI], Foster City, CA). Twenty-five-microliter reactions with 12.5 µL PCR mix (SYBR green; ABI), 1 mM of each primer and five dilutions of cDNA (0.0625–1 µg) were used. 18S was used as an internal control. The cycling parameters were optimized as follows: start at 60°C for 2 minutes, followed by activation at 95°C for 10 minutes, denaturing at 95°C for 15 seconds, annealing at 60°C for 40 seconds, and elongation at 72°C for 45 seconds, repeated for 40 amplification cycles. Dissociation curves were determined for PCR products, to rule out signal from primer dimers and other nonspecific dsDNA species. Samples were also subjected to agarose gel electrophoresis to verify production of the correctly sized PCR product.

Primers for Stat3 PCR were designed on computer (DNAstar, Inc., Madison, WI; adjusted with Primer Express software; ABI). PCR with primer pairs spanning an intron were used to rule out DNA contamination. The Stat3 forward primer was 5'ACCCAACAGCCGCCGTAG 3', and the reverse primer was 5'CAGACTGGTTGTTTCCATTCAGAT 3'. Expected product size was 192 bp. Primers were obtained from the Nucleic Acid Facility of the University of Pennsylvania.

Protein Extracts and Western Blot Analysis
Normal and hyperoxia-exposed mouse retinas were dissected at P12, P13, P15, P18, and P22 and frozen immediately at –80°C. Total protein extracts of retinas from each time point were prepared with sample buffer (NuPage LDS; Invitrogen-Life Technologies, Gaithersburg, MD). Protein samples were boiled and spun at 10,000g for 10 minutes, and the protein concentration was estimated with a Bradford assay37 (Bio-Rad Laboratories, Hercules, CA). Fifty micrograms of supernatant of each protein sample were separated by SDS-PAGE (NuPage 4%–12% gels; Invitrogen-Life Technologies) according to the manufacturer’s protocol. Controls for STAT3 and pSTAT3 were included on each gel (10 µL; Cell Signaling Technology, Beverly, MA). Proteins were then transferred electrophoretically to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked for 1 hour in TBS-T solution (50 mM Tris-HCl [pH 7.4], 150 mM sodium chloride, and 0.1% Tween-20), containing 10% nonfat dry milk and 5% normal goat serum, and incubated with STAT3 C-20 antibody (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA) or Phosph-STAT3 (Tyr705) antibody (1:1000; Cell Signaling Technology) in blocking solution overnight at 4°C. Antibody binding was detected with alkaline phosphatase–conjugated anti-rabbit antibody (1:10,000; Vector Laboratories, Burlingame, CA) and enhanced chemifluorescence (ECF) substrate (GE Healthcare, Piscataway, NJ). Blot signals were visualized by fluorometry (Storm 860 Imager; Molecular Dynamics, Sunnyvale, CA) and quantitated (ImageQuant, ver. 5.2; Molecular Dynamics). Internal loading controls were not used because both ERK and actin were differentially expressed in the microarray results, suggesting they were not appropriate controls. Instead, 4 blots from different samples were averaged for the final result (see Figure 2 ).



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 2. Western blot analysis showing increased Stat3 protein and pStat3 in P18 retinas after exposure to oxygen. Equal amounts of protein from the postnatal time points indicated were subjected to Western blot analysis. The blots were probed with (A) anti-STAT3 antibody or (B) anti-pSTAT3 antibody. For each blot, lane 1: pSTAT3 control; lane 2: STAT3 control. (C) Plot of relative Stat3 protein levels detected in two to four blots. Protein levels at the different time points are shown in units of the protein level at the P12 control, which is denoted as 1. The level of Stat3 in the oxygen-exposed retinas at P18 was significantly elevated compared with the P18 control (*P < 0.01). Data are the mean ± SD.

 
Preparation of Tissue Sections and Immunostaining Analysis
Eyes of normal and hyperoxia-exposed P12, P15, and P18 mice were dissected after cardiac perfusion with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) and fixed for 4 hours at 4°C. Fixed eye cups were infiltrated overnight with 30% sucrose in the same buffer, embedded in tissue freezing medium (Triangle Biomedical Sciences, Durham, NC), and cryosectioned at 10 µm. For immunostaining, retinal sections were pretreated with a blocking solution (1% normal goat serum, 1% bovine serum albumin, and 0.05% Triton X-100 in PBS [pH 7.4]) for 1 hour at room temperature and then incubated with primary antibody (STAT3 antibody or p-STAT3 antibody) diluted 1:100 in PBS with 0.3% Triton X-100 overnight at 4°C. After PBS rinse, the sections were treated with Cy3-conjugated goat anti-rabbit IgG (1:100; Jackson ImmunoResearch Laboratories, West Grove, PA), in PBS for 1 hour at room temperature. Slides were then washed in PBS and incubated in fluorescein Griffonia simplicifolia lectin, isolectin B4 (Vector Laboratories) for 20 minutes, washed in PBS, and mounted (Fluoromount-G; Southern Biotechnology Associates, Birmingham, AL). Preabsorption tests were performed by preincubating the diluted anti-STAT3 antibody with blocking peptide for 1 hour before the immunostaining procedures. Sections were viewed with a microscope equipped for epifluorescence (model TE300; NikonUSA, Melville, NY). Images were captured with a digital camera (Spot; Diagnostic Instruments, Sterling Heights, MI). Some sections were also evaluated with confocal microscopy (model LSM510; Carl Zeiss Meditec, Dublin, CA).


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
STAT3 mRNA in Retinal Neovascularization
To help delineate the proteins involved in the neovascular response of the retina to ischemia, we compared gene expression profiles in mouse retinas of oxygen-induced neovascularization versus age-matched control subjects. A total of 22 arrays from three time points were compared, including 4 arrays each from P12 control, P12+0 hour experiment, and P12+6 hour experiment, and 5 samples each from the P18 control and experiment groups. One P12 control microarray was an outlier and was not included in the analysis. Nonparametric (Mann-Whitney) analysis of the microarrays was overlapped with SAM analysis. SAM assigns a score to each gene in the microarray on the basis of change in gene expression relative to the SD of repeated measurements. For genes with scores greater than an adjustable threshold, SAM uses permutations of the repeated measurements to estimate the percentage of genes identified by chance, or the false discovery rate. The Mann-Whitney comparison was also applied to the data using the smallest available probability, according to the number of microarray replicates. To eliminate false-positive results that are inherent to the microarray technique, we overlapped the lists generated by the two analysis methods.

A total of 53 genes were found to be differentially expressed in the neovascular retinas using the analysis methods described (Mechoulam H, Pierce EA, manuscript in preparation). Stat3 was found to be upregulated at P18 in the neovascular retinas (1.36-fold, P < 0.001; Fig. 1 ). The Stat3 mRNA expression level at P12 (control and both experimental groups) was similar to the expression level at P18 control (Fig. 1) . The microarray result was validated by quantitative RT-PCR in five separate samples of mRNA, using 18S as an internal control. The Stat3 mRNA level in the neovascular retinas at P18 was elevated twofold (0.99 cycle difference, P < 0.05) compared with the P18 controls. At P15, there was a similar trend showing an elevation of 0.47 cycle (P = 0.2) in the neovascular sample compared with its age-matched control. Stat3 control levels were not significantly different among time points (P12, P15, and P18).



View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 1. Microarray results for Stat3 mRNA levels. Normalized levels of Stat3 in 22 microchips (4 microchips at each P12 time point, five microchips at P18 time points). The level at P18 in the oxygen-exposed groups was significantly elevated compared with the control at P18 (*P < 0.001 in Mann-Whitney comparison). Data are the mean ± SD mRNA levels at the different time points and are shown in units of the mRNA level at the P12 control, which is denoted as 1. P12 and P18 Control, age-matched controls; P12 NV, exposed to oxygen from P7 to P12; P12+6hr NV, oxygen exposed from P7 to P12, returned to room air for 6 hours; P18 NV, oxygen exposed from P7 to P12, returned to room air from P12 to P18.

 
STAT3 and pSTAT3 Levels at P18
To determine whether the increased mRNA levels are reflected in increased protein levels, we evaluated Stat3 protein levels in the retinas of animals at different time points during the development of retinal neovascularization (P12, P13, P15, P18, and P22). Samples from age-matched control subjects were included at each time point. The anti-STAT3 antibody recognized control STAT3 and pSTAT3 proteins (Fig. 2A , lanes 1, 2), and these signals were blocked by preincubation of the antibody with blocking STAT3 peptide (data not shown). As shown in Figure 2 , a marked elevation of Stat3 protein was demonstrated in the experimental sample at P18, when neovascularization is maximal in this model (Fig. 2A , lane 7). Quantitative analysis of the Western blot signals from four independent blot-analysis experiments indicated that Stat3 protein was elevated 2.3-fold in the neovascular sample at P18 compared with the control at P18 (P < 0.05) and 2.8-fold from the control at P12 (P < 0.05). The protein level had decreased at P22, to 1.2-fold of the control at P12 (Fig. 2C) .

Since STAT3 is activated by phosphorylation at Tyr705, we also evaluated the level of pStat3 in the retinas of mice with oxygen-induced retinopathy. Western blot analysis showed that the anti-pSTAT3 antibody used recognized only the phosphorylated form of STAT3, not the control STAT3 protein (Fig. 2B , lanes 1, 2). A significant amount of pStat3 was detected only in P18 retinas with maximum neovascularization (Fig. 2B , lane 7). Because signal was not present in other lanes, the extent of the increase in pStat3 could not be calculated.

Increased STAT3 and pSTAT3 Expression in Neovascular Vessels
To determine the location of the increased Stat3 and pStat3 expression in the retina, we performed immunofluorescence microscopy on frozen sections using labeled G. simplicifolia lectin as a marker for blood vessels.38 At P12, Stat3 was localized mainly to the internal plexiform layer (IPL) in both oxygen exposed and control retinas (Fig. 3A) . Stat3 was also demonstrated in the base of the inner nuclear layer (INL). These signals decreased with time, as seen at P15 and P18 (Fig. 3B 3C) . At P15, blood vessels in the inner retina were stained, especially in the neovascular sample. Vessel staining increased in the neovascular retina at P18. Double staining of a section of P15 experimental retina with antibodies to STAT3 and G. simplicifolia lectin, which detects vascular endothelial cells, showed partial colocalization, indicating that the increased Stat3 protein is present in both vascular and nonvascular cells (Fig. 3D) . Signal was not detected after incubation of the antibody with a blocking peptide (results not shown).



View larger version (64K):
[in this window]
[in a new window]
  		FIGURE 3. Stat3 labeling of retinal blood vessels is increased with time and Stat3 labeling of the inner plexiform layer (IPL) is decreased with time. Frozen sections of retinas from experimental (left) and control (right) mice at different time points were probed with anti-STAT3 antibodies: (A) P12; (B) P15; and (C) P18. (D) A section of retina from P15 experimental animals was probed with antibodies to STAT3 (red, middle) and G. simplicifolia lectin (green, left). A merged image (right) demonstrates partial colocalization of Stat3 with lectin in retinal blood vessels. Lectin staining showed that retinal blood vessels were located near the inner surface of the retina at all three time points (arrows; not shown for P12). INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer. Magnification, x200.

 
In contrast to Stat3, activated pStat3 staining colocalized almost perfectly with lectin in normal retinal blood vessels at P12, P15, and P18 (Fig. 4) . In the retinas of mice exposed to oxygen, blood vessels were not apparent at P12, and no specific pStat3 staining was noted (Fig. 4A) . pStat3 staining increased notably in retinal neovascularization at P15 and P18, and was more strongly associated with the epiretinal vessels than with inner vessels (Figs. 4C 4E) . The pStat3 signal was located in vascular cells, as indicated by the yellow-orange signal in the merged images (Fig. 4 , right panel). In the normal controls, pStat3 was detected in some retinal vessels, and at the base of the inner nuclear and outer nuclear layers throughout the retinas (Figs. 4B 4D 4F) . Only inner retinal blood vessels were labeled with anti-pStat3 antibodies; vessels outside the retina, such as those in the optic nerve, did not demonstrate pStat3 (Fig. 5) . The intracellular location of pStat3 in retinal vessels was determined by confocal immunomicroscopy. Some nuclear localization was detected in endothelial cells of the neovascular retinas at P15 and P18. However, in most endothelial cells, the labeling was concentrated in the cytoplasm and around the nucleus (results not shown).



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 4. Localization of pStat3 in retinal blood vessels. Frozen sections of retinas from experimental (A, C, E) and control (B, D, F) mice at different time points were probed with anti-pSTAT3 antibodies (red, middle) and lectin (green, left). Merged images are shown on the right. (A, B) P12; (C, D) P15; and (E, F) P18. In the experimental samples, pStat3 labeling increased with the development of neovascularization, and colocalized exactly with lectin-stained vessels. Colocalization of signals is indicated by the yellow-orange signal in the merged images (right). In contrast, pStat3 staining was not as extensive in control samples, although, where present, it colocalized with vessels. INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer. Magnification, x200.

 


View larger version (11K):
[in this window]
[in a new window]
  		FIGURE 5. pStat3 is localized to the retinal microvasculature, but not larger vessels. A section of retina and optic nerve from an experimental P15 animal was stained with anti-pSTAT3 antibodies (red, middle) and labeled lectin (green, left). A merged image is shown on the right. pStat3 was detected in the retinal vessels (arrow), but not in the larger vessels of the optic nerve (asterisk). Magnification x200.

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
The data demonstrate that production of Stat3 is upregulated during the development of retinal neovascularization. The increased Stat3 is activated by phosphorylation when neovascularization is at its maximum in the model used. The pStat3 especially concentrated in pathologic vessels. Consistent with this activation, some pStat3 was detected in the nuclei of endothelial cells in the neovascular vessels. Based on these data, we propose that STAT3 may help mediate proliferation of blood vessels in the neovascular retinas.

STAT3 is a transcription factor that mediates the growth-promoting activity of angiogenic growth factors, such as VEGF,26 hepatocyte growth factor,22 and platelet-derived growth factor, as well as the activity of other compounds such as IL-6 and leptin.21 These angiogenic factors function by binding to receptors, which have tyrosine kinase activities. STAT3 is activated by these tyrosine kinases and in response to activation translocates into the nucleus to stimulate the expression of survival and proliferation genes (for reviews, see Refs. 19 39 ). STAT3 is thus speculated to be a point of convergence for several angiogenic factor–signaling pathways in tumors. We hypothesize that this may also be true in retinal vascular diseases. Given its position as a central step in the angiogenic cascade, STAT3 may be a good target for pharmacologic modulation of angiogenesis. This may be particularly true for retinal neovascularization, given the observed concentration of pStat3 in pathologic vessels.

In the oxygen-induced retinopathy model used for these studies, angiogenesis is considered to be secondary to hypoxia-induced stimulation of angiogenic factor production.40 41 For example, expression of VEGF mRNA was shown to be increased after 6 to 12 hours of relative retinal hypoxia and remained elevated during the development of neovascularization.42 In contrast, the elevations in Stat3 mRNA and protein and in pStat3 protein were observed at the peak of neovascularization, and not at earlier time points, suggesting it is a late step in the angiogenic cascade. The timing of STAT3 production may reflect its location "downstream" of growth factors in the angiogenic cascade.

STAT3 has also been shown to be elevated and activated by hypoxia in several other model systems. In the brain, STAT3 is upregulated and activated in microglia, astrocytes, and neurons after transient ischemia for 2 hours, followed by reperfusion. There appears to be a temporal sequence to the upregulation of STAT3 in different cells in this model of ischemia and reperfusion. STAT3 in neurons and astrocytes was activated rapidly, starting 1 hour after reperfusion. In microglia STAT3 was upregulated 4 days after the ischemic insult, concomitant with the inflammatory reaction, rather than with the earlier stress reaction.43 44 Rapid activation of STAT3 in response to ischemia and reperfusion in myocardial tissue was postulated to mediate ischemic preconditioning that protects the heart against subsequent ischemia.45 The timing of STAT3 activation in the retinal endothelium, after 5 days of relative hypoxia, is comparable to STAT3 activation time in brain microglia, even though inflammation is not known to play a major role in oxygen-induced retinopathy. The different duration and resolution of hypoxia in the models may also account for the distinctive times of expression and activation of STAT3.

pStat3 was demonstrated in situ in epiretinal vessels throughout the retina, whereas intraretinal vessels did not stain uniformly for pStat3. Similarly, pStat3 was not found in larger vessels in the optic nerve. This observation can be explained by the exposure of the epiretinal vessels to angiogenic growth factors that activate STAT3. In the intraretinal vessels, that do not undergo excessive proliferation, Stat3 was not uniformly activated, possibly because of inconsistent exposure to angiogenic activating kinases. In larger vessels, Stat3 was not activated, either because it was not exposed to tyrosine kinases or because of certain qualities of these endothelial cells, as was suggested recently. Bartoli et al.46 showed VEGF-induced activation and nuclear translocation of STAT3 in retinal endothelial cells in vitro. This effect was shown to be linked to VEGFR2/STAT3 complex formation and did not occur in bovine aortic endothelial cells (BAECs), where the VEGFR2/STAT3 complex was not demonstrated. It is possible that the endothelial cells of the larger vessels of the optic nerve in our study have qualities similar to those of BAECs. The presence of activated Stat3 in retinal blood vessels, and specifically in the neovascular vessels, suggests a role of pSTAT3 in their growth. Its absence from larger vessels indicates that STAT3 may not be necessary for blood vessel survival and therefore could be an especially suitable target for antiangiogenic treatments.

After activation, STAT3 is translocated to the nucleus, where it exerts its function as a transcription factor. Although some translocation was noted in the neovascular samples, we could not demonstrate it throughout the sections. A recent study reporting nuclear translocation of STAT3 in response to VEGF showed that pSTAT3 remained in the nucleus for only a short time.46 In our study, only thin sections of cells were examined at two distant time points, possibly decreasing our ability to demonstrate STAT3 translocation. Still, the nuclear presence of STAT3 is essential for its function, and should be studied further in the retina.

Based on the data presented, we suggest that STAT3 has a role in the proliferation of retinal blood vessels. However, two other options are possible. STAT3 may have no functional role in angiogenesis and may have been elevated in our study because it is present in blood vessels, more of which are present at P18. This seems unlikely because of the concentration of pSTAT3 in pathologic vessels, and the known functions of STAT3 in tumor angiogenesis.15 It is also possible that STAT3 is involved in the regression of neovascularization, which begins after P17 to P20 in the mouse model.34 The function of STAT3 as a negative modulator of angiogenesis was suggested by one report that indicated that the inhibitory role of IL-6 on angiogenesis and endothelial cell proliferation and on VEGF-induced angiogenesis in the rabbit cornea is mediated through STAT3.25 However, if STAT3 were involved in the regression of retinal neovascularization, we would expect it to be elevated later, at P22, when the neovascular vessels are regressing in the model used. Because this was not observed, it appears less likely that STAT3 is involved in the regression of the neovascular vessels.

The analysis of gene expression microarrays is complex, and often, the multiple of change (x-fold) is used to find differentially expressed genes. Because this method is controversial, and changes in expression as small as 1.2-fold can be highly significant,47 we chose to overlap two other methods of analysis: nonparametric analysis and SAM. Stat3 was found to be significantly elevated in our experimental group at P18, although it was elevated by only 1.3-fold. Is this a biologically significant change in expression? Our data suggest that it is. The small increase in mRNA level translated into a larger change in protein expression, with Stat3 protein increased more than twofold at P18. Stat3 was also activated by phosphorylation at P18, consistent with it having a functional role in the neovascular process. Also, the retina is heterogeneous, and our samples included several types of neural cells and glia as well as blood vessels, which make up a very small portion of the complete retina. It is possible that Stat3 is considerably upregulated in retinal blood vessels and that this elevation is partially masked by the unchanged level in all other components of the retina and possibly decreasing levels in the inner plexiform and inner nuclear layers that were demonstrated in situ. This assumption is corroborated by the in situ finding of greatly increased pStat3 in the retinal blood vessels at P18.

Although the results presented herein are suggestive, additional investigation is necessary to verify the role of STAT3 in retinal angiogenesis. For example, functional studies using dominant-negative STAT3 mutants or antisense oligonucleotides to inhibit STAT3, or constitutively activated forms of STAT3, could help determine the function of STAT3 in retinal angiogenesis.16 26 Such additional investigation is warranted, because delineating the pathways by which STAT3 plays a role in retinal angiogenesis may provide new targets for therapeutic interventions that will address the actions of multiple signaling pathways in retinal angiogenesis and may be specific to growing or abnormal endothelium.


   Acknowledgements
 
The authors thank Jianhua Wang for technical assistance with the microarray hybridization and John Tobias and Elad Schneidman for assistance with the statistical analyses.


   Footnotes
 
Supported by Research to Prevent Blindness; the Foundation Fighting Blindness; the Rosanne Silbermann Foundation, Livingston, NJ; the F. M. Kirby Foundation, Morristown, NJ; and Fight for Sight, Schaumburg, IL.

Submitted for publication May 20, 2005; revised August 19, 2005; accepted October 20, 2005.

Disclosure: H. Mechoulam, None; E.A. Pierce, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Eric A. Pierce, F. M. Kirby Center for Molecular Ophthalmology, University of Pennsylvania, 305 Stellar-Chance Laboratories, 422 Curie Boulevard, Philadelphia, PA 19104; epierce{at}mail.med.upenn.edu.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. World Health Organization. Blindness and Visual Disability Part III of VII: Other Leading Causes Worldwide. Fact Sheet 144. 1997; World Health Organization Geneva, Switzerland.
  2. Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med. 1995;1:27–31.[CrossRef][ISI][Medline][Order article via Infotrieve]
  3. Shweiki D, Itin A, Soffer D, Keshet E. Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature. 1992;359:843–845.[CrossRef][Medline][Order article via Infotrieve]
  4. Campochiaro PA. Retinal and choroidal neovascularization. J Cell Physiol. 2000;184:301–310.[CrossRef][ISI][Medline][Order article via Infotrieve]
  5. Mechoulam H, Pierce EA. Retinopathy of prematurity: molecular pathology and therapeutic strategies. Am J Pharmacogenomics. 2003;3:261–277.[CrossRef][Medline][Order article via Infotrieve]
  6. Robinson GS, Aiello LP. Angiogenic factors in diabetic ocular disease: mechanisms of today, therapies for tomorrow. Int Ophthalmol Clinics. 1998;38:89–102.
  7. Brooks PC, Silletti S, von Schalscha TL, Friedlander M, Cheresh DA. Disruption of angiogenesis by PEX, a noncatalytic metalloproteinase fragment with integrin binding activity. Cell. 1998;92:391–400.[CrossRef][ISI][Medline][Order article via Infotrieve]
  8. Aiello LP. Vascular endothelial growth factor. 20th-century mechanisms, 21st-century therapies. Invest Ophthalmol Vis Sci. 1997;38:1647–1652.[Free Full Text]
  9. Gerber HP, McMurtrey A, Kowalski J, et al. Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway. Requirement for Flk-1/KDR activation. J Biol Chem. 1998;273:30336–30343.[Abstract/Free Full Text]
  10. Gliki G, Wheeler-Jones C, Zachary I. Vascular endothelial growth factor induces protein kinase C (PKC)-dependent Akt/PKB activation and phosphatidylinositol 3'-kinase mediates PKC delta phosphorylation: role of PKC in angiogenesis. Cell Biol Int. 2002;26:751–759.[CrossRef][ISI][Medline][Order article via Infotrieve]
  11. Takeda K, Noguchi K, Shi W, et al. Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proc Natl Acad Sci USA. 1997;94:3801–3804.[Abstract/Free Full Text]
  12. Duncan SA, Zhong Z, Wen ZL, Darnell JE. STAT signaling is active during early mammalian development. Dev Dyn. 1997;208:190–198.[CrossRef][ISI][Medline][Order article via Infotrieve]
  13. Takeda K, Kaisho T, Yoshida N, Takeda J, Kishimoto T, Akira S. Stat3 activation is responsible for IL-6-dependent T cell proliferation through preventing apoptosis: generation and characterization of T cell-specific Stat3-deficient mice. J Immunol. 1998;161:4652–4660.[Abstract/Free Full Text]
  14. Li W, Liang X, Kellendonk C, Poli V, Taub R. STAT3 contributes to the mitogenic response of hepatocytes during liver regeneration. J Biol Chem. 2002;277:28411–28417.[Abstract/Free Full Text]
  15. Buettner R, Mora LB, Jove R. Activated STAT signaling in human tumors provides novel molecular targets for therapeutic intervention. Clin Cancer Res. 2002;8:945–954.[Abstract/Free Full Text]
  16. Bromberg JF, Wrzeszczynska MH, Devgan G, et al. Stat3 as an oncogene. Cell. 1999;98:295–303.[CrossRef][ISI][Medline][Order article via Infotrieve]
  17. Akira S, Nishio Y, Inoue M, et al. Molecular-cloning of Aprf, a novel IFN-stimulated gene factor-3 p91-related transcription factor involved in the Gp130-mediated signaling pathway. Cell. 1994;77:63–71.[CrossRef][ISI][Medline][Order article via Infotrieve]
  18. Zhong Z, Wen Z, Darnell JE, Jr. Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science. 1994;264:95–98.[Abstract/Free Full Text]
  19. Levy DE, Lee CK. What does Stat3 do?. J Clin Invest. 2002;109:1143–1148.[CrossRef][ISI][Medline][Order article via Infotrieve]
  20. Wen ZL, Darnell JE. Mapping of Stat3 serine phosphorylation to a single residue (727) and evidence that serine phosphorylation has no influence on DNA binding of Stat1 and Stat3. Nucl Acids Res. 1997;25:2062–2067.[Abstract/Free Full Text]
  21. Sierra-Honigmann MR, Nath AK, Murakami C, et al. Biological action of leptin as an angiogenic factor. Science. 1998;281:1683–1686.[Abstract/Free Full Text]
  22. Nakagami H, Morishita R, Yamamoto K, et al. Mitogenic and antiapoptotic actions of hepatocyte growth factor through ERK, STAT3, and Akt in endothelial cells. Hypertension. 2001;37:581–586.[Abstract/Free Full Text]
  23. Mahboubi K, Li F, Plescia J, et al. Interleukin-11 up-regulates survivin expression in endothelial cells through a signal transducer and activator of transcription-3 pathway. Lab Invest. 2001;81:327–334.[ISI][Medline][Order article via Infotrieve]
  24. Waxman AB, Mahboubi K, Knickelbein RG, et al. IL-11 and IL-6 protect cultured human endothelial cells from H2O2-induced cell death. Am J Respir Cell Mol Biol. 2003;29:513–522.[Abstract/Free Full Text]
  25. Hatzi E, Murphy C, Zoephel A, et al. N-myc oncogene overexpression down-regulates IL-6; evidence that IL-6 inhibits angiogenesis and suppresses neuroblastoma tumor growth. Oncogene. 2002;21:3552–3561.[CrossRef][ISI][Medline][Order article via Infotrieve]
  26. Niu GL, Wright KL, Huang M, et al. Constitutive Stat3 activity up-regulates VEGF expression and tumor angiogenesis. Oncogene. 2002;21:2000–2008.[CrossRef][ISI][Medline][Order article via Infotrieve]
  27. Schaefer LK, Ren ZY, Fuller GN, Schaefer TS. Constitutive activation of Stat3 alpha in brain tumors: localization to tumor endothelial cells and activation by the endothelial tyrosine kinase receptor (VEGFR-2). Oncogene. 2002;21:2058–2065.[CrossRef][ISI][Medline][Order article via Infotrieve]
  28. Gray MJ, Zhang J, Ellis LM, et al. HIF-1alpha, STAT3, CBP/p300 and Ref-1/APE are components of a transcriptional complex that regulates Src-dependent hypoxia-induced expression of VEGF in pancreatic and prostate carcinomas. Oncogene. 2005;24:3110–3120.[CrossRef][ISI][Medline][Order article via Infotrieve]
  29. Wei LH, Kuo ML, Chen CA, et al. Interleukin-6 promotes cervical tumor growth by VEGF-dependent angiogenesis via a STAT3 pathway. Oncogene. 2003;22:1517–1527.[CrossRef][ISI][Medline][Order article via Infotrieve]
  30. Wei DY, Le XD, Zheng LZ, et al. Stat3 activation regulates the expression of vascular endothelial growth factor and human pancreatic cancer angiogenesis and metastasis. Oncogene. 2003;22:319–329.[CrossRef][ISI][Medline][Order article via Infotrieve]
  31. Zhang SSM, Wei JY, Li CJ, Barnstable CJ, Fu XY. Expression and activation of STAT proteins during mouse retina development. Exp Eye Res. 2003;76:421–431.[CrossRef][ISI][Medline][Order article via Infotrieve]
  32. Zhang SS, Wei J, Qin H, et al. STAT3-mediated signaling in the determination of rod photoreceptor cell fate in mouse retina. Invest Ophthalmol Vis Sci. 2004;45:2407–2412.[Abstract/Free Full Text]
  33. Peterson WM, Wang Q, Tzekova R, Wiegand SJ. Ciliary neurotrophic factor and stress stimuli activate the Jak-STAT pathway in retinal neurons and glia. J Neurosci. 2000;20:4081–4090.[Abstract/Free Full Text]
  34. Smith LE, Wesolowski E, McLellan A, et al. Oxygen-induced retinopathy in the mouse. Invest Ophthalmol Vis Sci. 1994;35:101–111.[Abstract/Free Full Text]
  35. Corimbia, Inc. Probe Profiler Software User Manual. 2002;
  36. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA. 2001;98:5116–5121.[Abstract/Free Full Text]
  37. Bradford MM. Rapid and sensitive method for quantitation of microgram quantities of protein utilizing principle of protein-dye binding. Anal Biochem. 1976;72:248–254.[CrossRef][ISI][Medline][Order article via Infotrieve]
  38. Chan-Ling T, Tout S, Hollander H, Stone J. Vascular changes and their mechanisms in the feline model of retinopathy of prematurity. Invest Ophthalmol Vis Sci. 1992;33:2128–2147.[Abstract/Free Full Text]
  39. Kisseleva T, Bhattacharya S, Braunstein J, Schindler CW. Signaling through the JAK/STAT pathway, recent advances and future challenges. Gene. 2002;285:1–24.[CrossRef][ISI][Medline][Order article via Infotrieve]
  40. Pierce EA, Foley ED, Smith LE. Regulation of vascular endothelial growth factor by oxygen in a model of retinopathy of prematurity. Arch Ophthalmol. 1996;114:1219–1228.[Abstract]
  41. Stone J, Chan-Ling T, Pe’er J, Itin A, Gnessin H, Keshet E. Roles of vascular endothelial growth factor and astrocyte degeneration in the genesis of retinopathy of prematurity. Invest Ophthalmol Vis Sci. 1996;37:290–299.[Abstract/Free Full Text]
  42. Pierce EA, Avery RL, Foley ED, Aiello LP, Smith LE. Vascular endothelial growth factor/vascular permeability factor expression in a mouse model of retinal neovascularization. Proc Natl Acad Sci USA. 1995;92:905–909.[Abstract/Free Full Text]
  43. Justicia C, Gabriel C, Planas AM. Activation of the JAK/STAT pathway following transient focal cerebral ischemia: signaling through Jak1 and Stat3 in astrocytes. Glia. 2000;30:253–270.[CrossRef][ISI][Medline][Order article via Infotrieve]
  44. Planas AM, Soriano MA, Berruezo M, et al. Induction of Stat3, a signal transducer and transcription factor, in reactive microglia following transient focal cerebral ischaemia. Eur J Neurosci. 1996;8:2612–2618.[CrossRef][ISI][Medline][Order article via Infotrieve]
  45. Xuan YT, Guo YR, Han H, Zhu YQ, Bolli R. An essential role of the JAK-STAT pathway in ischemic preconditioning. Proc Natl Acad Sci USA. 2001;98:9050–9055.[Abstract/Free Full Text]
  46. Bartoli M, Platt D, Lemtalsi T, et al. VEGF differentially activates STAT3 in microvascular endothelial cells. FASEB J. 2003;17:1562–1564.[Abstract/Free Full Text]
  47. Jin W, Riley RM, Wolfinger RD, White KP, Passador-Gurgel G, Gibson G. The contributions of sex, genotype and age to transcriptional variance in Drosophila melanogaster. Nat Genet. 2001;29:389–395.[CrossRef][ISI][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
 DiabetesHome page
X. Liu, M. G. Mameza, Y. S. Lee, C. I. Eseonu, C.-R. Yu, J. J. Kang Derwent, and C. E. Egwuagu
Suppressors of Cytokine-Signaling Proteins Induce Insulin Resistance in the Retina and Promote Survival of Retinal Cells
Diabetes, June 1, 2008; 57(6): 1651 - 1658.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mechoulam, H.
Right arrow Articles by Pierce, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mechoulam, H.
Right arrow Articles by Pierce, E. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS