IOVS Molecular Human Reproduction
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2005;46:4571-4577.)
© 2005 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.05-0723

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crowston, J. G.
Right arrow Articles by Weinreb, R. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crowston, J. G.
Right arrow Articles by Weinreb, R. N.

Effect of Bimatoprost on Intraocular Pressure in Prostaglandin FP Receptor Knockout Mice

Jonathan G. Crowston,1 James D. Lindsey,1 Christy A. Morris,1 Larry Wheeler,2 Felipe A. Medeiros,1 and Robert N. Weinreb1

1From the Hamilton Glaucoma Center and Department of Ophthalmology, University of California San Diego, La Jolla, California; and 2Allergan USA, Irvine, California.


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
PURPOSE. To determine the effect of bimatoprost on intraocular pressure in the prostaglandin FP receptor knockout mouse.

METHODS. The IOP response to a single 1.2-µg (4 µL) dose of bimatoprost was measured in the treated and untreated fellow eyes of homozygote (FP+/+, n = 9) and heterozygote (FP±, n = 10) FP-knockout mice, as well as in wild-type C57BL/6 mice (FP+/+, n = 20). Serial IOP measurements were also performed after topical bimatoprost in a separate generation of homozygous FP-knockout mice and wild-type littermate control animals (n = 4 per group). Aqueous humor protein concentrations were measured to establish the state of the blood–aqueous barrier. Tissue, aqueous humor and vitreous concentrations of bimatoprost, latanoprost, and their C-1 free acids were determined by liquid chromatography and tandem mass spectrometry.

RESULTS. A significant reduction in IOP was observed in the bimatoprost-treated eye of wild-type mice at 2 hours, with a mean difference and 95% confidence interval (CI) of the difference in means of –1.33 mm Hg (–0.81 to –1.84). Bimatoprost did not lead to a significant reduction in IOP in either the heterozygous knockout –0.36 mm Hg (–0.82 to +0.09) or homozygous FP-knockout mice 0.25 mm Hg (–0.38 to +0.89). The lack of an IOP response in the FP-knockout mice was not a consequence of blood–aqueous barrier breakdown, as there was no significant difference in aqueous humor protein concentration between treated and fellow eyes. Tissue and aqueous humor concentrations of bimatoprost, latanoprost, and their C-1 free acids indicate that latanoprost, but not bimatoprost, is hydrolyzed in the mouse eye after topical administration.

CONCLUSIONS. An intact FP receptor gene is critical to the IOP response to bimatoprost in the mouse eye.


Topically administered prostaglandin (PG) F2{alpha} and its analogues lower IOP in humans and nonhuman primates1 2 by increasing the uveoscleral outflow of aqueous humor.3 Bimatoprost, the C-1 ethyl amide of 17-phenyl-prostaglandin F2{alpha}, a structural analogue, is also a potent ocular hypotensive.4 Although the molecular mechanisms responsible for IOP lowering are not known, it has been suggested that bimatoprost fundamentally differs from latanoprost, by lowering IOP through mechanisms that are independent of FP receptor signaling.5 However, there is considerable controversy regarding the role of FP receptor signaling, because bimatoprost has been shown to bind and activate the FP receptor in cultured human trabecular meshwork and human ciliary muscle cells.6

Measurement of aqueous humor dynamics in the mouse eye has been detailed recently.7 The FP knockout mouse, generated by homologous translocation with a target vector that replaces the second exon of the FP gene with the ß-galactosidase and neomycin-resistance gene, was produced to demonstrate the critical role of the interaction of PGF2{alpha} with FP receptors in the initiation of parturition in pregnant mice.8 We recently demonstrated that a single application of latanoprost had no effect on IOP in the FP homozygous knockout mice and a diminished effect in the heterozygous knockout mice, compared with C57 BL/6 background control mice.9 This indicates that the FP receptor is necessary for the acute IOP response to latanoprost. The FP-knockout mouse also provides the opportunity to determine whether bimatoprost lowers IOP in the absence of the FP receptor.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Animal Husbandry
All experiments were performed in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Mice lacking the gene encoding the FP receptor were obtained as a gift from Shuh Narumiya (Kyoto University, Japan). Homozygous knockout females fail to initiate parturition.8 For this reason, heterozygous (female) and homozygous (male) mating pairs were used to generate an F1 generation. C57BL/6 mice constitute the founder species of the FP-knockout mice and were used as wild-type control subjects. Mice were bred and housed in clear cages covered loosely with air filters and containing white pine shavings for bedding. The environment was kept at 21°C in a 12-hour light–dark cycle (light, 6:00 AM to 6:00 PM). All mice were fed ad libitum. Animal ages ranged from 6 to 9 months.

Drug Application
To facilitate administration of eye drops, mice were restrained in a conical plastic sleeve (Decapicone; Braintree Scientific Inc., Braintree, MA). Four microliters bimatoprost 0.03% (Allergan, Irvine, CA) was applied topically to the right eye. Dose–response curve and time course were performed in C57BL/6 mice to determine the optimum dose of drug and the time of maximum IOP lowering.

Anesthesia
The mice were anesthetized by intraperitoneal injection of a mixture of ketamine (100 mg/kg, Ketaset; Fort Dodge Animal Health, Fort Dodge, IA) and xylazine (9 mg/kg, TranquiVed; Vedco Inc., St. Joseph, MO), as previously described.10 Each mouse was monitored carefully to assess the state of anesthesia. If the mouse did not respond to pinching of the back skin, it was placed on the platform for IOP measurement.

Determination of Mouse Genotype by PCR
DNA was extracted from 8-mm tail biopsy specimens of anesthetized adult mice using a kit (69504; Qiagen, Valencia, CA) according to the manufacturer’s guidelines. The oligonucleotide primers used to detect homologous translocation were 5F (GCCCATCCTTGGACACCGAGA), 6R (AGAGTCGGCAAGCTGTGACTT) and NeoII (TGATATTGCTGAAGAGCTTGG). Amplification was performed over 35 cycles of 94°C for 30 seconds, 65°C for 30 seconds, and 75°C for 10 minutes. PCR products were analyzed by electrophoresis in 1% agarose gels. The PCR product sizes were 700 bp for the FP receptor gene and 450 bp, corresponding to the LacZ/neo(r) cassette. DNA from the heterozygote Fp–/– mice therefore produces two bands (700 and 450 bp) and DNA from a homozygous FP+/+-knockout mouse producing a single band (450 bp).

Measurement of IOP
Cannulation Technique.
IOP measurements were performed between 2 and 6 PM to reduce the effect of circadian variation in IOP.11 Measurements were performed by cannulation of the anterior chamber, as described in detail previously.7 Beveled microneedles were made of borosilicate glass with a tip diameter between 75 and 100 µm. The microneedle was mounted on a micromanipulator to enable accurate positioning. It was connected to a pressure transducer (Model BLPR; World Precision Instruments, Sarasota, FL) which was calibrated against a manometer over the range of 0 to 30 mm Hg, as described previously.10 IOP was measured in both eyes within 7 minutes of the anesthetic injection. The second IOP was measured within 1 minute of the first eye recording. The investigator was masked to the genotype of the FP-knockout mice at the time of IOP measurement. The IOP response to bimatoprost was measured on three separate occasions in the FP-knockout mice, as small IOP alterations could have been masked by physiological intermouse and intereye differences in IOP. As a larger reduction in IOP was obtained for bimatoprost in preliminary experiments, the response to bimatoprost in C57BL/6 mice was only measured once. A 1-week washout period was used between repeat IOP measurements.

Induction-Impact (Rebound) Tonometry.
Longitudinal IOP measurement became feasible with the induction impact tonometer described by Danias et al.12 To confirm the initial findings, IOP response to a single 4-µL application of bimatoprost 0.03% in one eye was compared longitudinally with the fellow eye in a different generation of homozygous knockout (n = 4) and wild-type (n = 4) littermate control mice. IOP was recorded before and hourly after treatment by an observer who was masked to both mouse genotype and also to the eye that had been treated. Measurement of the IOP response to unilateral instillation of topical latanoprost in Swiss white mice with the induction-impact and cannulation tonometer revealed similar mean IOP reductions with both measurement techniques (data not shown). This noninvasive tonometer permits IOP measurement in awake mice.12 The tonometer was calibrated in vivo. A C57BL/6 mouse eye was cannulated close to the limbus with a needle connected to a fluid column and a pressure transducer. This permitted the eye pressure to be set by raising and lowering the fluid column. IOP measurements with the rebound tonometer were taken at intervals between 0 and 30 mm Hg. Longitudinal IOP measurement was performed in awake mice that were gently restrained to ensure no mechanical Valsalva effect that would elevate IOP. The tonometer probe was mounted on a micromanipulator and measurements were recorded from a distance of 3.0 mm ± 0.1 mm from the center of the cornea. A dissecting microscope was used to ensure good centration on the cornea.

Aqueous Humor Protein Concentration
Aqueous protein concentration was measured to determine whether topical application of bimatoprost led to a significant breakdown in the blood–aqueous barrier, which could result in secondary changes in IOP. Two hours after administration of bimatoprost, (1.2 µg in 4 µL), aqueous humor was aspirated through a microneedle attached to a 10-µL syringe-equipped micropump (Hamilton, Reno, NV; and Micro 4, World Precision Instruments). The Bradford protein assay (Bio-Rad Laboratories, Hercules, CA) was used according to the manufacturer’s guidelines. Aqueous humor samples (3 µL) were diluted in 97 µL phosphate-buffered saline. Eighty microliters of this solution was then mixed with 20 µL assay solution (Bio-Rad) in separate wells of a 96-well microtiter plate. Absorption was measured at 595 nm with a microtiter plate reader (SpectraMax 250). Aqueous protein concentration was determined from linear regression curves derived from bovine serum albumin standards.

Tissue Drug Concentrations
To understand the contribution of 17-phenyl trinor PGF2{alpha}, the C-1 acid of bimatoprost and a potent FP agonist, to lowering IOP in the mouse, we sought to determine the hydrolysis of bimatoprost in ocular tissues of C57BL/6J mice killed 2 hours after a single dose. A further group of mice treated with latanoprost was included for comparison.

Both eyes of 20 mice were treated topically with 4 µL of 0.03% bimatoprost (1.2 µg) per eye. Another 20 mice were treated with 4 µL of 0.005% latanoprost in the same manner. Untreated mice (n = 32) were used as the negative control. Mice were killed with CO2 gas at 2 hours after treatment and weighed. The eyes were enucleated, and bimatoprost or latanoprost and the corresponding C-1 acid concentrations were determined by liquid chromatography and tandem mass spectrometry (LC-MS/MS).

Eyes were briefly rinsed in Dulbecco’s phosphate-buffered saline. Each eye was dissected into anterior and posterior segments and the lens, vitreous humor, and aqueous humor were removed. Eyes were bisected, and each anterior and posterior segment was cut in half and placed directly into preweighed microcentrifuge tubes cooled on dry ice. Segments were pooled (eight anterior or eight posterior) from four animals. Five pooled samples were obtained for each test material. Tissues from untreated mice were processed in the same manner. The untreated tissues from 16 mice were collected as four pooled samples for each segment (eight anterior or eight posterior) at the time of the bimatoprost study. Another 16 mice were used to provide untreated tissues for the latanoprost study. The tissue weight of each pooled sample was determined. One milliliter acetonitrile-methanol (1:1 vol/vol) was added to each sample and then incubated at 5°C overnight (~18 hours). The samples were centrifuged at 10,000g for 2 minutes. The supernatant was removed and evaporated to dryness at 37°C with a stream of nitrogen gas. The residues were stored at –20°C until assayed.

Aqueous Humor Drug Concentrations
In a further set of experiments, eyes were treated with a 4-µL drop of bimatoprost or latanoprost or no treatment (10 eyes of 5 mice per group). After 2 hours, aqueous humor was aspirated as described earlier, and samples for each treatment group were pooled. Levels of bimatoprost, latanoprost, and their C-1 free acids were determined by LC-MS/MS. Masked aqueous humor samples where split and run in a masked fashion to determine levels of bimatoprost-bimatoprost acid and latanoprost-latanoprost acid separately.

Liquid Chromatography and Tandem Mass Spectrometry
The dry residue was reconstituted with 200 µL of 100% acetonitrile. The reconstituted samples were injected (80 µL) and analyzed by LC-MS/MS using a mass spectrometer (PE Sciex API 3000; Applied Biosystems, Foster City, CA), with a Shimadzu autosampler and HPLC pumps (Shimadzu Scientific Instruments, Columbia, MD) using an APS-2 column (3 µm, 2 x 150 mm; Keystone Scientific, Bellefonte, PA). The extracts were analyzed for parent compounds and the corresponding C-1 acid metabolites using multiple reaction monitoring (MRM) and deuterated compounds as internal standards. The results were expressed as concentration of analytes in nanograms per gram of tissue and ratio of C-1 acid concentration to parent compound concentration.

Statistical Analysis
Paired student t-tests were used to compare the IOP in treated and untreated-fellow eyes of mice of the same genotype. The average reduction in IOP (mean IOP in treated eyes – mean IOP in fellow eyes) was expressed as the mean difference and 95% confidence interval (CI) for the difference between means. A significant reduction in IOP was defined by a 95% CI range that was less than zero. Analysis of variance was used to compare the mean difference in IOP between strains. For comparison of 2-means, a P < 0.05 was considered to be statistically significant. A Tukey-Kramer post hoc modification of the ANOVA was performed to adjust for comparison between multiple groups. For serial IOP analysis, generalized estimating equations were used to determine the association of IOP difference between treated and untreated eyes and genotype. For determination of tissue levels a computer (Analyst software ver. 1.3; Applied Biosystems) was used for peak integration, construction of calibration curves from peak areas of analyte and internal standard, and the calculation of analyte concentrations in unknown samples.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
IOP Response to Bimatoprost in C57BL/6 Mice
Dose–response and time course of IOP response to bimatoprost was determined in C57BL/6 mice, which constitute the founder strain used for the generation of the FP-knockout mice.8 The IOP response was expressed as the mean reduction in IOP in the treated eye compared with the untreated fellow eye. The largest IOP reduction at 2 hours (–1.50 mm Hg) was obtained with a 1.2-µL dose (4 µL drop; Fig. 1 ). Subsequently, IOP was measured at 1, 2, and 4 hours after a single 1.2-µg dose. The largest reduction in IOP was observed at 4 hours. However, this was not significantly lower than the pressure reduction observed at 2 hours (P = 0.71, student t-test).



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 1. IOP response to bimatoprost in C57BL/6 mice. (A) The difference in IOP between treated and fellow eyes was measured 2 hours after a single application of bimatoprost, by using the cannulation technique (n = 8 per treatment group). (B) The mean difference in IOP between treated and untreated eyes at 1, 2, and 4 hours after a single application of bimatoprost (4 µL, n = 4 per treatment group).

 
IOP Response in FP-Knockout Mice
The average difference in IOP (±95% CI of the mean IOP difference) between the bimatoprost-treated and untreated fellow eyes was –0.36 mm Hg (–0.82 to +0.09) for the heterozygote FP-knockout mice and +0.25 mm Hg (–0.74 to +0.64) for the homozygous FP-knockout mice (Fig. 2 , Table 1 ). This indicates that bimatoprost does not lower IOP in the FP-knockout mice because the 95% CI of the mean difference crosses zero for both genotypes. In contrast, the mean difference in IOP and 95% CI for the C57BL/6 mice was –1.33 (–1.84 to –0.81) indicating that the same treatment reduced IOP in the treated eye compared with the untreated fellow eye. Analysis of variance was performed to compare the IOP reduction in treated eyes with that in fellow untreated eyes for the three genotypes. There was no statistically significant difference in mean IOP reduction in the heterozygous compared with the homozygous mice (P > 0.05). The mean reduction in IOP in the C57BL/6 mice was significantly greater than the difference in IOP for the heterozygous and homozygous FP knockout mice (P = 0.024, comparison of all group means with ANOVA).



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 2. Difference in IOP between treated and untreated eyes, 2 hours after a single dose (4 µL) of bimatoprost. Group mean values (solid line) and 95% CI (dashed lines) of the means are shown. C57BL/6 (n = 20), heterozygous FP-knockout (n = 10), homozygous FP-knockout mice (n = 8).

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Mean Difference in IOP between Bimatoprost-Treated and Untreated Fellow Eyes

 
Serial IOP Measurements with the Induction-Impact Tonometer
During the course of the study, it became apparent that the magnitude of the IOP response to prostaglandin analogues is larger when measured in the evening than in the midafternoon. The larger IOP reduction in the evening permitted evaluation of drug effect with a noninvasive induction impact tonometer, which in turn permitted serial IOP measurement in individual mice. IOP measurement performed hourly for 3 hours after drop installation in awake mice, with a noninvasive rebound tonometer, revealed a reduction in IOP in the treated eye of wild-type control mice but insignificant IOP alteration in the homozygous FP-knockout mice (Fig. 3) . Mean reduction in IOP (untreated fellow eye IOP – treated eye IOP) in wild-type mice at 2 and 3 hours (corrected for pretreatment baseline differences) was –4.6 and –4.8 mm Hg, respectively. The equivalent mean reduction in IOP at 2 and 3 hours in homozygous FP-knockout mice was +0.9 and –0.2 mm Hg, respectively. Generalized estimation equations were used to analyze the association with genotype of serial changes in the difference in IOP between treated and untreated eyes. The calculations revealed that, after treatment, the FP genotype was significantly associated with the intraocular difference in IOP over time (P < 0.032).



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 3. Difference in IOP between treated and untreated eyes in wild-type (n = 4) and homozygous FP-knockout (n = 4) mice measured just before (t = 0) and hourly for 3 hours after a single application of bimatoprost (4 µL). The observer was masked to mouse genotype and which eye had been treated. Data show mean IOP difference, corrected for difference in IOP between fellow eyes before treatment at t = 0 (±SEM).

 
Aqueous Humor Protein Concentration
A single 1.2-µg application of bimatoprost had no effect on aqueous humor protein levels at 2 hours in either the homozygous FP-knockout (P = 0.1, paired t-test) or the C57BL/6 (P = 0.12) mice (Fig. 4) . Aqueous humor protein levels were between 0.2 and 0.3 mg/mL, which was similar to the levels recorded previously in Swiss white mice.7 Protein levels tended to be higher in the FP-knockout mice compared with wild-type mice but this difference was not statistically significant.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 4. Aqueous humor protein concentration 2 hours after bimatoprost (4 µL) compared with untreated fellow eyes. Data points represent the mean ± SEM with n = 6 mice per treatment group.

 
Tissue Levels of Bimatoprost, Latanoprost, and Their Free Acids
Bimatoprost eluted at approximately 2.2 minutes and 17-phenyl trinor PGF2{alpha} eluted at approximately 4.2 minutes in the HPLC system. Blank samples showed no detectable concentrations indicating assay specificity. Standards were used to quantify bimatoprost and 17-phenyl trinor PGF2{alpha} in anterior and posterior ocular tissues and lower limit of quantitation (LOQ) was 2 pg on column injection for both bimatoprost and 17-phenyl trinor PGF2{alpha}. Linear standard curves were achieved from 2 pg to 10 ng on column injection with correlation coefficient values of 0.99 for both bimatoprost and 17-phenyl trinor PGF2{alpha}. The accuracy of the quality control samples in the anterior and posterior ocular tissues for the range of 2.5 pg to 1 ng on column injection ranged from 79% to 108% and 84% to 127% for bimatoprost and 17-phenyl trinor PGF2{alpha}, respectively. The mean bimatoprost concentrations and C-1 acid concentrations did not differ greatly from the anterior to posterior tissues (Table 2) . The bimatoprost concentration was 15.9 ± 4.1 ng/g in the anterior samples and 10.6 ± 2.9 ng/g in the posterior samples. The C-1 acid concentration of bimatoprost was much lower, with 0.32 ± 0.16 and 0.23 ± 1.01 ng/g in the anterior and posterior samples, respectively. Two of the five posterior samples had amounts below the limit of quantitation.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Bimatoprost, Bimatoprost C-1 Acid, Latanoprost, and Latanoprost C-1 Acid Levels in Ocular Tissues

 
In comparison, latanoprost eluted at approximately 3.5 minutes, and latanoprost free acid eluted at approximately 3.0 minutes in the HPLC system. Blank samples showed no detectable concentrations, indicating assay specificity. The neat standards were used to quantify latanoprost and latanoprost free acid in anterior and posterior ocular tissues, and the lower limit of quantitation (LOQ) was 2 pg on column injection for both latanoprost and latanoprost free acid. Linear standard curves were achieved from 2 pg to 10 ng on column injection with correlation coefficient values of 0.99 for both latanoprost and latanoprost free acid. The accuracy of the quality control samples in mouse anterior and posterior ocular tissues for the range of 2.5 pg to 1 ng on column injection ranged from 71.6% to 115% and 78.5% to 108% for latanoprost and latanoprost free acid, respectively. The amount of latanoprost did not differ greatly from the anterior to the posterior tissues; however, latanoprost free acid was three times higher in the anterior samples than in the posterior samples. Specifically, the latanoprost concentration was 3.5 ± 1.4 ng/g in the anterior samples and 4.2 ± 2.1 ng/g in the posterior samples. C-1 acid concentration was higher with 20.1 ± 7.9 and 6.6 ± 3.2 ng/g in the anterior and posterior samples, respectively.

Aqueous Humor Levels of Bimatoprost, Latanoprost, and Their Free Acids
The bimatoprost concentration in aqueous humor, 2 hours after topical administration of a single 4-µL dose, which gave maximum IOP reduction, was 1.6ng/mL (4 nM; Table 3 ). Bimatoprost acid levels were below the limit of quantitation for aqueous humor samples (LOQ, 1 ng/mL). In comparison, 2 hours after a single 4-µL application of latanoprost, the concentration of latanoprost acid was 98 ng/mL (245 nM). Latanoprost was not detected (LOQ 5 ng/mL). These data suggest that the distribution of bimatoprost and its free acid into mouse aqueous humor are different from latanoprost.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Bimatoprost, Bimatoprost C-1 Acid, Latanoprost and Latanoprost C-1 Acid Levels in Aqueous Humor

 

    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
The results demonstrate that a single application of bimatoprost does not reduce IOP in FP receptor knockout mice. A significant reduction in IOP was observed, however, in bimatoprost-treated wild-type littermate control mice as well as C57BL/6 mice, which are the founder species for the FP-knockout mice and have normal FP receptor expression. Further, bimatoprost is not efficiently hydrolyzed to 17-phenyl trinor PGF2{alpha} in the mouse eye, although trace levels of the free acid were detectable in the ocular tissues of the anterior and posterior segment 2 hours after a single treatment. These data indicate that the early IOP response to a single application of bimatoprost is critically dependent on FP receptor expression in the mouse eye.

Several potential limitations of this study should be considered. First, the data were generated in the mouse, and extrapolation to the human should be made with caution. We have shown that aqueous humor dynamics in the mouse have several similarities to those of the human.7 In addition, a close correlation has been reported in the relative potencies of several of FP agonists in functional agonist assays of cultured human trabecular meshwork compared with mouse fibroblast lines.6 13 14 This supports the existence of homology in the amino acid structure of the FP receptors of the two species. Although non-FP mechanisms are not significant in the early response in the mouse, it is possible that alternative FP-independent mechanisms are relevant in the human. Second, the effect of repeated exposure to bimatoprost in the FP-knockout or wild-type mice has not yet been investigated. With these limitations in mind, it is clear that the FP receptor plays a critical role in the early IOP response to bimatoprost in the mouse. The similarities in aqueous humor dynamics in the mouse and human, coupled with homology in the cellular response to FP agonists and the availability of genetically engineered mice support the value of this model for studying the mechanisms of IOP-lowering by prostaglandin analogues.

It has been suggested that bimatoprost reduces IOP by an as yet uncharacterized prostamide receptor.5 15 16 17 18 19 There are conflicting reports on what concentration of bimatoprost free acid is needed in the aqueous humor to activate FP receptor signaling and to lower IOP. Studies of FP receptor signaling using cultured human trabecular meshwork or human ciliary muscle cells as well as mouse fibroblasts and rat aortic smooth muscle showed that bimatoprost acid has a relatively high affinity for the FP receptor (Ki = 83 nM) and an EC50 of 2.8 to 3.8 nM in most cells as measured by equilibrium phosphoinositide (PI) turnover assays.20 Bimatoprost also exhibited functional activity at the FP receptor in human trabecular meshwork cells (EC50 = 3245 nM).20 In contrast to latanoprost, bimatoprost is only slowly hydrolyzed to its free acid form by corneal and other ocular tissues.21 22 Levels of bimatoprost free acid (22 ±7.0 nM, 2 hours after the last dose after 7 days of treatment) have recently been reported in the aqueous humor of patients undergoing cataract surgery.23 Finally, the selective FP antagonist AL-8810 (11ß-fluoro-15-epi-15-indanyl prostaglandin F2{alpha}) inhibited the agonist activity of bimatoprost and bimatoprost acid, further suggesting a role for the FP receptor.24 25 26

Because bimatoprost C-1 free acid levels were largely undetected in aqueous humor and ocular tissues 2 hours after topical application, it is unlikely that bimatoprost C-1 acid, which is known to be a potent FP receptor agonist, plays a major contribution to the acute IOP reduction in the mouse. The levels of bimatoprost in tissue and aqueous were well below the EC50 documented in vitro by a calcium-mobilization assay in the transformed Swiss 3T3 murine cell line (3120 nM for bimatoprost and 49 nM for bimatoprost acid). This raises the possibility that primary ocular tissues may have different binding affinities in vivo. Another possible explanation is that spliced variants of the FP receptor could have different agonist affinities and explain our data. Our finding that no significant IOP lowering occurs in the absence of intact FP receptor gene strongly supports the view that FP signaling, at least in the mouse, is critical for the early IOP response to bimatoprost.


    Acknowledgements
 
The authors thank Jinsong Ni and June Chen (Allergan USA) for their assistance in measuring tissue prostaglandin concentrations.


    Footnotes
 
Supported in part by the National Eye Institute EY05990 (RNW).

Submitted for publication June 8, 2005; revised July 21, 2005; accepted October 13, 2005.

Disclosure: J.G. Crowston, Alcon Inc. and Pfizer, Inc. (R); J.D. Lindsey, None; C.A. Morris, None; L. Wheeler, Allergan USA (E); F.A. Medeiros, None; R.N. Weinreb, Allergan USA (C)

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Robert N. Weinreb, Hamilton Glaucoma Center, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0946; weinreb{at}eyecenter.ucsd.edu.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. Giuffre G. The effects of prostaglandin F2 alpha in the human eye. Graefes Arch Clin Exp Ophthalmol. 1985;222:139–141.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  2. Camras CB, Bito LZ. Reduction of intraocular pressure in normal and glaucomatous primate (Aotus trivirgatus) eyes by topically applied prostaglandin F2 alpha. Curr Eye Res. 1981;1:205–209.[Web of Science][Medline][Order article via Infotrieve]
  3. Toris CB, Camras CB, Yablonski ME. Effects of PhXA41, a new prostaglandin F2 alpha analog, on aqueous humor dynamics in human eyes. Ophthalmology. 1993;100:1297–1304.[Web of Science][Medline][Order article via Infotrieve]
  4. Brubaker RF. Mechanism of action of bimatoprost (Lumigan). Surv Ophthalmol. 2001;45(suppl 4)S347–S351.
  5. Woodward DF, Krauss AH, Chen J, et al. Pharmacological characterization of a novel antiglaucoma agent, bimatoprost (AGN 192024). J Pharmacol Exp Ther. 2003;305:772–785.[Abstract/Free Full Text]
  6. Sharif NA, Kelly CR, Crider JY. Human trabecular meshwork cell responses induced by bimatoprost, travoprost, unoprostone, and other FP prostaglandin receptor agonist analogues. Invest Ophthalmol Vis Sci. 2003;44:715–721.[Abstract/Free Full Text]
  7. Aihara M, Lindsey JD, Weinreb RN. Aqueous humor dynamics in mice. Invest Ophthalmol Vis Sci. 2003;44:5168–5173.[Abstract/Free Full Text]
  8. Sugimoto Y, Yamasaki A, Segi E, et al. Failure of parturition in mice lacking the prostaglandin F receptor. Science. 1997;277:681–683.[Abstract/Free Full Text]
  9. Crowston JG, Lindsey JD, Aihara M, Weinreb RN. Effect of latanoprost on intraocular pressure in mice lacking the prostaglandin FP receptor. Invest Ophthalmol Vis Sci. 2004;45:3555–3559.[Abstract/Free Full Text]
  10. Aihara M, Lindsey JD, Weinreb RN. Reduction of intraocular pressure in mouse eyes treated with latanoprost. Invest Ophthalmol Vis Sci. 2002;43:146–150.[Abstract/Free Full Text]
  11. Aihara M, Lindsey JD, Weinreb RN. Twenty-four-hour pattern of mouse intraocular pressure. Exp Eye Res. 2003;77:681–686.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  12. Danias J, Kontiola AI, Filippopoulos T, Mittag T. Method for the noninvasive measurement of intraocular pressure in mice. Invest Ophthalmol Vis Sci. 2003;44:1138–1141.[Abstract/Free Full Text]
  13. Griffin BW, Williams GW, Crider JY, Sharif NA. FP prostaglandin receptors mediating inositol phosphates generation and calcium mobilization in Swiss 3T3 cells: a pharmacological study. J Pharmacol Exp Ther. 1997;281:845–854.[Abstract/Free Full Text]
  14. Kelly CR, Williams GW, Sharif NA. Real-time intracellular Ca2+ mobilization by travoprost acid, bimatoprost, unoprostone, and other analogs via endogenous mouse, rat, and cloned human FP prostaglandin receptors. J Pharmacol Exp Ther. 2003;304:238–245.[Abstract/Free Full Text]
  15. Woodward DF, Krauss AH, Chen J, et al. The pharmacology of bimatoprost (Lumigan). Surv Ophthalmol. 2001;45(suppl 4)S337–S345.
  16. Liang Y, Li C, Guzman VM, et al. Comparison of prostaglandin F2alpha, bimatoprost (prostamide), and butaprost (EP2 agonist) on Cyr61 and connective tissue growth factor gene expression. J Biol Chem. 2003;278:27267–27277.[Abstract/Free Full Text]
  17. Spada CS, Krauss AH, Woodward DF, et al. Bimatoprost and prostaglandin F(2 alpha) selectively stimulate intracellular calcium signaling in different cat iris sphincter cells. Exp Eye Res. 2005;80:135–145.[Medline][Order article via Infotrieve]
  18. Chen J, Senior J, Marshall K, et al. Studies using isolated uterine and other preparations show bimatoprost and prostanoid FP agonists have different activity profiles. Br J Pharmacol. 2005;144:493–501.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  19. Matias I, Chen J, De Petrocellis L, et al. Prostaglandin ethanolamides (prostamides): in vitro pharmacology and metabolism. J Pharmacol Exp Ther. 2004;309:745–757.[Abstract/Free Full Text]
  20. Sharif NA, Kelly CR, Crider JY, Williams GW, Xu SX. Ocular hypotensive FP prostaglandin (PG) analogs: PG receptor subtype binding affinities and selectivities, and agonist potencies at FP and other PG receptors in cultured cells. J Ocul Pharmacol Ther. 2003;19:501–515.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  21. Maxey KM, Johnson JL, LaBrecque J. The hydrolysis of bimatoprost in corneal tissue generates a potent prostanoid FP receptor agonist. Surv Ophthalmol. 2002;47(suppl 1)S34–S40.
  22. Davies SS, Ju WK, Neufeld AH, Abran D, Chemtob S, Roberts LJ, II. Hydrolysis of bimatoprost (Lumigan) to its free acid by ocular tissue in vitro. J Ocul Pharmacol Ther. 2003;19:45–54.[CrossRef][Medline][Order article via Infotrieve]
  23. Camras CB, Toris CB, Sjoquist B, et al. Detection of the free acid of bimatoprost in aqueous humor samples from human eyes treated with bimatoprost before cataract surgery. Ophthalmology. 2004;111:2193–2198.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  24. Sharif NA, Kelly CR, Crider JY. Agonist activity of bimatoprost, travoprost, latanoprost, unoprostone isopropyl ester and other prostaglandin analogs at the cloned human ciliary body FP prostaglandin receptor. J Ocul Pharmacol Ther. 2002;18:313–324.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  25. Sharif NA, Kelly CR, Williams GW. Bimatoprost (Lumigan(R)) is an agonist at the cloned human ocular FP prostaglandin receptor: real-time FLIPR-based intracellular Ca(2+) mobilization studies. Prostaglandins Leukot Essent Fatty Acids. 2003;68:27–33.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  26. Sharif NA, Williams GW, Kelly CR. Bimatoprost and its free acid are prostaglandin FP receptor agonists. Eur J Pharmacol. 2001;432:211–213.[CrossRef][Web of Science][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
Br. J. Ophthalmol.Home page
C B Camras, N A Sharif, M B Wax, and J Stjernschantz
Bimatoprost, the prodrug of a prostaglandin analogue
Br. J. Ophthalmol., June 1, 2008; 92(6): 862 - 863.
[Full Text] [PDF]


Home page
Br. J. Ophthalmol.Home page
L B Cantor
Author's reply
Br. J. Ophthalmol., June 1, 2008; 92(6): 863 - 864.
[Full Text] [PDF]


Home page
IOVSHome page
J. G. Crowston, C. A. Morris, J. D. Lindsey, and R. N. Weinreb
Prostaglandin FP Receptors Do Not Contribute to 24-hour Intraocular Pressure Variation in Mice
Invest. Ophthalmol. Vis. Sci., May 1, 2007; 48(5): 2095 - 2098.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
T. Ota, M. Aihara, T. Saeki, S. Narumiya, and M. Araie
The Effects of Prostaglandin Analogues on Prostanoid EP1, EP2, and EP3 Receptor-Deficient Mice.
Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3395 - 3399.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crowston, J. G.
Right arrow Articles by Weinreb, R. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crowston, J. G.
Right arrow Articles by Weinreb, R. N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS