IOVS Heart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2005;46:1403-1408.)
© 2005 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.04-1209

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, L.
Right arrow Articles by Duncan, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, L.
Right arrow Articles by Duncan, G.

Sigma Receptor Antagonists Inhibit Human Lens Cell Growth and Induce Pigmentation

Lixin Wang,1 Alan R. Prescott,2 Barbara A. Spruce,3 Julie Sanderson,1 and George Duncan1

1From the School of Biological Sciences, University of East Anglia, Norwich, United Kingdom; the 2Centre for High-Resolution Imaging (CHIPs), School of Life Sciences, and the 3Department of Surgery and Molecular Oncology, Ninewells Hospital and Medical School, University of Dundee, Dundee, Scotland, United Kingdom.


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
PURPOSE. The expression of the Sigma 1 receptor and the ability of receptor antagonists to inhibit growth and induce pigment formation were investigated in human lens epithelial cells.

METHODS. Capsular bags were formed for experimental purposes by performing sham cataract operations on donor lenses. The resultant bags were cultured in Eagle’s minimum essential medium (EMEM) alone or supplemented with the Sigma receptor antagonists rimcazole (3 µM) and BD1047 (10 µM). Cell growth was monitored by phase microscopy. Tyrosine incorporation was quantified by culturing in the presence of 14-C tyrosine for 24 hours. At the end of the culture period, some bags were fixed in 4% paraformaldehyde for electron microscopy, and others were plunged into liquid nitrogen for later immunoblot and PCR analyses. Protein levels of tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), and tyrosinase-related protein 2 (TYRP2) were quantified by Western blot analysis. The presence of pigment granules within epithelial cells were monitored by phase and electron microscopy techniques.

RESULTS. The Sigma-1 receptor was expressed in native human lens cells and in cultured capsular bag cells. The Sigma receptor antagonists BD1047 and rimcazole inhibited lens cell growth and, surprisingly, lens cells accumulated pigment granules in the presence of the antagonists. The antagonists raised preexisting levels of TYR and TYRP1, whereas there was no change in TYRP2.

CONCLUSIONS. The human lens normally expresses components of the melanin synthesis pathway, and this suggests a possible origin for the pigment granules that have been observed under certain conditions in the human lens. Exposure of lens cells to Sigma receptor antagonists leads to growth inhibition and pigment granule production.


Sigma receptors were originally described in brain tissue, and Sigma ligands were developed to treat certain psychiatric disorders.1 More recently, however, Sigma receptor antagonists have been shown to inhibit proliferation in mammary and colon carcinoma cell lines.2 This has led to the development of specific Sigma ligands for diagnostic tumor imaging3 4 and specific Sigma antagonists to control tumor growth.5 A striking characteristic of the human lens is that it continues to grow throughout life by the division of cells in the equatorial region and the consequential production of fully differentiated fiber cells.6 The robust growth of lens cells becomes clinically significant in the events that follow cataract surgery where a capsular bag is formed to hold the implanted intraocular lens. The ability of lens epithelial cells to colonize the posterior capsule after surgery provides the basis for posterior capsule opacification (PCO), which can induce a marked deterioration in vision for a significant proportion of patients with cataract.7 Spruce et al.5 have recently shown that primary cultures of bovine lens cells are unusually sensitive to Sigma receptor antagonists, compared with most other normal, untransformed cells and the Sigma-1 receptor has been reported to be present in the lens epithelium of mice.8 In this study, we evaluated the potential of Sigma antagonists to inhibit lens epithelial cell growth in our human capsular bag model.9 The results show that not only is messenger RNA for the Sigma-1 receptor expressed in human lens cells, but growth is indeed inhibited by Sigma antagonists. Exposure to the antagonists also induced pigmentation of the epithelial cells and, intriguingly, pigment granules "of unknown origin" have been reported to be present in certain cataracts and aged human lenses.10 Cell pigmentation is critically important in the eye where, for example, oculocutaneous albinism leads to a loss of visual acuity and in extreme cases, blindness.11 The retinal pigment epithelium (RPE) is heavily pigmented and a major function of melanin is to protect the retina by absorbing stray light.12 There is also evidence that melanin has an antioxidant and free radical scavenging ability, and this is important in a number of cell types.13 The synthesis of pigment by certain cell types is of great importance, not only in terms of protective mechanisms, but also in the acquisition of an aggressive cell phenotype, for example, in malignant melanomas.14 The mechanisms underlying pigment dynamics are not well understood, partly because of the complexity of the control processes, but also because of the lack of availability of a suitable model system that does not normally pigment, but can be made to produce fully formed pigment granules. We propose that the normally optically clear lens provides an excellent model system for studying the molecular mechanisms of pigment granule formation.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Preparation and Culture of Capsular Bags
Human eye tissue donated for research was obtained from the East Anglian Eye Bank, and usage was in accordance with the tenets of the Declaration of Helsinki. Most eyes contained whole lenses, but four globes were also obtained from donors who had undergone cataract surgery. The resultant ex vivo capsular bag was dissected and used for RNA extraction.

As previously described,15 a sham cataract operation was performed on donor eyes, and the resultant capsular bag and anterior epithelium were secured separately on PMMA dishes. Bags were maintained in EMEM alone9 or EMEM supplemented with either 3 µM rimcazole dihydrochloride (rimcazole), 10 µM (+)-SK&F 10047 hydrochloride (SKF), and 3 or 10 µM BD1047 dihydrochloride (BD1047) and incubated at 35°C in a 5% CO2 atmosphere. Ongoing cell observations were performed with a phase-contrast microscope (Nikon, Tokyo, Japan) and images captured with a digital camera (Coolpix 950; Nikon) with associated software.

Western Blot Analyses
After dissection, epithelial preparations were maintained in EMEM, with or without 3 µM rimcazole for 5 days. Cells were then lysed on ice in buffer: 50 mM HEPES (pH 7.5), 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 10% glycerol, 10 mM sodium pyrophosphate, 2 mM sodium orthovanadate, 10 mM sodium fluoride, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 10 µg/mL aprotinin. Lysates were precleared by centrifuging at 13,000 rpm 4°C for 10 minutes,16 and the protein content of the soluble fraction assayed (Pierce, Rockford, IL). Equal amounts of protein from each sample were loaded onto 10% SDS-PAGE gels for electrophoresis and transfer onto polyvinylidene difluoride (PVDF) membrane (NEN Life Science Products, Boston, MA) with a semidry transfer cell (Trans-Blot; Bio-Rad, Herts, UK). Proteins were detected using a chemiluminescent blot analysis system (ECL+; Amersham Biosciences, Amersham, UK) with anti-TYR (Upstate Biotechnology, Lake Placid, NY), anti-TYRP1, anti-TYRP2, and anti-actin. The latter three were from Santa Cruz Biotechnology, Inc.

Reverse Transcription–Polymerase Chain Reaction
After dissection, epithelial preparations, including ex vivo capsular bags, were washed in serum-free EMEM, and RNA was collected from the cells by using a mini kit (RNeasy; Qiagen, Ltd., Crawley, UK). RNA (250 ng) was reverse transcribed in a 20-µL reaction mixture (Superscript II RT; Invitrogen, Ltd., Paisley, UK). cDNA (1 µL; diluted 1:5 in sterile double distilled water) was amplified by PCR in a 20-µL reaction buffer in the following conditions: 0.5 µM each primer (Invitrogen, Ltd.), 0.8 mM deoxy-nucleoside trisphosphate mixture (Bioline Ltd., London, UK), 10 mM Tris-HCl, 1.5 mM MgCl2, 50 mM KCl, and 2.5 U TaqDNA polymerase (Roche Diagnostics, Lewes, UK). PCR was performed by using the following program with a thermal controller (MJ Research Inc., Reno, NV): initial denaturation 94°C for 2 minutes, denaturation at 94°C for 40 seconds, annealing at 50°C for 30 seconds, and extension at 72°C for 40 seconds. Steps 2 through 4 were cycled 27 times (GAPDH); 36 cycles (Sigma-1 receptor) with a final extension at 72°C for 10 minutes. The oligonucleotide primer (5'–3') sequences specific for the genes examined were as follows: GAPDH: ACCACAGTCCATGCCATCAC (sense) and TCCACCACCCTGTTGCTGTA (anti-sense); Sigma 1 receptor: 5'-AGCGCGAAGAGATAGC-3' (sense) and 5'-AGCATAGGAGCGAAGAGT-3' (anti-sense).8 PCR products, together with the 100-bp DNA markers (Invitrogen-Life Technologies), were run on a 1% agarose gel, and images were captured and analyzed (1D system; Eastman Kodak, Rochester, NY).

14C-Tyrosine Uptake
Capsular bags were maintained in EMEM or EMEM supplemented with 3 µM rimcazole for 7 days (when the pigment granules could be observed in cells). Then, 2 µCi/mL of 14C-tyrosine (Amersham Biosciences) was then added to each dish for an additional 24 hours. The bags were washed briefly twice with fresh EMEM, and the medium was then replaced with 1 mL of ice-cold 5% trichloroacetic acid (TCA). After 30 minutes, the TCA was removed from each well to determine cytosolic tyrosine levels. Then, 1 mL of 250 mM NaOH was added to each dish to digest the preparation and determine the radioisotope levels in the remaining fraction. Ten milliliters of scintillation fluid (HiSafe Supermix; PerkinElmer Life Sciences, Wellesley, MA) were then added to each scintillation vial and the samples assayed with a scintillation counter (PerkinElmer Life Sciences).

Transmission Electron Microscopy
The anterior epithelium and capsular bag specimens were fixed in 4% paraformaldehyde while they were attached to the Petri dish. They were then postfixed for 1 hour in 1% glutaraldehyde and for 30 minutes in osmium tetroxide (OsO4) in PBS, washed in PBS and dehydrated through graded alcohols, and soaked in propylene oxide (two times for 15 minutes each) before overnight infiltration in resin (Durcupan; Sigma-Aldrich, St. Louis, MO) and propylene oxide (1:1) followed by resin. Sections of 70-nm thickness were mounted onto copper grids and stained with 1% uranyl acetate and lead citrate before viewing in a transmission electron microscope (Tecnai 12; FEI, Hillsboro, OR) equipped with plates (model FDL5000; Fuji, Tokyo, Japan) which were scanned digitally (Ditabis, Pforzheim, Germany).

Statistical Analysis
All results are expressed as mean ± SEM. All experiments were performed on a matched-pair basis, with one donor eye serving as the control and the other eye from the same donor as the tested eye. Data were analyzed by a two-tailed t-test assuming equal variance. The level of significance was set as P ≤ 0.05.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
The data in Figure 1A show that messenger RNA for the Sigma-1 receptor was expressed in native human anterior and equatorial epithelial lens cells and expression was also retained in cells from a capsular bag recovered from a donor who had undergone cataract surgery (ex vivo bag). The growth of cells within the capsular bag cultured in vitro (Figs. 1B 1C 1D) shows the same pattern as found in vivo; in both cases, the posterior capsule was covered by a single monolayer of epithelial cells within approximately 14 days. The robust nature of this growth is shown by the fact that cell coverage occurred in vitro without the addition of serum or added growth factors. This robust growth was inhibited by the relatively nonselective Sigma antagonist rimcazole (Fig. 1B) , and we have further shown that the Sigma-1 selective antagonist BD104717 (10 µM) also inhibited growth (Fig. 1C) . Although the Sigma-2 receptor plays an important role in cell survival and growth in several systems,18 the sensitivity of lens cells to BD1047 indicates that the Sigma-1 receptor may play the more important role in lens cells. The Sigma receptor agonist (+)-SKF 10047 had no significant effect on growth when added alone (Fig. 1D) . Cell growth in human lens cells can be entirely suppressed and cell death induced by inactivating the endoplasmic reticulum (ER) calcium store,19 and it is interesting that the Sigma-1 receptor appears to be located primarily in this compartment.20 21 In fact, Sigma receptor agonists and antagonists have a profound, but complex, effect on calcium signaling,4 5 20 22 which could help to explain why growth ultimately ceased and cells on the posterior capsule regressed when exposed to rimcazole or BD1047 for long periods (data not shown). Consistent with a role for calcium in Sigma-antagonist–mediated lens cell growth inhibition, we have recently found that rimcazole empties the ER store in human lens cells (Collison DJ, Wang L, Duncan G, unpublished data, 2003). In addition, Sigma-1 receptor stimulation appears to be anti-apoptotic,5 and antagonists such as BD1047 would therefore be expected ultimately to induce cell death.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 1. Sigma-1 receptor expression and growth control. (A) Expression of Sigma-1 receptor mRNA in lens central epithelium (CE), equatorial epithelium (EE), and in vivo capsular bags (CB). (B, C) Effect of the antagonists rimcazole and BD1047 on the growth of cells across the posterior capsule. (D) Effect of the Sigma agonist SKF10047on cell cover. (BD) 100% represents cell confluence on the posterior capsule. The data at each time point are expressed as mean ± SE (n = 4).

 
The retardation of growth on the posterior capsule generally took 7 days to become apparent, and during that time the cells became increasingly pigmented (Fig. 2A) . Control cells, on the contrary, remained quite clear. Confluent anterior cells and actively growing posterior cells both underwent pigmentation. When the antagonist-treated cells were viewed using the transmission electron microscope (Fig. 2B) , the pigment was seen to be packaged in vesicles and appeared to follow the same developmental progression (stages 1–1V) as in MNT-1 melanoma cells (Fig. 2C) .23



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 2. Sigma-1 receptor and pigmentation of lens cells. (A) Phase micrographs of cultured human lens cells on central anterior and posterior capsule, respectively. The capsular bags were maintained in serum-free or supplemented (3 µM rimcazole) medium for 1 week, and at this time dark pigmented areas (arrowheads) were apparent in the treated bags. (B, C) Electron micrographs of cells on the posterior capsule. (B) Cross-sections of human lens epithelial cells grown (Ba) in control medium and (Bb) in the presence of 3 µM BD1047. (C) Different stages of pigment granule formation (I–IV) as defined in MNT-1 melanoma cells by Seiji et al.23

 
The first stages of melanin synthesis involve the incorporation of tyrosine into the cell, and whereas rimcazole had no effect on uptake of labeled tyrosine into the freely exchanging pool (data not shown), it induced a significant increase in incorporation into the TCA precipitable fraction of match-paired capsular bags (Fig. 3B) , indicating that it may be incorporated into melanin. We therefore investigated the expression of other critical components of the tyrosine-melanin pathway (Fig. 3A) 24 —specifically, TYR, TYRP1, and TYRP2. Surprising in an optically clear tissue such as the lens was that all three components were found to be present. Figure 3C gives the comparison of the expression of these proteins with two heavily pigmented cell types: human RPE cells (lane 2) and the melanoma cell line A2508 (lane 3). The non–lens cells appear to have associated higher molecular weight species that probably reflect posttranslational modification of the original proteins. It should be noted that Zhao and Overbeek25 failed to detect mRNA transcripts for TYRP2 in the developing murine lens. This discrepancy may reflect species differences or indeed a low level of gene activity relative to protein levels.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 3. Effect of Sigma-1 receptor antagonism on components of the melanin synthesis pathway. (A) The melanin synthesis pathway. The critical steps involving tyrosine, TYR, TYRP1, and TYRP2 are indicated. (B) The effect of 3 µM rimcazole on 14C-tyrosine incorporation into protein in human lens epithelial cells over 24 hours. Data are expressed as a percentage of control incorporation and are given as mean ± SEM (n = 6). *P < 0.05; t-test. (C) Immunoblots giving the expression of TYR, TYRP1, and TYRP2 in (lane 1) freshly-isolated native human lens cells, (lane 2) freshly isolated RPE cells, and (lane 3) the melanoma cell line A2508. Numbers to the left indicate the molecular size (in kilodaltons) of the protein marker. (D) The effect of 3 µM rimcazole on the expression of TYR, TYRP1, and TYRP2 in human lens epithelial cells by Western blot. Pooled data are given as the mean ± SEM (n = 4). *P < 0.05; paired t-test. Representative immunoblots for TYR, TYRP1, TYRP2, and ß-actin are also shown.

 
Pigment granules are present in capsular bag cells after 5 days of exposure to 3 µM rimcazole and the protein expression data obtained at this time reveal a significant upregulation of TYR and TYRP1 (Fig. 3D) . In these experiments, it was invaluable to be able to carry them out in a matched paired format. Although there was variation from donor to donor, the immunoblots from the rimcazole-treated epithelia for TYR and TYRP1 always gave a higher absorbance value than those from the control samples.


    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
The growth data in Figure 1 confirm the conclusions of Spruce et al.,5 drawn from experiments on cultured bovine cells, that the lens is unusually sensitive to Sigma receptor antagonism. Untransformed cells are not usually influenced by these antagonists, and Spruce et al.5 ascribed the sensitivity of lens and microvascular endothelial cells to their self-reliant, autocrine mode of survival. We have recently shown that human lens cells grown on the posterior capsule not only survive but actively proliferate in growth-factor–free EMEM.9 The molecular mechanisms for the growth inhibition are unknown, but they are believed to involve calcium signaling, channel modulation, and eventual apoptosis.2 5 26 Although human lens cells exposed to rimcazole for prolonged periods ultimately die, they appear to undergo all the normal processes of melanin production23 27 before they do so. Stage 1 is initiated in the ER,28 and the progression to the fibrillar stage appears to involve both TYRP1 and -2. Once the fibrillar matrix has been generated, melanin synthesis is initiated and electron-dense pigment becomes deposited on the fibrils. TYR plays a critical role at this time. The availability of tyrosine itself is also important, and there is evidence that tyrosine levels can control the proliferative activity of pigmented cells.29 High levels of tyrosine inhibit proliferation and increase the proportion of pigmented, highly differentiated cells. It should be noted that Spruce et al.5 failed to report a similar pigmentation in bovine cells exposed to rimcazole, but they used higher concentrations of rimcazole, inducing rapid cell death and did not perform the detailed phase and EM studies necessary to establish the presence of pigment granules.

It is now accepted that several factors increase pigmentation of melanoma cells, and these include an upregulation of TYR and the tyrosine-related proteins.14 27 Conversely, oculocutaneous albinism, an ER retention disease, involves mutations of either TYR or TYRP1.11 Human lens cells not only express TYR, TYRP1, and TYRP2, but the Sigma antagonist rimcazole significantly increased the expression of two of these. Furthermore, both Sigma antagonists increased pigment granule production in capsular bag cells. The human lens, therefore, has the potential, throughout life, to produce pigment granules but does not except under certain special circumstances. The data presented herein, suggest that one function of Sigma receptors could be to modulate pigment formation. Their location in the ER and their possible role in protein trafficking20 indicate that they could control both proliferation, which in the human lens is critically dependent on a functional calcium store19 and also melanin production, which initiates in the ER.28 Iris pigmentation is increased on exposure to PGF2{alpha} ligands,30 and tyrosinase expression is upregulated in cultures of iris cells exposed to latanoprost, a PGF2{alpha} receptor agonist.31 Furthermore, this receptor signals by releasing calcium from the ER.

The question remains as to why the lens expresses elements of the potentially damaging melanin biosynthesis pathway. In fact, the original investigators of both cataracta nigra (Fig. 4) and age-related axial pigmentation of the human lens suggested a possible explanation.10 Although they did not know the source of the pigment granules they identified, the authors proposed that it might be within the lens itself and argued that, if this were the case, the lens must possess at least some of the enzymes involved in melanin synthesis (Fig. 3A) . They also pointed out that most of the melanin precursors are actually powerful antioxidants10 and so could play a protecting role. In this context, it is known that skin or RPE cells respond to photo-oxidation insults by increasing melanin production.13 The cataracta nigra lens illustrated in Figure 4 shows that the black pigmentation of the anterior portion of the lens accompanies a dense brunescent nuclear cataract. In nuclear cataract, the central regions of the lens have a high concentration of oxidized methionine and glutathione, as well as protein-mixed disulfides, all indicating prolonged oxidative insults to the lens.33 The lens becomes increasingly brunescent with age and browning via the Maillard reaction,34 and tryptophan oxidation6 undoubtedly contributes to this process, which is accelerated in nuclear cataract.34 Intriguingly, the melanin synthesis pathway can also produce brunescent products in the presence of free sulfhydryl groups.35 Pirie36 has pointed out that exposure of lens proteins to oxidized tyrosine itself can produce brunescent products. An increasing activation of the tyrosine-melanin synthesis pathway has thus the potential to explain not only cataracta nigra, but also the brunescent pigmentation in the much more common age-related nuclear cataract.10 34 36



View larger version (94K):
[in this window]
[in a new window]
 
FIGURE 4. Section through a cataracta nigra lens removed by cryoprobe attached to the anterior surface (uppermost) followed by intracapsular extraction. The lens (1.1 cm in diameter) was frozen at –20°C immediately after surgery and later bisected, thawed at ambient temperature (18°C), and photographed. This lens was in fact processed as part of a past comparative cataract study involving the photography of lenses in vivo and in vitro.32 The data were not used, as the patient could not focus for comparative in vivo photography.

 
Sigma receptors of different subtypes appear to act in opposite ways to regulate apoptosis. Sigma-1 receptors appear to be antiapoptotic, whereas Sigma-2 receptors are proapoptotic,5 18 and Sigma-1 receptors may also be involved in neuroprotection.37 The Sigma-1 knockout mouse shows no abnormal phenotype and behaves in a manner similar to their control littermates. However, they show different physiological responses when stressed,38 and this may also be critical in the lack of induction in lens changes. We cannot unequivocally propose a Sigma-1-specific role for the antagonist effects that we observe, as we cannot exclude that the Sigma-2 receptor may be present in the human lens. Until this receptor is cloned and sequenced and the appropriate reagents are available this, will have to remain unresolved. However, we have established the presence of Sigma-1 and have found that the Sigma-1-specific antagonist BD1047 induces pigmentation. We therefore suggest that the Sigma-1 receptor has an important protective role in minimizing the harmful effects of photo-oxidation. In cells where the melanin pathway has been upregulated, it is crucial to distribute correctly the enzyme components if full melanin synthesis is not to be the result. Sigma-1 ligands are known to disrupt the dynamic relationship of the receptor with the ER,20 and this we propose links the unscheduled production of pigment granules with inhibition of cell growth.


    Acknowledgements
 
The authors thank Michael Wormstone for helpful discussions on all aspects of the work, Ian Clark for providing the melanoma cell line (A2058), and John James (Centre for High-resolution Imaging; CHIPS) for technical assistance.


    Footnotes
 
Supported by The Humane Research Trust, The Royal Society, Fight for Sight, and The Wellcome Trust.

Submitted for publication October 12, 2004; revised December 17, 2004; accepted January 7, 2005.

Disclosure: L. Wang, None; A.R. Prescott, None; B.A. Spruce, None; J. Sanderson, None; G. Duncan, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: George Duncan, School of Biological Sciences, University of East Anglia, Norwich NR4 7TJ, UK; g.duncan{at}uea.ac.uk.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. Quirion R, Bowen WD, Itzhak Y, et al. A proposal for the classification of sigma binding sites. Trends Pharmacol Sci. 1992;13:85–86.[CrossRef][Medline][Order article via Infotrieve]
  2. Brent PJ, Pang GT. Sigma binding site ligands inhibit cell proliferation in mammary and colon carcinoma cell lines and melanoma cells in culture. Eur J Pharmacol. 1995;278:151–160.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  3. John CS, Vilner BJ, Geyer BC, Moody T, Bowen WD. Targeting Sigma receptor-binding benzamides as in vivo diagnostic and therapeutic agents for human prostate tumors. Cancer Res. 1999;59:4578–4583.[Abstract/Free Full Text]
  4. Brent PJ, Herd L, Saunders H, Sim AT, Dunkley PR. Protein phosphorylation and calcium uptake into rat forebrain synaptosomes: modulation by the sigma ligand, 1,3-ditolylguanidine. J Neurochem. 1997;68:2201–2211.[Web of Science][Medline][Order article via Infotrieve]
  5. Spruce BA, Campbell LA, McTavish N, et al. Small molecule antagonists of the {sigma}-1 receptor cause selective release of the death program in tumor and self-reliant cells and inhibit tumor growth in vitro and in vivo. Cancer Res. 2004;64:4875–4886.[Abstract/Free Full Text]
  6. Harding J. Cataract. 1991; Chapman & Hall London.
  7. Wormstone IM. Posterior capsule opacification: a cell biological perspective. Exp Eye Res. 2002;74:337–347.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  8. Shamsul Ola M, Moore P, El-Sherbeny A, et al. Expression pattern of sigma receptor 1 mRNA and protein in mammalian retina. Brain Res Mol Brain Res. 2001;95:86–95.[Medline][Order article via Infotrieve]
  9. Wormstone IM, Liu CS, Rakic JM, Marcantonio JM, Vrensen GF, Duncan G. Human lens epithelial cell proliferation in a protein-free medium. Invest Ophthalmol Vis Sci. 1997;38:396–404.[Abstract/Free Full Text]
  10. Duke-Elder S. Diseases of the lens and vitreous. System of Ophthalmology. 1969;11 H Kimpton London.
  11. Toyofuku K, Wada I, Valencia JC, Kushimoto T, Ferrans VJ, Hearing VJ. Oculocutaneous albinism types 1 and 3 are ER retention diseases: mutation of tyrosinase or Tyrp1 can affect the processing of both mutant and wild-type proteins. FASEB J. 2001;15:2149–2161.[Abstract/Free Full Text]
  12. Forrester JV, Dick AD, McMenamin PG, Lee WR. The Eye. 2002; 2nd ed. Saunders, Elsevier Science Ltd New York.
  13. Hirobe T, Kawa Y, Mizoguchi M, Ito S, Wakamatsu K. Effects of genic substitution at the pink-eyed dilution locus on the proliferation and differentiation of mouse epidermal melanocytes in vivo and in vitro. J Exp Zool. 2002;292:351–366.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  14. Hochberg M, Lotem M, Gimon Z, Shiloni E, Enk CD. Expression of tyrosinase, MIA and MART-1 in sentinel lymph nodes of patients with malignant melanoma. Br J Dermatol. 2002;146:244–249.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  15. Liu CS, Wormstone IM, Duncan G, Marcantonio JM, Webb SF, Davies PD. A study of human lens cell growth in vitro: a model for posterior capsule opacification. Invest Ophthalmol Vis Sci. 1996;37:906–914.[Abstract/Free Full Text]
  16. Maidment JM, Duncan G, Tamiya S, Collison DJ, Wang L, Wormstone IM. Regional differences in tyrosine kinase receptor signaling components determine differential growth patterns in the human lens. Invest Ophthalmol Vis Sci. 2004;45:1427–1435.[Abstract/Free Full Text]
  17. Matsumoto RR, Bowen WD, Tom MA, Vo VN, Truong DD, De Costa BR. Characterization of two novel sigma receptor ligands: antidystonic effects in rats suggest sigma receptor antagonism. Eur J Pharmacol. 1995;280:301–310.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  18. Crawford KW, Bowen WD. Sigma-2 receptor agonists activate a novel apoptotic pathway and potentiate antineoplastic drugs in breast tumor cell lines. Cancer Res. 2002;62:313–322.[Abstract/Free Full Text]
  19. Duncan G, Wormstone IM, Liu CS, Marcantonio JM, Davies PD. Thapsigargin-coated intraocular lenses inhibit human lens cell growth. Nat Med. 1997;3:1026–1028.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  20. Hayashi T, Su TP. Regulating ankyrin dynamics: roles of sigma-1 receptors. Proc Natl Acad Sci USA. 2001;98:491–496.[Abstract/Free Full Text]
  21. Hanner M, Moebius FF, Flandorfer A, et al. Purification, molecular cloning, and expression of the mammalian sigma1-binding site. Proc Natl Acad Sci USA. 1996;93:8072–8077.[Abstract/Free Full Text]
  22. Hayashi T, Kagaya A, Takebayashi M, et al. Modulation by sigma ligands of intracellular free Ca++ mobilization by N-methyl-D-aspartate in primary culture of rat frontal cortical neurons. J Pharmacol Exp Ther. 1995;275:207–214.[Abstract/Free Full Text]
  23. Seiji M, Iwashita S. On the site of melanin formation in melanocytes. J Biochem (Tokyo). 1963;54:465–467.[Free Full Text]
  24. Korner A, Pawelek J. Mammalian tyrosinase catalyzes three reactions in the biosynthesis of melanin. Science. 1982;217:1163–1165.[Abstract/Free Full Text]
  25. Zhao S, Overbeek PA. Tyrosinase-related protein 2 promoter targets transgene expression to ocular and neural crest-derived tissues. Dev Biol. 1999;216:154–163.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  26. Aydar E, Palmer CP, Djamgoz MB. Sigma receptors and cancer: possible involvement of ion channels. Cancer Res. 2004;64:5029–5035.[Abstract/Free Full Text]
  27. Watabe H, Valencia JC, Yasumoto K, et al. Regulation of tyrosinase processing and trafficking by organellar pH and by proteasome activity. J Biol Chem. 2004;279:7971–7981.[Abstract/Free Full Text]
  28. Kushimoto T, Valencia JC, Costin GE, et al. The Seiji memorial lecture: the melanosome: an ideal model to study cellular differentiation. Pigment Cell Res. 2003;16:237–244.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  29. Schwahn DJ, Xu W, Herrin AB, Bales ES, Medrano EE. Tyrosine levels regulate the melanogenic response to alpha-melanocyte-stimulating hormone in human melanocytes: implications for pigmentation and proliferation. Pigment Cell Res. 2001;14:32–39.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  30. Drago F, Marino A, La Manna C. alpha-Methyl-p-tyrosine inhibits latanoprost-induced melanogenesis in vitro. Exp Eye Res. 1999;68:85–90.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  31. Lindsey JD, Jones HL, Hewitt EG, Angert M, Weinreb RN. Induction of tyrosinase gene transcription in human iris organ cultures exposed to latanoprost. Arch Ophthalmol. 2001;119:853–860.[Abstract/Free Full Text]
  32. Marcantonio JM, Duncan G, Davies PD, Bushell AR. Classification of human senile cataracts by nuclear colour and sodium content. Exp Eye Res. 1980;31:227–237.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  33. Truscott RJ, Augusteyn RC. Oxidative changes in human lens proteins during senile nuclear cataract formation. Biochim Biophys Acta. 1977;492:43–52.[Medline][Order article via Infotrieve]
  34. Monnier VM, Kohn RR, Cerami A. Accelerated age-related browning of human collagen in diabetes mellitus. Proc Natl Acad Sci USA. 1984;81:583–587.[Abstract/Free Full Text]
  35. Barsh GS. What controls variation in human skin color?. Public Library of Science Biology. 2003;1:19–22.
  36. Pirie A. Reaction of tyrosine oxidation products with proteins of the lens. Biochem J. 1968;109:301–305.[Web of Science][Medline][Order article via Infotrieve]
  37. Martin PM, Ola MS, Agarwal N, Ganapathy V, Smith SB. The sigma receptor ligand (+)-pentazocine prevents apoptotic retinal ganglion cell death induced in vitro by homocysteine and glutamate. Brain Res Mol Brain Res. 2004;123:66–75.[Medline][Order article via Infotrieve]
  38. Langa F, Codony X, Tovar V, et al. Generation and phenotypic analysis of sigma receptor type I (sigma 1) knockout mice. Eur J Neurosci. 2003;18:2188–2196.[CrossRef][Web of Science][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
IOVSHome page
K. T. Tchedre and T. Yorio
{sigma}-1 Receptors Protect RGC-5 Cells from Apoptosis by Regulating Intracellular Calcium, Bax Levels, and Caspase-3 Activation
Invest. Ophthalmol. Vis. Sci., June 1, 2008; 49(6): 2577 - 2588.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
L. M. Hodgkinson, G. Duncan, L. Wang, C. J. Pennington, D. R. Edwards, and I. M. Wormstone
MMP and TIMP Expression in Quiescent, Dividing, and Differentiating Human Lens Cells
Invest. Ophthalmol. Vis. Sci., September 1, 2007; 48(9): 4192 - 4199.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, L.
Right arrow Articles by Duncan, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, L.
Right arrow Articles by Duncan, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS